Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2006 Sep;44(9):3422–3425. doi: 10.1128/JCM.01269-06

Antibiotic Susceptibility and Molecular Diversity of Bacillus anthracis Strains in Chad: Detection of a New Phylogenetic Subgroup

Angaya Maho 1, Alexandra Rossano 2, Herbert Hächler 2,3,†, Anita Holzer 2,3, Esther Schelling 4, Jakob Zinsstag 4, Mahamat H Hassane 1, Bhen S Toguebaye 5, Ayayi J Akakpo 6, Matthew Van Ert 7, Paul Keim 7,8, Leo Kenefic 7, Joachim Frey 2,3, Vincent Perreten 2,*
PMCID: PMC1594716  PMID: 16954291

Abstract

We genotyped 15 Bacillus anthracis isolates from Chad, Africa, using multiple-locus variable-number tandem repeat analysis and three additional direct-repeat markers. We identified two unique genotypes that represent a novel genetic lineage in the A cluster. Chadian isolates were susceptible to 11 antibiotics and free of 94 antibiotic resistance genes.


Bacillus anthracis, the etiological agent of anthrax, is a sporulating bacterium causing disease primarily in herbivores in many countries of Southern Europe, South America, Asia, and Africa (22). In Chad, anthrax is hyperendemic in cattle (22), and human cases of intestinal and cutaneous anthrax are reported each year (World Anthrax Data Site [http://www.vetmed.lsu.edu/whocc/]). However, studies of the genetic diversity and antibiotic susceptibilities of B. anthracis in this country have not been conducted. Here, we used a previously reported eight-marker multiple-locus variable-number tandem repeat (VNTR) analysis (MLVA) method (13) and three additional direct-repeat (DR) markers (15) to examine the genetic diversity of this pathogen in Chad. We also evaluated the Chadian B. anthracis isolates for antibiotic resistance by using physiological and genetic methods.

Between 1996 and 2003, 174 blood samples were taken from the heart region or jugular vein of cattle carcasses in five southern prefectures in Chad. The samples were screened for B. anthracis by cultivation on tryptone soy agar plates containing 5% sheep blood. After incubation at 37°C for 48 h, cultures from 15 samples were identified as B. anthracis on the basis of colony morphology, absence of hemolysis, and susceptibility to B. anthracis-specific γ phage (2, 21). These cultures were sent to the Swiss Reference Centre (Bern, Switzerland) for further physiological and genetic testing.

Template DNA for PCR was obtained by cell lysis followed by filtration (18). PCRs were performed using Taq DNA polymerase (Roche Diagnostics, Basel, Switzerland) and an annealing temperature of 55°C if not otherwise specified. We used PCR to screen the samples for the presence of B. anthracis chromosomal (Ba813) and plasmid (pXO1 and pXO2) sequences (see Table 1 for PCR targets and primer sequences). Eight VNTR markers, vrrA, vrrB1, vrrB2, vrrC1, vrrC2, CG3, pXO1-aaT, and pXO2-at, were amplified by PCR according to the method of Keim et al. (13) and sequenced on an ABI Prism 3100 genetic analyzer (Applied Biosystems, Foster City, CA) with dRhodamine-labeled terminators. The sizes of the VNTR amplicons were compared to previously published allele sizes (13, 20) as well as to the 11 B. anthracis strain genome sequences from GenBank (http://www.ncbi.nlm.nih.gov).

TABLE 1.

