Epigenetic Histone Modifications Do Not Control Igκ Locus Contraction and Intranuclear Localization in Cells with Dual B Cell-Macrophage Potential

Abstract

Somatic rearrangement of the Ig genes during B cell development is believed to be controlled, at least in part, by accessibility of the loci to the recombinational machinery. Accessibility is poorly understood, but appears to be controlled by a combination of histone posttranslational modifications, large scale Ig locus contractions, and changes in intranuclear localization of the loci. These changes are regulated by developmental stage-specific as well as tissue-specific mechanisms. We previously isolated a murine B cell lymphoma line, Myc5, that can oscillate between the B cell and macrophage lineages depending upon growth conditions. This line provides an opportunity to study tissue-specific regulation of epigenetic mechanisms operating on the Ig loci. We found that when Myc5 cells are induced to differentiate from B cells into macrophages, expression of macrophage-specific transcripts was induced (M-CSFR, F4/80, and CD14), whereas B cell-specific transcripts decreased dramatically (mb-1, E47, IRF4, Pax5, and Igκ). Loss of Igκ transcription was associated with reduced Igκ locus contraction, as well as increased association with heterochromatin protein-1 and association of the Igκ locus with the nuclear periphery. Surprisingly, however, we found that histone modifications at the Igκ locus remained largely unchanged whether the cells were grown in vivo as B cells, or in vitro as macrophages. These results mechanistically uncouple histone modifications at the Igκ locus from changes in locus contraction and intranuclear localization.

Immunoglobulin genes are formed by the somatic assembly of variable (V), diversity (D), and joining (J) segments (V and J segments for L chain genes) (1). The somatic rearrangement process is highly regulated with H chain genes generally rearranging during the pro-B cell stage and L chain genes rearranging during the pre-B cell stage. The same recombination machinery is used for both H and L chain Ig genes, yet L chains do not rearrange in pro-B cells when the H chain locus is undergoing rearrangement. It is believed that each locus is differentially accessible to the recombination machinery partly due to modifications of histones packing the locus (2). Differences in H3 and H4 acetylation and methylation have been observed at the Ig loci and these modifications are believed to be part of the locus accessibility mechanism (3).

At the pro-B cell stage, V_H genes are associated with hyperacetylated histones H3 and H4, whereas the histones are hypoacetylated at the pre-B cell stage (2–9). Histone acetylation appears to occur in a stepwise fashion with distal V_H genes requiring IL-7 signaling for acetylation (3, 5, 7). Similarly, there are developmentally associated changes in the histone acetylation status at the Igκ and Igλ L chain loci (6, 10). In non-B cells, histones at the Ig loci are usually unacetylated on H3, but methylated on H3 lysine 9 (4, 6, 7, 10, 11). Thus, epigenetic histone modifications at the Ig loci are controlled in a cell-specific, and developmental-specific, fashion.

In addition to epigenetic modifications, the Ig loci undergo gross changes in nuclear localization and locus contraction. Before the onset of somatic rearrangement, Ig loci reside at the nuclear periphery in an “extended” configuration. However, coincident with Ig somatic rearrangement, the loci take up an intranuclear localization with concomitant contraction of the loci (H chain first followed by L chain) (12–15). Rearrangement of distal V genes requires locus contraction and looping (12, 16), and this contraction requires transcription factor Pax5 (11, 15, 17). After rearrangement, the Ig loci go through a rapid decontraction process apparently to prevent further rearrangements (12).

We recently characterized a number of B cell lymphomas derived by transduction of p53^null bone marrow cells with a c-myc expressing retrovirus (18). Injection of these transduced bone marrow cells into animal hosts resulted in development of B cell lymphomas. Interestingly, several of these B cell lymphomas had the ability to differentiate into macrophages when grown in vitro (19). These lymphoma lines are typified by a line named Myc5 which shows the surprising ability to oscillate between the B cell and macrophage lineages (19). When Myc5 cells are grown as s.c. tumors in vivo, the cells adopt a B cell lymphoma phenotype. Myc5 tumors contain VDJ rearrangements and express CD45R, CD19, and IgM on the cell surface (19). If grown in vitro on S17 stromal cells, Myc5 cells lose expression of surface markers characteristic of B cells (CD45R and CD19) but gain expression of markers characteristic of macrophages (F4/80 and CD11b). These cells also lose expression of transcription factors paired box protein-5 and early B cell factor which are crucial for early B cell development (19). Strikingly, Myc5 clones can repeatedly oscillate between the B cell and macrophage lineages thus exhibiting a surprising plasticity of differentiated stage (19). This developmental plasticity afforded an opportunity to explore changes in Ig gene expression, epigenetic status, contraction status, and intranuclear localization in each differentiated state.