List of the oligonucleotide primers used for B. anthracis strain identification and differentiation

Gene/locus Primer Oligonucleotide sequence (5′ to 3′) Reference
pag (pXO1) PA5 TCCTAACACTAACGAAGTCG 1, 22
PA8 GAGGTAGAAGGATATACGGT
capB (pXO2) 1234 CTGAGCCATTAATCGATATG 12, 22
1301 TCCCACTTACGTAATCTGAG
Ba813 R1 TTAATTCACTTGCAACTGATGGG 17
R2 AACGATAGCTCCTACATTTGGAG
AA03 AA032 TTAGCGCCCCCTTGCGTTCC 15
AA033 TTAGCGCCCCTAGACCAATTGC
AJ03 AJ035 AGCACCTCGTTCATGCTCATAACGG 15
AJ036 AGCACCTCGTCTACTTCATTTTGTGC
AT07 AT073 CTCCTCAAATTACTAAAATGAAACC 15
AT074 TTGGCATAGACGTATATTGCGGTCC
vrrA vrrA-f1 CACAACTACCACCGATGGCACA 13
vrrA-r1 GCGCGTTTCGTTTGATTCATAC
vrrB1 vrrB1-f1 ATAGGTGGTTTTCCGCAAGTTATTC 13
vrrB1-r1 GATGAGTTTGATAAAGAATAGCCTGTG
vrrB2 vrrB2-f1 CACAGGCTATTCTTTATCAAACTCATC 13
vrrB2-r1 CCCAAGGTGAAGATTGTTGTTGA
vrrC1 vrrC1-f1 GAAGCAAGAAAGTGATGTAGTGGAC 13
vrrC1-r1 CATTTCCTCAAGTGCTACAGGTTC
vrrC2 vrrC2-f1 CCAGAAGAAGTGGAACCTGTAGCAC 13
vrrC2-r1 GTCTTTCCATTAATCGCGCTCTATC
CG3 CG3-f1 TGTCGTTTTACTTCTCTCTCCAATAC 13
CG3-r1 AGTCATTGTTCTGTATAAAGGGCAT
pXO1-aat pXO1-AAT-f3 CAATTTATTAACGATCAGATTAAGTTCA 13
pXO1-AAT-r3 TCTAGAATTAGTTGCTTCATAATGGC
pXO2-at pXO2-AT-f1 TCATCCTCTTTTAAGTCTTGGGT 13
pXO2-AT-r1 GTGTGATGAACTCCGACGACA

Since comparisons of the sequence sizes to the fragment size data revealed minor size discrepancies (1 bp for vrrA, 3 bp for vrrC1, and a previously reported 3-bp shift in the pXO1 size [P. Keim, personal communication] [6]), MLVA-8 fragment analysis of 88 diverse genotypes (13) and two Chadian isolates (isolate ChadA1, group VII, and isolate ChadA8, group VIII) was performed in the Keim genetics laboratory (Northern Arizona University) to ensure the comparability and accuracy of the raw VNTR scores from the Chadian strains with reference to those from the genotypes published by Keim et al. in 2000 (13) (Fig. 1).

FIG. 1.

FIG. 1.

Dendrogram based on MLVA of eight markers of Chadian B. anthracis strains and the diverse 88 genotypes reported by Keim et al. (13). The dendrogram was generated by clustering using the unweighted-pair group method with arithmetic means. Note that genotype 25 has been removed from the analysis since this strain no longer possesses the pXO2 plasmid, resulting in missing data in the MLVA.

Three additional DR regions of the B. anthracis chromosome (markers AJ03, AA03, and AT07) were amplified by PCR as described previously (15), except that an annealing temperature of 45°C was used. The sequences for the different markers were compared to each other by multiple sequence alignment with ClustalW (http://www.ch.embnet.org) and the numbers of DRs determined (Table 2). The Sterne strain NCTC8234 was used as a control, and the positions of the DRs were matched to the complete nucleotide (nt) sequence of this strain (GenBank accession no. AE017225). In the Sterne strain, the AJ03 marker is characterized by a succession of two 40-bp DRs (1092652CGAT-32 nt-GCGC1092731), the AA03 by a succession of three slightly imperfect repeats (1721256TTCA-61/62/63 nt-TTAG1721502), and the AT07 marker by a succession of seven 39-bp DRs (4234463ACTA-31 nt-TGAT4234735).

TABLE 2.