We find here that as Myc5 cells differentiate from the B cell to the macrophage lineage, macrophage-related transcripts increase, whereas B cell-related transcripts decrease dramatically. Concomitantly, the Igκ locus adopts a more extended configuration consistent with differentiation to a non-B cell phenotype. Similarly, the Igκ loci take up a more peripheral localization within the nucleus and become increasingly associated with heterochromatin protein-1 (HP-1).³ Surprisingly, however, Myc5 cell chromatin structure (as measured by histone acetylation and methylation) at the Igκ locus remains largely unchanged whether Myc5 cells are grown in vivo as B cells, or in vitro as macrophages. These results indicate that changes in Igκ locus contraction and intranuclear localization are not dependent upon changes in the Igκ locus histone modifications measured here, thus uncoupling these mechanisms.

Materials and Methods

Quantitative PCR

Total RNA was isolated from 10 × 10⁶ fresh Myc5 tumor cells, or cells differentiated into macrophages by culture on S17 feeder cells in medium supplemented with M-CSF for 4–6 wk. Oligo(dT)-primed cDNA was made from 5 μg of RNA using the Superscript cDNA synthesis kit (Strategene). Real-time PCR was performed in triplicate samples using primers specific for desired transcripts (Table I) in the presence of SYBR Green. Standard curves were run with known quantities of DNA in 10-fold serial dilutions. Transcript levels were calculated by the ΔΔ crossing point method (20).

Table I.

Primers for RT-PCR

Primer Name	Sequence
Mouse γ-actin F	CACGGCATTGTCACTAACT
Mouse γ-actin R	CAGCCAGGTCCAGACGCAAGAT
Mouse mb-1F	CACGGTGAACTTGGGCGAGGAG
Mouse mb-1R	GCTGTGATGATGCGGTTCTTGGTA
Mouse Pax5F	CGGAAGCAGATGCGGGGAGAC
Mouse Pax5R	CTGTGACAATAGGGTAGGACTG
Mouse E47F	CGAGAAGCCGCAGACCAAACT
Mouse E47R	TCCCCGACCACGCCAGAC
Mouse PU.1F	CCCCTGGAGGTGTCTGATGGAG
Mouse PU.1R	CTTCTTGCGGTTGCCCTTCTGGAT
Mouse Blimp1F	TGTCGGGACTTTGCGGAGAGG
Mouse Blimp1R	GGGTGAAATGTTGGAACGGTAGAT
Mouse CEBPαF	CAAGAGCCGAGATAAAGCCAAACA
Mouse CEBPαR	ATCCAGCGACCCGAAACCATCCT
IgκConstantF	TGATGGCAGTGAACGACAAAATGG
IgκConstantR	AGGAAAGGGAGGAGGAGGAGAAGG
M-CSFRF	AGACCGTTTTGCGTAAGACCTG
M-CSFRR	CGGATGTGTGAGCAATGGCAGT
IRF4F	GACTGCCGGCTGCATATCTGC
IRF4R	GCCGATCGCTGCACAGTGCCAG
GM-CSFRF	CACGGTGTCACGCTGGATGT
GM-CSFRR	CGTCGTGACCCGTGGAGTTGA
F4/80F	TTTCCTCGCCTGCTTCTTC
F4/80R	CCCCGTCTCTGTATTCAACC
CD14F	GGCTTGTTGCTGTTGCTTC
CD14R	CAGGGCTCCGAATAGAATCC

Three-dimensional DNA fluorescence in situ hybridization (3D-FISH)

Locus-specific DNA probes prepared from the bacterial artificial chromosomes (BAC) RP23-211L5 (Vκ4-91) and RP23-435I4 (IgκC) were labeled by nick translation with digoxigenin-dUTP or biotin-dUTP (Roche/Enzo Biochem). 3D-FISH assay was done according to published procedures (12, 16) with slight modifications. Myc5 cells were attached to polylysine-coated slides and fixed in 4% paraformaldehyde in 1 × PBS for 10 min at room temperature. After three washes in 1 × PBS, cells were permeabilized at room temperature in 1 × PBS, 0.25% Triton X-100, 0.25% saponin for 20 min, 0.01 N HCl for 10 min, and 20% glycerol in 1 × PBS for 30 min. Slides were immersed in liquid nitrogen and allowed to thaw slowly three times. Genomic DNA was denatured at 73°C in 2 × SSC, 70% formamide solution for 2 min, followed by two 5-min washes in 2 × SSC. A total of 10 μl of hybridization mixture was added to each slide, coverslips were mounted, and sealed with rubber cement, and incubated overnight at 37°C in a humid chamber. Digoxigenin-labeled DNA probes were detected with sheep rhodamine-coupled anti-digoxygenin (Roche/Enzo Biochem), followed by further signal amplification with Texas Red-coupled anti-sheep (Vector Laboratories). Biotinylated DNA probes were detected with FITC-avidin followed by further signal amplification with biotinylated FITC-coupled anti-avidin and FITC-avidin (Vector Laboratories).

Confocal analysis

Cells were analyzed by confocal microscopy using a Leica TCS SL system. Optical sections of 0.2 μm were collected, and only cells with signals from both alleles were analyzed. Distances separating each probe were calculated according to Sayegh et al. (16). The center of each nucleus was determined by measuring intersecting diameters in each section showing a signal. The radial fraction (R) of distance to signal/distance was calculated (14) with an R value of 0.8–1.0 representing a peripheral signal and of 0–0.8 representing a central signal.

Chromatin immunoprecipitation (ChIP) assays

Cells were fixed in 1.1% formaldehyde, 100 mM NaCl, 0.5 mM EGTA, 50 mM Tris-HCl (pH 8) for 10 min at 37°C, then at 4°C for 50 min. Cross-linking was stopped by addition of 5% volume of 2.5 M glycine. Cells were washed in PBS, 0.25% Triton X-100, then in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, 200 mM NaCl, and finally in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, 1% SDS, and 1 mM PMSF. After sonication and centrifugation, samples were diluted to 6 A²⁶⁰ U/ml in 140 mM NaCl, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM PMSF, 100 μg/ml yeast transfer RNA, and 100 μg/ml BSA. Chromatin extracts were preincubated 1 h at 4°C with protein A-agarose and incubated with respective Abs at 4°C overnight. Abs used were anti-H3 acetyl-lysine 9, anti-H3 acetyl-lysine 14, anti-H3 methyl-lysine 4, anti-H3 methyl-lysine 9, anti-H4 acetyl-lysine, anti-HP-1γ(Upstate Biotechnology), anti-IKAROS (Santa Cruz Biotechnology), and anti-PU.1. Samples were recovered by centrifugation and cross-links were reversed by incubation at 65°C overnight. After treatment with RNase A (100 μg/ml) and proteinase K (400 μg/ml), samples were extracted with phenol-chloroform and precipitated with ethanol in the presence of 10 μg of glycogen. Samples were collected by centrifugation and resuspended in 50 μl of water. Bound and unbound DNA samples of 5, 10, and 20 ng were subjected to PCR (95°C 1 min, 55°C 30 s, 72°C 30 s for 25 cycles, followed by 72°C for 2 min) with primers specific for either the Igκ intron enhancer, Cκ exon, or 3′ enhancer (Table II). Samples were either evaluated by real-time PCR, or were dot-blotted onto Nytran paper, and hybridized to the following probes labeled with [α-³²P]dCTP with the Megaprime Labeling System (Amersham Biosciences): intron enhancer, a 473-bp AluI DNA fragment; Cκ, a 1.7-kb HindIII-BglII fragment; 3′ enhancer, a 1.1-kb EcoRI-SacI DNA fragment. After hybridization and washing, dot blots were exposed to x-ray film.