Genetic diversity and antibiotic susceptibilities of B. anthracis strains from different regions in Chad

Strain(s) Geographical origin
Allele size (bp)b for indicated MVLA-8 marker
Cluster No. of DRs for indicated RAPDc marker
Groupd Antibiotic MIC (μg/ml)e
Town/village Prefecture (regiona) vrrA vrrB1 vrrB2 vrrC1 vrrC2 CG3 pXO1 pXO2 AA03 AJ03 AT07 GEN ERY CLI SYN TET CHL CIP XNL VAN PEN AMC
ChadA1 N'Djamena Chari Baguirmi (CW) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 2 <1 4 <0.25 8 2 <0.12 2/1
ChadA2 N'Djamena Chari Baguirmi (CW) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 2 <1 4 <0.25 8 2 <0.12 2/1
ChadA3 Massakory Chari Baguirmi (CW) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 1 <1 4 <0.25 8 2 <0.12 2/1
ChadA4 Dourbali Chari Baguirmi (CW) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 2 <1 4 <0.25 8 2 <0.12 2/1
ChadA5 Karal Chari Baguirmi (CW) 290 229 171 616 604 158 123 133 Aβ 2 4 5 VIII <1 1 0.5 2 <1 8 <0.25 8 2 <0.12 2/1
ChadA6 Am-Timan Salamat (CE) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 2 <1 4 <0.25 8 2 <0.12 2/1
ChadA7 Bongor Mayo Kebbi (SW) 290 229 171 616 604 158 123 133 Aβ 2 4 5 VIII <1 1 0.5 1 <1 8 <0.25 8 2 <0.12 2/1
ChadA8 Koumra Moyen-Chari (SE) 290 229 171 616 604 158 123 133 Aβ 2 4 5 VIII <1 1 0.5 1 <1 8 <0.25 8 2 <0.12 2/1
ChadA9 Massenya Chari Baguirmi (CW) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 1 <1 4 <0.25 8 2 <0.12 2/1
ChadA10 Bitkine Guera (C) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 0.5 0.5 1 <1 4 <0.25 8 2 <0.12 2/1
ChadA11 Mandelia Chari Baguirmi (CW) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 2 <1 4 <0.25 8 2 <0.12 2/1
ChadA12 Bongor Mayo Kebbi (SW) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 1 <1 4 <0.25 8 2 <0.12 2/1
ChadA13 Moîssala Moyen-Chari (SE) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 0.5 0.5 1 <1 8 <0.25 8 2 <0.12 2/1
ChadA14 Bongor Mayo Kebbi (SW) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 1 <1 8 <0.25 8 2 <0.12 2/1
ChadA15 Karal Chari Baguirmi (CW) 290 229 171 616 604 158 123 133 Aβ 2 2 5 VII <1 1 0.5 1 <1 4 <0.25 8 2 <0.12 2/1
NCTC8234f 314 (313) 229 (229) 162 (162) 580 (583) 532 (532) 158 (158) 132 (129) 3 2 7 II <1 1 <0.25 1 <1 8 <0.25 8 2 <0.12 2/1
All Chadian strains (289) (229) (171) (613) (604) (158) (120) (133) Aβ
a

C, central; CW, central west; CE, central east; SW, southwest; SE, southeast.

b

Values in parentheses indicate allele sizes determined following correction and normalization. The sizes of the alleles are based on their effective lengths in base pairs determined by sequence analysis, since discrepancies exist between the sizes determined by MLVA fragment analysis (14) and the real sizes of alleles vrrA (290 versus 289 bp for the Chadian strains and 314 versus 313 bp for the Sterne strain), vrrC1 (616 versus 613 bp for the Chadian strains and 580 versus 583 bp for the Sterne strain), and pXO1 (123 versus 120 bp for the Chadian strains and 132 versus 129 bp for the Sterne strain).

c

RAPD, random amplified polymorphic DNA.

d

The groups are based on the numbers of DRs in markers AA03, AJ03, and AT07 according to the classification of Levy et al. (15); groups VII and VIII are new groups.