Table II.

Primers for ChIP studies

Primer Name	Sequence
3′ Enhancer F	GCACAGAGTACCCACCCATATCTC
3′ Enhancer R	CTTGAAAGGGTGTGGAGTGCACCA
Intron enhancer F	CCTCTGTCACCCAAGAGTTGGCAT
Intron enhancer R	AGCCAGGGTCTGTATTTGGGTGTC
Constant F	CCCACCATCCAGTGAGCAGTTAAC
Constant R	GAGCTGGTGGTGGCGTCTCAGGAC

Results

Macrophage differentiation is accompanied by loss of B cell-related transcripts and gain of macrophage-related transcripts

We previously showed that Myc5 cells can oscillate between the B cell and macrophage phenotypes (19). Because differentiation to these distinct cell lineages can easily be manipulated, this system afforded a convenient system to study mechanisms that control tissue-specific differences in gene expression, Ig locus contraction, Ig locus intranuclear localization, and epigenetic histone modifications. We anticipated that during transition from the B cell lymphoma phenotype to the macrophage phenotype, we would observe loss of B cell-related transcripts, and gain of macrophage-related transcripts. To assess this, we assayed expression of various transcripts indicative of each cell type by quantitative RT-PCR. Indeed, we found that in general, macrophage-related transcripts increased when Myc5 cells differentiated into macrophages, while B cell-related transcripts decreased (Table III). Increased expression was observed with macrophage related transcripts M-CSFR, F4/80, and CD-14 (23-, 3.1-, and 5.2-fold increases, respectively). Dramatic drops were observed for B cell-related transcripts E47 (−14-fold), mb-1 (−20-fold), IFN regulatory factor 4 (IRF4) (−73-fold), and Pax5 (−413-fold). The most dramatic drop was in Igκ transcript levels (~−25,000-fold). This loss of Igκ gene expression in Myc5 macrophages may be due to reduced levels of Pax5, IRF4, and E47 (Table III) which are known to be involved in controlling enhancer activity (21–27), or alternatively could be due to epigenetic changes at the Igκ locus (see below). Minor changes were observed in CEBPα, GM-CSFR, PU.1, and Blimp-1 levels. The relatively minor change in PU.1 expression was surprising because PU.1 is generally believed to be expressed at higher levels in macrophages compared with B cells (28–30). However, in general, there was good correlation with gain of macrophage-related transcripts in Myc5 macrophages, and loss of B cell-related transcripts normally expressed in Myc5 B cell lymphoma cells.

Table III.

Fold change in transcripts in vitro (macrophages)/in vivo (B cells)^a

Transcript	Fold Change
M-CSFR	+23
CD-14	+5.2
F4/80	+3.1
GM-CSFR	+1.2
PU.1	−2.0
Blimp1	−2.1
E47	−14
Mb-1	−20
IRF4	−73
Pax5	−413
Igκ	−25,000

^aLoss of B cell-related transcripts in vitro and gain of macrophage-related transcripts during B cell to macrophage differentiation. RNA was isolated from either Myc5 tumors grown in vivo, or from Myc5 cells differentiated in vitro in the presence of M-CSF. RNA samples were subjected to RT-PCR with primers specific for a variety of transcripts. Expression ratios of in vitro/in vivo transcript levels for various transcripts are shown.

Changes in Igκ locus contraction and subnuclear localization as Myc5 cells differentiate into macrophages

Our results indicate that transcription at the Igκ locus was very dramatically reduced when Myc5 B cells differentiated into macrophages. Associated with this change in transcription, we anticipated that large-scale locus contraction and intranuclear localization might change as well. As mentioned above, Ig loci reside at the nuclear periphery in an “extended” configuration before the onset of somatic rearrangement. Similarly, in non-B cells, the Ig loci are usually associated with the nuclear periphery in an extended conformation. Therefore, as Myc5 cells differentiate from B cells to macrophages, we expected to observe a loss of Igκ locus contraction resulting in a more extended configuration. Similarly, we anticipated a more peripheral localization of Igκ loci within the nucleus. We used 3D-FISH to explore contraction and subnuclear localization of the Igκ loci in Myc5 B cells and Myc5 macrophages.

For FISH, we used BAC probe 211L5 which contains the Vκ 4-91 family of Vκ genes and BAC probe 34515 which contains the Cκ region (Fig. 1A). Probes were differentially labeled (green fluorescence, Vκ red fluorescence, Cκ), thus enabling us to estimate the distances separating the Vκ and Cκ regions in both cell types. As expected, we found that the Igκ locus was in a more contracted phenotype in Myc5 B cells compared with Myc5 macrophages (Fig. 1A, Table IV). Thus, concomitant with differentiation into the macrophage phenotype, the Igκ locus adopts a more extended configuration (Table IV).

FIGURE 1.

Igκ locus compaction status and subnuclear localization differs in Myc5 B cells and macrophages. A, The Igκ loci are in a more extended configuration in Myc5 B cells. 3D-FISH was performed on Myc5 B cells and Myc5 macrophages using probes (see bottom panel) specific for the Vκ4-91 region (green), or the Cκ region (red). Average measurements of distances between V and C regions are shown in Table IV. B, Igκ alleles associated with the nuclear periphery increase in Myc5 macrophages. The percentage of Myc5 B cells or macrophages that contain both alleles at the nuclear periphery (maroon), one at the periphery and one in the center (yellow), or both in the center of the nucleus (blue) are shown. C, The κ locus is more enriched for association with HP-1 in Myc5 macrophages compared with Myc5 B cells. ChIP studies were performed with Myc5 B cell and macrophage chromatin using HP-1-γand IKAROS Abs. DNA was subjected to PCR with primers that flank the intron enhancer. Fold change between the in vitro grown macrophages and in vivo B cells was determined by real-time PCR. Agarose gels of PCR products derived from 5, 10, and 20 ng of DNA are shown in the top panel.

Table IV.

Contraction status of Igκ locus

	Percentage of Alleles Separated by Distance
Cell Phenotype	0–0.3 μm	0.3–1.0 μm	1.0–1.5 μm	Sample Size
Myc5 B cells	49.0	50.0	1.0	96
Myc5 macrophages	27.6	70.7	1.7	58

We also determined the position of the Igκ loci in the nucleus in each differentiated state. Indeed, we found that position of the Igκ loci changed as cells differentiated from the B cell to the macrophage phenotype. In Myc5 B cells, essentially all cells contain either both Igκ alleles in the center of the nucleus, or contain one in the center and one in the periphery (Fig. 1B). On the contrary, as Myc5 cells differentiated into macrophages, ~30% of cells contained both Igκ alleles at the nuclear periphery (Fig. 1B). Thus, consistent with the differentiation state of Myc5 cells, and in line with expression pattern of the Igκ gene, large scale changes in locus contraction and nuclear localization were observed at the Igκ locus during transition from the B cell lineage to the macrophage lineage.

Increased association of the Igκ locus with the nuclear periphery in Myc5 macrophages suggested that the locus might also be associated with HP-1, or with centromere associated protein, IKAROS. To test this, we performed ChIP studies using anti-HP-1 and anti-IKAROS Abs and primers that flank the Ig κ intron enhancer. Indeed, we found a 3.3-fold increase in HP-1 at the κ locus in Myc5 macrophages compared with Myc5 B cells (Fig. 1C). In contrast, we observed a 7.4-fold loss in IKAROS association with the κ locus in Myc5 macrophages (Fig. 1C). Thus, when the cell adopts the macrophage phenotype, the locus appears to be associated with heterochromatin, but not necessarily centromeric chromatin.

Epigenetic histone modifications at the Igκ locus reveal a stable phenotype

Because Igκ gene expression levels, Igκ locus contraction, Igκ locus intranuclear localization, and association with HP-1 changed as Myc5 cells differentiated from the B cell to the macrophage phenotype, we fully expected to observe significant changes in Igκ locus histone modifications. First, we explored the histone modification pattern at the Igκ locus in Myc5 B cells compared with that observed in Myc3 B cells. Myc3 cells are identical in genetic background to Myc5 cells, but Myc3 cells are incapable of adopting a macrophage phenotype. Thus, we thought that perhaps epigenetic differences would be discernable between these two cell types that might reflect their differing abilities to support macrophage differentiation. To explore epigenetic structures in Myc3 and Myc5 cells, we performed ChIP experiments with chromatin isolated from Myc5 B cell lymphoma tumor cells, and Myc3 B cell lymphoma tumor cells. We used Abs specific for histone H3 acetyl-lysine 9, H3 acetyl-lysine 14, H3 methyl-lysine 4, and H4 pan-acetyl-lysine. The above Abs detect epigenetic marks generally associated with transcriptionally active chromatin. After immunoprecipitation, we performed PCR with primers specific for the Igκ C region. Surprisingly, we observed no difference in chromatin structure when comparing Myc3 to Myc5 tumor cells (Fig. 2). Thus, the differing capacities of these two lines to differentiate into macrophage cells is not reflected by differences in Igκ locus histone modification patterns.

FIGURE 2.

Myc5 epigenetic structure is identical with Myc3 structure. ChIP assays were performed with Myc3 and Myc5 tumors using Abs against H3 methyl-lysine 4, H3 acetyl-lysine 9, H4 acetyl-lysine 14, and H4 acetyl-lysine. PCR was performed with 5, 10, and 20 ng samples of bound DNA compared with 5 ng of unbound DNA using primers to the Igκ C region. A, Dot blots of amplified DNA. B, Chart of percent bound with each Ab. Error bars, SD from the mean.

Therefore, we explored histone modification patterns in Myc5 cells differentiated into either B cells or macrophages. Given the changes we observed in gene expression patterns during transition of Myc5 B cells to Myc5 macrophages, as well as the large scale changes in Igκ locus contraction and intranuclear localization, we anticipated that these changes would be associated with substantial alterations in histone modifications at the Igκ locus. ChIP studies were performed with chromatin isolated from Myc5 cells grown either as B cells or macrophages. We used the same Abs described above, as well as anti-H3 methyl-lysine 9 Abs to detect silent chromatin marks, and anti-PU.1 Abs to explore transcription factor binding at the Igκ 3′ enhancer (31, 32). After immunoprecipitation, PCR was performed with primers specific for either the Igκ intron enhancer, C region, or 3′ enhancer, followed by dot blot analyses to detect amplified DNA. After quantitation, values for each cell type were normalized to the level of H4 acetylation defined as 100%.

Myc5 B cell lymphoma cells showed enrichment of H3 acetyl-lysine 9, H3 acetyl-lysine 14, H3 methyl-lysine 4, and H4 acetyl-lysine at all locations within the Igκ locus consistent with what one would expect for a transcriptionally active locus (Fig. 3, Myc5 B cell dot blot panels). Unexpectedly, we also observed essentially the same pattern at each position in the locus after differentiation into macrophages (Fig. 3, Myc5 Macs dot blot panels). Although there was some relative enrichment of H3 acetyl-lysine 9 and H3 methyl-lysine 4 at the intron enhancer in Myc5 B cells compared with macrophages (bottom left chart), these differences were only in the 2-fold range. Similarly, there was some enrichment of H3 acetyl-lysine 9, H3 acetyl-lysine 14, and H3 methyl-lysine 4 at the 3′enhancer in B cells compared with macrophages (bottom right chart), but again, in most cases the differences were in the 2-fold range. None of these differences were observed at the Cκ region (bottom middle chart) which showed very similar levels of each histone modification in Myc5 macrophages and B cells. Thus, the most striking conclusion is that modification of histones packing the κ locus changed very little whether the cells were grown as B cells or macrophages. Surprisingly, PU.1 remained bound to the 3′ enhancer in Myc5 cells differentiated into either the B cell or macrophage phenotypes (right dot blot panels, lower right chart). These results were completely unexpected because the locus is transcriptionally silent in the macrophage phenotype, and in light of the changes in locus contraction and intranuclear localization (Fig. 1 and Table I).

FIGURE 3.