e

MICs were determined in duplicate, and the MIC interpretive standards were those recommended in CLSI supplement M100-S15 (8). Antibiotics: GEN, gentamicin; ERY, erythromycin; CLI, clindamycin, SYN, quinupristin-dalfopristin; TET, tetracycline; CHL, chloramphenicol; CIP, ciprofloxacin; XNL, ceftiofur; VAN, vancomycin; PEN, penicillin; AMC, amoxicillin-clavulanic acid. The CLSI susceptibility breakpoints are as follows: for GEN, ≤4; for ERY, ≤0.5; for CLI, ≤0.5; for SYN, ≤1; for TET, ≤1; for CHL, ≤8; for CIP, ≤0.5; for VAN, ≤4; for PEN, ≤0.12; for AMC, ≤4/2. The CLSI susceptibility breakpoints for TET, CIP, and PEN are those recommended in CLSI supplement M100-S15 (8). For GEN, ERY, CLI, SYN, CHL, VAN, and AMC, S. aureus susceptibility breakpoints are suggested since no susceptibility breakpoints were available for B. anthracis in the CLSI supplement (3, 4, 16). No CLSI criteria for susceptibility were available for XNL. The CLSI resistance breakpoints are as follows: for GEN, ≥16; for ERY, ≥8; for CLI, ≥4; for SYN, ≥4; for CHL, ≥32; for VAN, ≥32; for PEN, ≥0.25; for AMC, ≥8/4. The resistance breakpoint for PEN is that recommended in CLSI supplement M100-S15 (8). For GEN, ERY, CLI, SYN, CHL, VAN, and AMC, S. aureus resistance breakpoints are suggested since no resistance breakpoints were available for B. anthracis in the CLSI supplement (3, 14, 16). No CLSI criteria for resistance were available for TET, CIP, or XNL.

f

The vaccine strain Sterne 34F2 (NCTC8234) was used as a control.

The antibiotic susceptibilities of the Chadian B. anthracis isolates were measured in Müller-Hinton broth by using custom Sensititre susceptibility plates (Trek Diagnostics Systems, East-Grinstead, England, and MCS Diagnostics BV, JL Swalmen, The Netherlands), according to the CLSI guidelines (7). To exclude the possibility that Chadian B. anthracis isolates possessed antibiotic resistance genes that were not phenotypically expressed in vitro, we screened for the presence of 94 gram-positive bacterial antibiotic resistance genes using a microarray (18).

PCR analysis revealed that the 15 isolates were B. anthracis and positive for the pXO1 and pXO2 plasmids. The fragment sizes and DNA sequences for the eight MLVA markers were identical in all Chadian strains. The effective sizes and the corrected, normalized scores for the eight MLVA alleles of the Chadian strains are listed in Table 2. Of note, this is the first report of a 133-bp allele in pXO2. Analysis by unweighted-pair group method using average linkages clustered samples into a new genetic group in the A branch according to Keim's classification system (Aβ) (Fig. 1) (13). We used the system proposed by Levy et al. (15) to classify the 15 B. anthracis isolates into two different, novel genotypic groups (VII and VIII) (Table 2). These groups are new since this combination of DRs within the three markers has yet to be reported for B. anthracis, and the five-DR pattern in the AT07 marker in all Chadian strains is unique. We found no obvious geographic clustering of group VII and VIII strains (Fig. 2).

FIG. 2.

FIG. 2.

Geographical and genetic distribution of B. anthracis in the different prefectures of Chad. Frequency of occurrence of B. anthracis in the different prefectures is indicated by different gray patterns. The numbers of strains isolated in the different town/village areas (▪) appear in parentheses after the respective names. The distribution of the two different genotypic groups VII and VIII within the prefectures is indicated in parentheses in the figure panel.

The Chadian isolates were susceptible to the antibiotics tested but displayed decreased susceptibilities to ceftiofur, erythromycin, and the combination quinupristin-dalfopristin and a slightly higher MIC for clindamycin (MIC, 0.5 μg/ml) than the Sterne strain NCTC8234 (Table 2).

Microarray-based analysis revealed that the strains were free of all antibiotic resistance genes tested except the β-lactamase genes bla1 and bla2, which are endogenous to B. anthracis but are not expressed (5).

This study is the first to describe the genetic and physiological attributes of B. anthracis strains in Chad. Certainly, this region of Africa has been underrepresented in previous studies of the global genetic diversity of B. anthracis (13). On a regional level, the identical MLVA genotypes of the Chadian strains indicate a high degree of genetic similarity among B. anthracis isolates within the country. This is supported by the existence of only two unique, closely related strains identified by the three additional DR markers (groups VII and VIII) and the absence of antibiotic resistance genes in all the tested isolates. Similarly, our data suggest a low level of phenotypic diversity as it relates to antibiotic resistance. The finding that Chadian isolates were susceptible to 11 antibiotics and free of antibiotic resistance genes is significant from a public health perspective and can be used for therapeutic measures in the treatment of people affected with B. anthracis in this country.

From a global perspective, our MLVA and DR analysis showed that the Chadian strains displayed unique genetic signatures and are not closely related to any of the worldwide B. anthracis strains analyzed to date (6, 9, 10, 11, 13, 19, 20). Indeed, the long branch lengths of the Aβ group indicate a considerable degree of evolutionary divergence for these two strains from the remaining B. anthracis isolates in the A lineage (Fig. 1). In summary, our results provide a first look at the genetic diversity and antibiotic resistance patterns of this pathogen in Chad and can be useful for future epidemiological analyses of anthrax outbreaks in this region.

Acknowledgments

We thank Haim Levy for helpful advice and Jana U'Ren for technical assistance.

This work was partially supported by grant 4049-067448 from the National Research Programme NRP49 on antibiotic resistance of the Swiss National Science Foundation and by the Swiss Agency for Development and Cooperation for the training of Chadian capacity.