Histone modifications at the Igκ locus remain similar in the two differentiation states. ChIP experiments were performed with chromatin isolated from either Myc5 B cell lymphoma tumors, or Myc5 cells differentiated into macrophages in vitro by growth in medium supplemented with M-CSF. Chromatin was immunoprecipitated with the indicated Abs then subjected to PCR with primers that amplify either the Igκ intron enhancer, C region, or 3′ enhancer. After amplification, samples were subjected to dot blot analyses with probes specific for each Igκ locus region. A map of the Igκ locus is shown at the top with representative dot blots in the center panel. Bottom panel, The relative enrichment of each immunoprecipitated DNA from either Myc5 B cells (□) or Myc5 macrophages ( ) normalized to the level of anti-acetyl H4 immunoprecipitated DNA in each cell type (defined as 100%). Error bars, SD from the mean.

The relatively constant chromatin structure at the Igκ locus under both differentiation phenotypes was surprising. We compared histone modification patterns in Myc5 cells with patterns observed in cell lines representative of either plasmacytoma cells (S194 cells) or macrophages (RAW264.7 macrophages). S194 plasmacytoma cells showed elevated H3 lysine 9 acetylation, H4 acetylation, and H3 lysine 4 methylation (Fig. 4C). On the contrary, RAW264.7 macrophages showed elevated H3 lysine 14 acetylation (Fig. 4D). Interestingly, Myc5 cells appear to be a composite of the distinct patterns observed in S194 and RAW264.7 cells (Fig. 4, A and B). Myc5 cells showed elevated acetylation on H4 and H3 lysines 9 and 14, coupled with methylation of H3 lysine 4. The pattern observed in Myc5 cells, however, was identical with that observed in Myc3 cells (Fig. 2) suggesting that this epigenetic phenotype is not particular to the capacity to differentiate into both B cells and macrophages. Overall, our results show the surprising feature that Myc5 epigenetic structure at the Igκ locus remains stable whether the cells adopt B cell or macrophage phenotype.

FIGURE 4.

Myc5 chromatin structure at the Igκ C region is a composite between plasmacytoma cell and macrophage phenotypes. ChIP studies were performed with either (A) Myc5 tumor cells, (B) Myc in vitro-differentiated macrophages, (C) S194 plasmacytoma cells, or (D) RAW264.7 macrophages, using the indicated Abs. DNA was amplified with primers specific to the Igκ C region then detected by dot blot analyses. The chromatin composition at the Igκ locus in Myc5 cells appears to be a composite of patterns observed in plasmacytoma cells and macrophages.

Discussion

Myc5 cells possess the unusual property of being able to oscillate between phenotypes characteristic of the B cell and macrophage lineages. A surprising observation from our studies was the similarity in Igκ locus chromatin structure in Myc5 B cells compared with Myc5 macrophages. Although Igκ gene expression dropped dramatically, and the Igκ locus adopted a more extended configuration and changed to a more peripheral nuclear localization, the locus epigenetic chromatin structure remained essentially unchanged during B cell to macrophage differentiation. Thus, the locus contained very similar histone H3 and H4 acetylation and methylation patterns whether grown as B cells or macrophages. This is quite distinct from studies showing different histone modification patterns at the Ig loci at various stages of B cell development, and particularly differences between B cells and non-B cells (11–17). Thus, Myc5 cells show a very surprising stability in histone posttranslational modifications at the Igκ locus despite dramatic differences in transcriptional activity, locus contraction, and intranuclear localization. This is in contrast to our prior work that showed that loss of H3 lysine 9 methylation at the V_H locus is dependent upon Pax5 expression in Myc5 cells (11). Therefore, methylation of H3 lysine 9 at the IgH locus appears to be dependent upon continuous Pax5 expression, whereas the histone marks studied here at the κ locus are largely independent of Pax5 function.

An interesting aspect of our results is that they clearly show that locus contraction and nuclear localization are not directly dependent upon changes in the histone modifications studied here at the Igκ C region, intron enhancer, and 3′ enhancer. Instead, changes in large scale locus configuration can occur irrespective of local hi-stone modifications at the κ locus. Thus, local epigenetic structures can be overridden by larger-scale regional changes. The persistence of these epigenetic structures could conceivably be maintained for later κ locus modifications such as receptor editing or somatic hypermutation. Loss of transcription at the locus also did not directly correlate with deacetylation of histones within the general vicinity of the Cκ region and its associated enhancers. Instead, loss of Igκ gene expression in Myc5 macrophages could be the consequence of reduced IRF4, E47, and Pax5 expression which are known to regulate Igκ enhancer activity (21–27). Loss of transcription also correlated with increased association with repressor protein HP-1. Therefore, reduced κ transcription could result from both loss of key transcription factors and increased association with HP-1.

Surprisingly, transcription factor PU.1 remained bound to the Igκ 3′ enhancer under both conditions. An attractive hypothesis is that PU.1 is sufficient to maintain certain epigenetic phenotypes at the Igκ locus (H3 K9 acetylation, H4 acetylation, and H3 K4 methylation) even when the cells differentiate into macrophages. However, published data from our laboratory and others suggest that PU.1 is not sufficient for generating an open chromatin conformation on its own (31–33). Thus, other factors are likely needed to maintain the high H3 and H4 acetylation patterns observed in Myc5 macrophages.

The differences in large scale Igκ locus compaction and intranuclear localization we observed when Myc5 cells changed from the B cell to macrophage phenotype are largely consistent with the published literature. When Pax5 expression is lost due to homozygous mutation, Ig loci remain in an extended configuration (11, 15, 17). Likewise, when Myc5 cells change from the B cell to macrophage phenotype with concomitant loss of Pax5 expression, the Igκ loci tended to transition from a compacted to a more extended configuration (Fig. 1, Table IV). Thus, the Myc5 system may be useful for deciphering the role of Pax5 in the contraction process.

Published data on Ig locus intranuclear localization are somewhat complex. Generally, cells that do not express Ig genes maintain the loci at the nuclear periphery (14). In early B cell stages (pro-B and pre-B), coincident with somatic rearrangement processes, the Ig H and L chain loci migrate to more central locations within the nucleus (12–15). After rearrangement, often one allele associates with heterochromatin (12, 13). Our data show that as Myc5 cells transition from the B cell to the macrophage phenotype, a growing number of Igκ alleles become associated with the nuclear periphery (Fig. 1B). It is likely that these alleles are also associated with heterochromatin (12, 13) as evidenced by loss of Igκ gene expression and increased association with HP-1. Rather unexpectedly, the κ locus was less enriched for IKAROS in Myc5 macrophages compared with B cells. Thus, the locus does not appear to associate with centromeric chromatin even though it is increasingly associated with the nuclear periphery. Association with centromeric chromatin is generally believed to result in long-term stable repression. Because the κ locus in Myc5 cells oscillates between active and repressed states, the lack of association with IKAROS in perhaps not that surprising.

In other work, we have shown that Myc5 cells are restricted to the B cell and macrophage pathways (Ref. 19 and S. Hodawadekar, D. Yu, B. Freedman, O. Sunyer, M. L. Atchison, and A. Thomas-Tikhonenko, submitted for publication) (data not shown). Thus, Myc5 cells appear poised to develop along either developmental pathway. A number of cell lines or bone marrow cells have shown the ability to give rise to B cells and macrophages, though none of them are capable of the oscillation capacity of Myc5 cells (34–36). A splenic B cell population grown on fibroblasts simultaneously expresses B cell and macrophage characteristics, and a rare bone marrow population is bipotential, capable of generating both B cells and macrophages (37, 38). These cells, unlike Myc5 cells however, lack rearrangements. VDJ_H Myc5 cells may represent a more mature cell derived from this bipotential lineage, but which still retains its bipotential capacity, even after Ig gene rearrangement. The fact that one can obtain multiple clones with the Myc5 phenotype from mice (19) argues that this is a significant mammalian hemopoietic lineage with potential to oscillate between two developmental fates depending upon environmental signals. This ability to maintain the capacity to oscillate between B cell and macrophage fates is marked by stable epigenetic histone modifications at the Igκ locus. Thus, Myc5 cells represent a cell type that can dramatically change gene expression patterns, differentiation phenotypes, and large scale Ig locus intranuclear position and contraction status, without observable alterations in histone modifications at the Igκ C region and flanking enhancer regions.