REFERENCES

  • 1.Beyer, W., P. Glöckner, J. Otto, and R. Böhm. 1995. A nested PCR method for the detection of Bacillus anthracis in environmental samples collected from former tannery sites. Microbiol. Res. 150:179-186. [DOI] [PubMed] [Google Scholar]
  • 2.Brown, E. R., and W. B. Cherry. 1955. Specific identification of Bacillus anthracis by means of a variant bacteriophage. J. Infect. Dis. 96:34-39. [DOI] [PubMed] [Google Scholar]
  • 3.Cavallo, J. D., F. Ramisse, M. Girardet, J. Vaissaire, M. Mock, and E. Hernandez. 2002. Antibiotic susceptibilities of 96 isolates of Bacillus anthracis isolated in France between 1994 and 2000. Antimicrob. Agents Chemother. 46:2307-2309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Centers for Disease Control and Prevention. 2001. Update: investigation of bioterrorism-related anthrax and interim guidelines for exposure management and antimicrobial therapy, October 2001. Morb. Mortal Wkly. Rep. 50:909-919. [PubMed] [Google Scholar]
  • 5.Chen, Y., J. Succi, F. C. Tenover, and T. M. Koehler. 2003. β-Lactamase genes of the penicillin-susceptible Bacillus anthracis Sterne strain. J. Bacteriol. 185:823-830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cheung, D. T., K. M. Kam, K. L. Hau, T. K. Au, C. K. Marston, J. E. Gee, T. Popovic, M. N. Van Ert, L. Kenefic, P. Keim, and A. R. Hoffmaster. 2005. Characterization of a Bacillus anthracis isolate causing a rare case of fatal anthrax in a 2-year-old boy from Hong Kong. J. Clin. Microbiol. 43:1992-1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Clinical and Laboratory Standards Institute. 2003. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 6th ed., vol. 23, no. 2. Approved standard M7-A6. Clinical and Laboratory Standards Institute, Wayne, Pa.
  • 8.Clinical and Laboratory Standards Institute. 2005. Performance standards for antimicrobial susceptibility testing; fifteenth informational supplement M100-S15, vol. 25, no. 1. Clinical and Laboratory Standards Institute, Wayne. Pa.
  • 9.Fasanella, A., M. Van Ert, S. A. Altamura, G. Garofolo, C. Buonavoglia, G. Leori, L. Huynh, S. Zanecki, and P. Keim. 2005. Molecular diversity of Bacillus anthracis in Italy. J. Clin. Microbiol. 43:3398-3401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fouet, A., K. L. Smith, C. Keys, J. Vaissaire, C. Le Doujet, M. Levy, M. Mock, and P. Keim. 2002. Diversity among French Bacillus anthracis isolates. J. Clin. Microbiol. 40:4732-4734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gierczynski, R., S. Kaluzewski, A. Rakin, M. Jagielski, A. Zasada, A. Jakubczak, B. Borkowska-Opacka, and W. Rastawicki. 2004. Intriguing diversity of Bacillus anthracis in eastern Poland—the molecular echoes of the past outbreaks. FEMS Microbiol. Lett. 239:235-240. [DOI] [PubMed] [Google Scholar]
  • 12.Hutson, R. A., C. J. Duggleby, J. R. Lowe, R. J. Manchee, and P. C. Turnbull. 1993. The development and assessment of DNA and oligonucleotide probes for the specific detection of Bacillus anthracis. J. Appl. Bacteriol. 75:463-472. [DOI] [PubMed] [Google Scholar]
  • 13.Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R. Okinaka, P. J. Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus variable-number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J. Bacteriol. 182:2928-2936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Keim, P., M. N. Van Ert, T. Pearson, A. J. Vogler, L. Y. Huynh, and D. M. Wagner. 2004. Anthrax molecular epidemiology and forensics: using the appropriate marker for different evolutionary scales. Infect. Genet. Evol. 4:205-213. [DOI] [PubMed] [Google Scholar]
  • 15.Levy, H., M. Fisher, N. Ariel, Z. Altboum, and D. Kobiler. 2005. Identification of strain specific markers in Bacillus anthracis by random amplification of polymorphic DNA. FEMS Microbiol. Lett. 244:199-205. [DOI] [PubMed] [Google Scholar]
  • 16.Mohammed, M. J., C. K. Marston, T. Popovic, R. S. Weyant, and F. C. Tenover. 2002. Antimicrobial susceptibility testing of Bacillus anthracis: comparison of results obtained by using the National Committee for Clinical Laboratory Standards broth microdilution reference and Etest agar gradient diffusion methods. J. Clin. Microbiol. 40:1902-1907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Patra, G., P. Sylvestre, V. Ramisse, J. Therasse, and J. L. Guesdon. 1996. Isolation of a specific chromosomic DNA sequence of Bacillus anthracis and its possible use in diagnosis. FEMS Immunol. Med. Microbiol. 15:223-231. [DOI] [PubMed] [Google Scholar]
  • 18.Perreten, V., L. Vorlet-Fawer, P. Slickers, R. Ehricht, P. Kuhnert, and J. Frey. 2005. Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J. Clin. Microbiol. 43:2291-2302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ryu, C., K. Lee, H. J. Hawng, C. K. Yoo, W. K. Seong, and H. B. Oh. 2005. Molecular characterization of Korean Bacillus anthracis isolates by amplified fragment length polymorphism analysis and multilocus variable-number tandem repeat analysis. Appl. Environ. Microbiol. 71:4664-4671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Smith, K. L., V. DeVos, H. Bryden, L. B. Price, M. E. Hugh-Jones, and P. Keim. 2000. Bacillus anthracis diversity in Kruger National Park. J. Clin. Microbiol. 38:3780-3784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Turnbull, P. C. 1999. Definitive identification of Bacillus anthracis—a review. J. Appl. Microbiol. 87:237-240. [DOI] [PubMed] [Google Scholar]
  • 22.World Health Organization. 1998. Guidelines for the surveillance and control of anthrax in humans and animals, 3rd ed. World Health Organization, Geneva, Switzerland.

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES