Specific Binding of the Xanthomonas campestris pv. vesicatoria AraC-Type Transcriptional Activator HrpX to Plant-Inducible Promoter Boxes

Ralf Koebnik; Antje Krüger; Frank Thieme; Alexander Urban; Ulla Bonas

doi:10.1128/JB.00795-06

. 2006 Aug 25;188(21):7652–7660. doi: 10.1128/JB.00795-06

Specific Binding of the Xanthomonas campestris pv. vesicatoria AraC-Type Transcriptional Activator HrpX to Plant-Inducible Promoter Boxes^▿

Ralf Koebnik ^1,^†,^*, Antje Krüger ^1,^†, Frank Thieme ¹, Alexander Urban ^1,^‡, Ulla Bonas ¹

PMCID: PMC1636286 PMID: 16936021

Abstract

The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N₁₅-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N₈-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a −10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.

Most gram-negative plant-pathogenic bacteria possess a type III protein secretion system (T3SS) which transports effector proteins into the host cell, where they may interfere with metabolic pathways of the host and/or suppress plant defense reactions (28, 38). A number of effectors are specifically recognized in resistant plants by corresponding resistance gene products. Recognition often triggers a rapid local defense response termed the hypersensitive response, which ultimately restricts bacterial growth (47). The genes encoding the T3SS are referred to as hypersensitive response and pathogenicity (hrp) genes, because hrp mutations abolish both the induction of the hypersensitive response in resistant plants and pathogenicity in susceptible plants (22).

In Xanthomonas campestris pv. vesicatoria, the causal agent of bacterial spot disease on pepper and tomato plants, the T3SS is encoded by at least six loci, designated hrpA to hrpF (2, 18), which are clustered in a 23-kb chromosomal region. The hrp gene cluster carries at least 22 genes, 11 of which are highly conserved among plant and animal pathogens and therefore have been termed hrc (hrp conserved) genes (1, 18). Expression of Xanthomonas hrp operons is activated in planta by the products of two regulatory genes, hrpG and hrpX (36, 42, 45), which are located elsewhere in the chromosome. HrpG is a member of the OmpR family of two-component response regulators and controls, in most cases via the AraC-type regulator HrpX, the hrpG regulon, including genes for type III effector proteins (30, 31, 32). Many of the HrpX-regulated genes possess a conserved cis-regulatory element, the plant-inducible promoter (PIP) box, with the consensus sequence TTCGC-N₁₅-TTCGC (13). It was proposed that HrpX binds to the PIP box to induce expression of the downstream gene(s) (42).

PIP box-related sequence motifs have been identified in several species of Xanthomonas and Burkholderia, in Ralstonia solanacearum (TTCG-N₁₆-TTCG, called the hrp_II box) (7), and in Acidovorax avenae (GenBank accession numbers AY898625, AB207101, and AB207102). Mutagenesis of a Xanthomonas PIP box demonstrated that single nucleotide replacements were tolerated at all positions except for the central cytidine of each half-site, leading to 10 to 30% residual promoter activity (41). Interestingly, C-to-T and C-to-G replacements at the last position of each half-site reduced the promoter activity a maximum of 50%, whereas C-to-A replacements inactivated the promoter (41). In line with this observation, there was only one adenine residue found at the corresponding position in 64 natural hrp_II half-sites (29) and none in 50 additional candidate hrp_II half-sites (7). Thus, PIP and hrp_II boxes appear to be equivalent to each other and are probably best described by the following pattern: TTCGB-N₁₅-TTCGB, where “B” refers to any base except adenine.

In addition, another conserved sequence element 30 to 32 bp downstream of the PIP box (31 to 33 bp downstream of the hrp_II box) is of importance for the transcription of hrp genes (7, 29, 41). Mapping of transcriptional start sites indicated that the conserved sequence corresponds to the −10 promoter region (7, 13; U. Bonas, unpublished data). Besides genes with a PIP box and a −10 region, genes with an imperfect PIP box, such as TTCGC-N₈-TTCGT in the case of hrpF, and genes without a PIP box have also been described as being expressed in an HrpX-dependent manner (19, 31, 41). This finding could be explained by the following two alternative models. (i) HrpX activates genes independent of a PIP box, one of which encodes a regulator which recognizes the PIP box and activates the corresponding genes. (ii) HrpX binds to the PIP box and induces the expression of hrp genes and of another regulator, which then activates the HrpX-dependent genes that lack a PIP box.

In this study, DNA affinity enrichment was used to test whether HrpX interacts with the PIP box. Single and double replacements of the conserved dithymidine motifs of the PIP box revealed their crucial importance for DNA binding of HrpX. Moreover, we predicted and confirmed the HrpX-dependent expression of novel members of the HrpX regulon. Our results demonstrate that HrpX is the most downstream component of the hrp gene regulatory cascade.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

Bacterial strains and plasmids used for this study are described in Table 1. Plasmids were introduced into Escherichia coli by electroporation and into X. campestris pv. vesicatoria by conjugation, using pRK2013 as a helper plasmid in triparental matings (9, 14). E. coli cells were cultivated at 37°C in LB medium, and X. campestris pv. vesicatoria strains were grown at 30°C in NYG medium (8). Antibiotics were added to the media at the following final concentrations: gentamicin, 15 μg/ml; kanamycin, 25 μg/ml; and rifampin, 100 μg/ml.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid	Relevant characteristics	Reference or source
Strains
Xanthomonas campestris pv. vesicatoria strains
85-10	Pepper race 2, spontaneous rifampin-resistant mutant of a field isolate	5
85*	hrpG* mutant of strain 85-10 leading to constitutive hrp gene expression; Rif^r	44
85-10ΔhrpX	hrpX deletion mutant of 85-10; Rif^r	U. Bonas, unpublished data
85ΔhrpX*	hrpX deletion mutant of 85*; Rif^r	31
E. coli strain
DH10b	F⁻mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR araΔ139 Δ(ara, leu)7697 galU galK λ⁻nupG rpsL (Sm^r)	Invitrogen, Carlsbad, CA
Plasmids
pBBR1MCS-5	Broad-host-range cloning vector; lac promoter; Gm^r	21
pBBR1-HrpX-His	pBBR1MCS-5 derivative expressing hexahistidine-tagged HrpX	This work
pBX1	pBluescript KS plasmid clone harboring hrpX from X. campestris pv. vesicatoria strain 85-10; Ap^r	42
pCR 2.1-TOPO	General-purpose cloning vector; Ap^r Km^r	Invitrogen, Carlsbad, CA
pRK2013	Helper plasmid for triparental matings; TraRK⁺ Mob⁺ Km^r	14
pXCVs1p0103ah02	1,657-bp shotgun clone of Xanthomonas campestris pv. vesicatoria strain 85-10 containing the hrpD PIP box	40

Open in a new tab

Plant material and plant inoculations.

The pepper cultivar ECW-10R, carrying the resistance gene Bs1, has been described previously (26). Bacteria were hand inoculated into the leaf mesophyll at a concentration of 2 × 10⁸ CFU ml⁻¹ in 10 mM MgCl₂ (2). Reactions were scored 2 days after inoculation. For better visualization of the hypersensitive response, leaves were bleached with 100% ethanol.

RNA analyses.

RNA extraction, cDNA synthesis, and reverse transcription-PCR (RT-PCR) experiments were performed as described previously (31). Experiments were performed at least three times for each gene, with two independent cDNA preparations included in each. Oligonucleotide sequences are available upon request.

Generation of a hexahistidine-tagged derivative of HrpX.

The coding sequence of hrpX was amplified from plasmid pBX1 (42) by PCR, using Pfu polymerase (Stratagene, Heidelberg, Germany) and oligonucleotide primers with appropriate restriction sites and the hrpX ribosome-binding site (Table 2). For construction of a hexahistidine-tagged derivative, six histidine codons were included in the 3′ primer. PCR fragments were cloned into pCR 2.1-TOPO and sequenced. Correct hrpX inserts were subcloned into the broad-host-range vector pBBR1MCS-5. Recombinant plasmids were then introduced into X. campestris pv. vesicatoria, and functionality was tested by complementation of a chromosomal hrpX deletion.

TABLE 2.

Oligonucleotides used in this study

Name	Sequence (5′-3′)^a	Relevant characteristics
hrpX-5′	5′-CTAGCTCGAGAGAGACCGGCATGATCCTTTCCACCTACTTTGCAGCGATC	XhoI site, authentic ribosome-binding site
hrpX-3′	5′-GCATAAGCTTACCGCTGCAGGGTCTCCATCGGCG	HindIII site
hrpX-3′-His	5′-GCATAAGCTTAGTGATGATGGTGGTGATGGGCGCCCCGCTGCAGGGTCTCCATCGGCG	HindIII site, hexahistidine tag
PIP(hrpB/hrpC)-5′	5′-TTCGATGAGCCCACTCACGAC
PIP(hrpB/hrcC)-3′	5′-TTCTTCTCGGTCGGCTTCTCG	5′ Biotinylated
PIP(hrpD)-5′	5′-CAAGAGGTCGTCGCACAGAC
PIP(hrpD)-3′	5′-GCTGATCTGGAGCGTGCTAC	5′ Biotinylated
PIP(hrpE)-5′	5′-CGTACACATGCCATCACACG
PIP(hrpE)-3′	5′-GAGTGAGCAACCAGGCCAATC	5′ Biotinylated
PIP(hrpF)-5′	5′-GGGCCGATTTTTGCGCTTTTTTCG
PIP(hrpF)-3′	5′-GCAAGTCGGAGCCATCCTTG	5′ Biotinylated
PIP(hrcV)-5′	5′-GCTGTTCACCACGCTACTGC
PIP(hrcV)-3′	5′-CGGCGTGCCTCATCTGCGGT	5′ Biotinylated
PIP(sulA)-5′	5′-GAATTCAATAGGGTTGATCTTTG
PIP(lacZ)-3′	5′-GCCTCAGGAAGATCGCACTCC	5′ Biotinylated
PIP(hrpD)mut1f	5′-GTTTTTGCGGCTAGCGCCGGACC	NheI site
PIP(hrpD)mut1r	5′-GGTCCGGCGCTAGCCGCAAAAAC	NheI site
PIP(hrpD)mut2f	5′-GACCAGCTATCGCAGCGCTTCAATACCAG	Eco47III site
PIP(hrpD)mut2r	5′-CTGGTATTGAAGCGCTGCGATAGCTGGTC	Eco47III site

Open in a new tab

Restriction sites are underlined, mismatched nucleotides are doubly underlined, start and stop codons are shown in bold, codons for the C-terminal hexahistidine tag are shown in italics, and PIP box half-sites are shown in bold italics.

Construction of site-directed mutants with substitutions in the PIP box of hrpD.

A 1.7-kb shotgun clone, pXCVs1p0103ah02, from the X. campestris pv. vesicatoria genome project (40), containing the PIP box of hrpD, was used as a template for site-directed mutagenesis using mutagenic oligonucleotides (Table 2) and the QuikChange system (Stratagene). Clones were screened by restriction analysis and confirmed by DNA sequence analysis.

Generation and immobilization of biotinylated DNA fragments.

Biotinylated DNA fragments were generated by PCR using the appropriate primers (Table 2). Amplified DNA fragments were purified using a PCR purification kit (QIAGEN GmbH, Hilden, Germany). One hundred microliters of M-280 streptavidin Dynabeads (Dynal Biotech GmbH, Hamburg, Germany) was washed twice with 100 μl wash buffer (10 mM Tris-HCl, pH 7.5; 2 M NaCl) and resuspended in 200 μl wash buffer. A 200-μl sample containing 20 pg purified biotinylated DNA was added to the beads, and the suspension was incubated with slight shaking for 1 hour at room temperature. The beads were washed three times with wash buffer and resuspended in binding buffer (20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, and 0.01% Triton X-100).

Magnetic DNA affinity enrichment.

Magnetic DNA affinity enrichment of proteins was performed as described previously (11, 16), with the following modifications. For each experiment, 50-ml bacterial cultures were grown to an optical density at 600 nm of 0.6 and chilled on ice. Cells were harvested at 4°C and resuspended in 2 ml binding buffer. Bacteria were broken with a French press, and soluble proteins were obtained by centrifugation at 4°C. DNA-coated Dynabeads were mixed with a 10-fold excess of calf thymus DNA as a competitor (Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany) and with 1.8 ml of a freshly prepared soluble protein extract. The suspension was incubated with slight shaking for 45 min at room temperature. The beads were washed with 500 μl binding buffer, with 500 μl binding buffer plus competitor DNA, and again with 500 μl binding buffer. Bound proteins were eluted twice with 100 μl elution buffer (20 mM Tris-HCl, pH 7.5, 2 M NaCl, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, 0.01% Triton X-100). Both eluates were combined and concentrated to 50 μl, using Vivaspin 500 microconcentrators with a cutoff size of 10 kDa (Vivascience AG, Hannover, Germany). The sample was desalted with 500 μl 10% glycerol and 0.01% Triton X-100 and concentrated to 50 μl. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and detected by Western blot analysis, using monoclonal antibodies against the pentahistidine epitope (1:2,000; QIAGEN GmbH) and an anti-mouse horseradish peroxidase-conjugated secondary antibody, which was detected by enhanced chemiluminescence (Amersham Pharmacia Biotech, Freiburg, Germany). As a control for equal loading of samples, a second SDS-PAGE gel was stained with silver or Coomassie brilliant blue (Serva Elektrophoresis GmbH, Heidelberg, Germany).

Supplemental material.

A table giving more information about all 24 predicted perfect PIP box-regulated promoters in the chromosome of X. campestris pv. vesicatoria strain 85-10 and their associated genes is available at http://www.biologie.uni-halle.de/genet/plant/research/supplementary/.

RESULTS

Analysis of HrpX-dependent genes.

One model to explain the HrpX-dependent expression of genes lacking a (consensus) PIP box, such as xopB, xopC, and xopD (30-32), postulated the action of an additional regulatory gene with a PIP box, whose expression is controlled by HrpX. We therefore analyzed the complete genome sequence of X. campestris pv. vesicatoria (40) for the presence of the motif TTCGB-N₁₅-TTCGB-N_30-32-YANNNT (B represents C, G, or T; Y represents C or T). In total, 24 putative PIP box-regulated promoters were found, many of which corresponded to known HrpX-dependent genes. However, no candidate regulatory gene which in turn could activate genes lacking a PIP box was identified among them (see supplementary Table 1 at http://www.biologie.uni-halle.de/genet/plant/research/supplementary/).

To analyze whether the expression of genes with predicted PIP box-regulated promoters does indeed depend on HrpX, we performed RT-PCR analyses of X. campestris pv. vesicatoria strain 85-10, its derivative 85* (44), and the hrpX deletion mutant 85*ΔhrpX (31) grown in complex NYG medium. As shown in Fig. 1, transcripts of all tested genes are highly abundant in strain 85* but not (XCV0505, XCV0536, XCV0722, XCV2568, and XCV4424), or in much smaller amounts (XCV0285 and XCV2729), in the hrpX wild-type strain 85-10 and in 85*ΔhrpX. This indicates that these genes are HrpG- and HrpX-dependently expressed and thus coregulated with the T3SS.

FIG. 1. — Expression analysis of *X. campestris* pv. vesicatoria genes with candidate PIP box-regulated promoters by RT-PCR. *X. campestris* pv. vesicatoria strains 85-10, 85*, and 85*Δ*hrpX* were grown in NYG medium. 16S rRNA was used as a constitutive control. The DNA samples were separated in a 1.5% agarose gel and stained with ethidium bromide. The results of one representative experiment are shown. XCV refers to the nomenclature used by Thieme et al. (40) and to a locus tag in GenBank. *hgi* (hrpG induced) refers to the nomenclature used by Noël et al. (31).

Surprisingly, the HrpX-dependent xopB gene, which has been described to not have a PIP box (31), was found to have a putative PIP box-regulated promoter, albeit with a TTCGG motif instead of the TTCGC consensus motif (see supplementary Table 1 at http://www.biologie.uni-halle.de/genet/plant/research/supplementary/). We realized that other induced genes for which no PIP box had been described might also contain a PIP box-regulated promoter with slight deviations from the consensus sequence. Therefore, HrpX-dependent genes were scrutinized for plant-inducible promoters consisting of a PIP box and a −10 region, allowing for a maximum of two point mutations in the two motifs. Indeed, in most cases, a candidate PIP box-regulated promoter could be identified, except for hpaJ, XCV0869, XCV2993, XCV3406, and XCV4423 (Table 3). We also scrutinized type III effector genes of X. campestris pv. vesicatoria strain 85-10 for the presence of candidate PIP box-regulated promoters (Table 3). Except for avrBs1, a candidate PIP box-regulated promoter was found in all cases. One of them (xopQ) corresponded to a cDNA fragment (hgi) which was found in a cDNA-AFLP screen and shown to be hrpX-dependently induced (31).

TABLE 3.

Candidate PIP box-regulated promoters of T3SS-associated genes and/or hrpG-induced genes (hgi) from X. campestris pv. vesicatoria strain 85-10

Gene/operon and category	CDS^a	Evidence^b	PIP box sequence^c	Distance 1 (bp)^d	−10 Sequence	Distance 2 (bp)^e	Reference
T3SS core components
hrpB1	0427	gus	TTCGCCAGCGAATTCCGATATTCGC	31	TAGCGT	44	45
hrcU	0426	hgi-3 hgi-206	TTCGCCAGGCCATCCACACATTCGC	31	CACAAT	32	31, 45
hrcQ	0423	gus	TTCGCCGGACCAGCTATCGCTTCGC	31	TACTTT	211	45
hrcD	0418	gus	TTCGCCCATGACCATGCAGCTTCGC	31	TAGATT	218	45
hrpF	0411	hgi-34	TTCGCCAAAATAGTTCGT	28	CAACAT	94	31, 45
T3SS-associated components
hpaF	0409	hgi-203	TTCGCCAGGCGATGCAGCCTCTTCGC	30	TAGCCT	46	31, 32
hpaH	0441	hgi-81	TTCGCTTGCCTATTAAGTGTTTCGT	31	TATGTT	176	31, 32
hpaJ	2440	RT-PCR					30
xopA	0440	hgi-27	TTCGCTTGCACAAGCGTAATTTCGC	31	TACTGT	93	31, 32
Type III effector genes
avrBs1	d0104	Const. gus					12, 35
avrBs2	0052	ND	TTCGCATCCGGGCGGTACTTTTCGC	30	TTTACT	28	37
avrRxv^f	0471	Const. gus	TTCGCATTATTGCCTAGATCTTCGC	31	TCTAAT	6	6, 46
ecf^f	3785	Const. by RT-PCR	TTCGTCGTCCCAGCCAGGACTTCGG	31	TACAGT	483	27
xopB	0581	hgi-25 hgi-66 hgi-80	TTCGCCGTCCCAACCATGACTTCGG	30	CAAACT	346	31
xopC	2435	hgi-37 hgi-41	TTCGCTCTCAGACGGGTTTTTTCTC	30	TAAAAT	193	30, 31
xopD	0437	gus	ATCGCTTCAGAGGAAGCTTGTTCGT	32	TAAATT	684	32
xopF1	0414	ND	TTCGTGTATGGCGCAGGTGGTTCGC	32	GACAAT	57	34
xopF2	2942	ND	TTCGTGCGTTGCGCCGGTGATTCGC	31	GACACT	53	34
xopJ	2156	hgi-11	TTCGTCGTCACAGCTATGACTTCGG	30	CAAACT	29	30, 31
xopN	2944	ND	TTCGCGCAGTGCATTCACCACTTCGC	32	CAGGAA	114	34
xopO	1055	ND	TTCGGAATGGTGGAAAATTTTTCCT	31	CATCAT	31	34
xopP	1236	ND	TTCGTCTCAGTCACCACGCATTCGC	32	TACTAA	340	34
xopQ	4438	hgi-63	TTCGTCGCCGCACACAGGAATTCAC	31	TAACGT	145	31, 34
xopX	0572	ND	TTCTTCCTGCAACGCAGTAGTTCGC	30	CAAATG	57	25
Uncharacterized genes	d0093	hgi-1	TTCTCTAACGCGGCGATTACTTCCG	30	TACTGT	29	31
	0041/0042	hgi-100	TTCGCTTGCCAATCTAGCGTTTCCG	31	CAGACT	28	31
	0324	hgi-69	TTCGCATACGCAAGCGGGATTTCCA	31	TATGCT	10	31
	0536	hgi-49, RT-PCR	TTCGCGGCGCGCGCGCCAGCTTCGT	31	CATACT	248	This study
	0845	hgi-128 hgi-130	ATCGTTTTACGCACACAGAGTTCGC	31	GAGAAT	38	31
	0869	hgi-9					31
	1512	hgi-213	TTCGTGCGCTGAGGTGTCGCATCGC	32	CAACGT	15	31
	2568	hgi-6, RT-PCR	TTCGCACACGCACCCTTGCATTCGC	32	TATGAT	191	This study
	2729	hgi-127, RT-PCR	TTCGCTTTGCATCGCTGCACTTCGT	30	TATGGT	120	31; this study
	2993/2994	hgi-94/hgi-52, RT-PCR					31; this study
	3013	hgi-208	TTCCGTTTGATCGGCAGCACTTCGC	30	AACGAT	184	31
	3406	hgi-16					31
	3407	hgi-98, RT-PCR	TTCGGCCAAGCTTACGTCAACTCGC	31	CATGCT	293	31; this study
	3765	hgi-133, RT-PCR	TTCGTTTTTGGAGCGCCGCGTGCGG	30	CACACT	79	This study
	4423	hgi-40					31
	4424	hgi-221, RT-PCR	TTCGTTTGCTGCGGCGGCGCTTCGT	31	TACGAT	81	This study

Open in a new tab

Number of CDS according to the genome annotation (40).

Experimental evidence for HrpX-dependent expression. All hgi genes (hrpG-induced genes) originated from a cDNA-AFLP screen (31); gus indicates experimental evidence from a beta-glucuronidase reporter gene fusion. Const., constitutive expression; ND, not determined.

PIP box half-sites and conserved nucleotides of the −10 region are shown in bold. Nucleotides deviating from the consensus are underlined.

Distance in base pairs between the end of the PIP box and the −10 promoter motif.

Distance in base pairs between the end of the −10 promoter motif and the predicted translational start codon.

avrRxv and ecf were not upregulated in minimal medium when present on a plasmid (6, 27).

To confirm the hrpX-dependent expression of genes with candidate PIP box-regulated promoters deviating from the consensus sequence, we performed another RT-PCR analysis. As shown in Fig. 1, transcripts of genes XCV3407 and XCV3765 are highly abundant in strain 85* but not in the control strains. This indicates that genes with a mismatch in the second PIP box half-site are also HrpG- and HrpX-dependently expressed. These results corroborated our assumption that HrpX might bind directly to the PIP box and encouraged us to set up an assay to confirm this hypothesis. Since the regulation of genes in the hrp cluster is well characterized, we focused our analyses on the operons hrpB to hrpF.

Construction and characterization of an epitope-tagged HrpX derivative.

To test HrpX for DNA binding, we wanted to express a functional protein with an epitope tag to facilitate detection. For this purpose, promoterless derivatives of the hrpX gene with its authentic ribosome-binding site were cloned into the medium-copy-number vector pBBR1MCS-5 under control of the E. coli lac promoter, which is constitutively active in X. campestris pv. vesicatoria (43). Two constructs were created, with one encoding the wild-type HrpX protein and the other encoding a derivative with a hexahistidine tag fused at the C terminus (HrpX-His). Both HrpX-encoding plasmids were conjugated into X. campestris pv. vesicatoria strains 85-10ΔhrpX and 85*ΔhrpX, which carry a deletion of the hrpX gene. Inoculation of transconjugants into resistant ECW-10R pepper leaves induced the hypersensitive response at 2 days postinoculation, comparable to that in the hrpX wild-type strain, demonstrating that the epitope-tagged HrpX derivative was able to complement the hrpX deletion (Fig. 2). As expected, there was no response when the hrpX deletion strain (with or without empty vector) was inoculated (Fig. 2). Western blot analysis revealed the presence of HrpX-His in total cell extracts of X. campestris pv. vesicatoria (data not shown), confirming that the epitope is proteolytically stable and thus suitable for the following experiments.

FIG. 2. — Complementation of the 85* *hrpX* deletion mutant by hexahistidine-tagged HrpX. *X. campestris* pv. vesicatoria strains expressing AvrBs1 were inoculated into an AvrBs1-responsive ECW-10R pepper leaf. The response to the translocation of AvrBs1 was monitored in the wild-type strain (85*) and the isogenic *hrpX* deletion mutant (85*Δ*hrpX*) without a plasmid, with plasmid pBBR1MCS-5 (empty vector), and with a pBBR1MCS-5 derivative expressing a hexahistidine-tagged HrpX derivative (HrpX-His). The wild-type and complemented strains induced the hypersensitive response. In contrast, there was no response to 85*Δ*hrpX* or 85*Δ*hrpX* with empty vector. *X. campestris* pv. vesicatoria strains were inoculated at 5 × 10⁸ CFU/ml. Two days after inoculation, the leaf was bleached with ethanol. The dark regions result from phenolic compounds due to the development of the hypersensitive response. The dashed lines indicate the inoculated areas.

DNA affinity enrichment of HrpX using perfect and imperfect PIP boxes.

To determine whether HrpX binds the PIP box, we used a magnetic DNA affinity enrichment approach. A 300-bp DNA fragment harboring the two PIP boxes (14 bp from each other) of the divergently transcribed hrpB and hrpC operons was amplified by PCR (Fig. 3). As a negative control, an internal 300-bp region of the hrcV gene, which lacks a PIP box, was generated. The purified DNA fragments were immobilized on streptavidin-coated magnetic beads, which were then incubated with a crude protein extract from X. campestris pv. vesicatoria containing HrpX-His. We did not use E. coli extracts since we suspected that binding to DNA might require the preformation of a binary complex between RNA polymerase and the activator, as shown for the AraC-type regulators MarA and SoxS (23).

FIG. 3. — Genetic organization of the *X. campestris* pv. vesicatoria *hrp* gene cluster and DNA fragments used for magnetic DNA affinity enrichment of HrpX. The solid lines at the top indicate the six *hrp* transcription units, *hrpA* to *hrpF*; the thick arrows indicate different genes. *hrc* genes are shown as open arrows and are labeled with the corresponding letter code, *hrp* genes are shown in dark gray, *hpa* genes are shown as striped arrows, and the *xopF1* gene is shown in light gray. Perfect PIP boxes (black circles) and the imperfect PIP box of *hrpF* (open circle) are indicated. DNA fragments used for magnetic DNA affinity enrichment of HrpX are symbolized by black bars below the map (not drawn to scale). Sequences of oligonucleotide primers used for PCR amplification of biotinylated DNA fragments are listed along with the PIP boxes contained by these DNA fragments. Mutant variants of the *hrpD* PIP box are given at the bottom. Conserved half-sites of the PIP boxes are shown in bold.

After washing and elution of bound proteins from the beads, eluted proteins were analyzed by SDS-PAGE and Western blot analysis using His tag-specific antibodies. A strong signal of the expected molecular size was observed with the PIP box-containing fragment corresponding to the hrpB-hrpC promoter region (Fig. 4A, lane 1) but not with the negative control lacking a PIP box (Fig. 4A, lane 4). To ensure that in all cases similar protein amounts were applied to the beads, eluted protein samples were separated in a second SDS-PAGE gel, which was silver stained (Fig. 4B). As a second negative control, we used a DNA fragment from E. coli containing the lexA operator (10). As expected, this DNA fragment did not bind HrpX-His (data not shown). These results strongly suggest that HrpX binds to a PIP box-containing DNA fragment.

FIG. 4. — DNA affinity enrichment of HrpX using a DNA fragment containing a PIP box. (A) Immunoblot analysis of protein eluates after magnetic DNA affinity enrichment. A soluble protein extract of *X. campestris* pv. vesicatoria strain 85* was applied to DNA fragments with PIP boxes of the divergently transcribed *hrpB* and *hrpC* operons (lane 1), of *hrpD* (lane 2), and of *hrpE* (lane 3) and to an *hrcV* DNA fragment lacking a PIP box (lane 4). In a separate experiment, binding of HrpX-His to a DNA fragment with the *hrpB-hrpC* PIP boxes (lane 5) was compared to binding to a DNA fragment with the imperfect *hrpF* PIP box (lane 6). Proteins were separated by SDS-PAGE, blotted, and incubated with a His tag-specific antibody. (B) As a control for equal loading of the samples shown in panel A, a second SDS-PAGE gel was stained with silver. Protein samples were as in panel A, lanes 1 to 4. (C) Immunoblot analysis of protein eluates outlined in panel A, using DNA fragments with the *hrpD* wild-type PIP box (lane 1), a PIP box with TT-to-AG mutations of the first half-site (lane 2), a PIP box with TT-to-AG mutations of the second half-site (lane 3), and a PIP box with TT-to-AG mutations of both half-sites (lane 4). (D) As a loading control for the samples shown in panel C, a second SDS-PAGE gel was stained with Coomassie blue. Since it was expected that the mutant PIP boxes would bind weakly to HrpX, four times more protein was applied in lanes 2 to 4. M, molecular mass marker. The bars correspond to molecular masses of 80, 61, and 48 kDa, from top to bottom.

To further support the hypothesis that HrpX binds to the PIP box and not to another DNA sequence motif which might have been present on the 300-bp hrpB-hrpC fragment, we tested three additional DNA fragments of between 165 and 287 bp in length. As shown in Fig. 4A, HrpX-His also bound to DNA fragments containing the perfect PIP boxes of the hrpD and hrpE operons (lanes 2 and 3). Interestingly, a DNA fragment containing the imperfect PIP box of hrpF was bound by HrpX-His with the same efficiency as that for fragments containing the other PIP boxes (Fig. 4A, lanes 5 and 6). Hence, HrpX binds to both perfect and imperfect PIP boxes.

Effects of base substitutions in the PIP box on HrpX binding.

To confirm the sequence specificity of HrpX binding, DNA fragments mutated in the PIP box were used. For this experiment, we constructed three mutants with substitutions in the hrpD PIP box, where the TT dinucleotide of each half-site was replaced by AG, either individually or in combination, leading to hrpD-mut1, hrpD-mut2, and hrpD-mut12 (Fig. 3). The same replacements have been shown to reduce the promoter activity of the hrpY gene from R. solanacearum 10-fold, and the simultaneous replacement of both TT motifs lowered the activity by a factor of 17 (7).

Upon DNA affinity enrichment, both single mutations led to drastic reductions in the HrpX-specific signal in Western blots probed with His tag-specific antibodies (Fig. 4C, lanes 2 and 3). No signal was observed with the double mutant hrpD-mut12 (Fig. 4C, lane 4). Hence, point mutations in the PIP box may diminish or abolish binding of HrpX. From these results, we conclude that HrpX binds specifically to the PIP box of HrpX-regulated genes.

DISCUSSION

In this study, we demonstrate that the AraC-type transcriptional activator HrpX from X. campestris pv. vesicatoria interacts with a cis-regulatory element, the PIP box, which is present in the promoter regions of many HrpX-regulated genes. To our knowledge, this is the first report on the binding of an Hrp regulatory protein to promoters controlling expression of the T3SS in plant pathogens. Using magnetic DNA affinity enrichment, we show that HrpX binds to the promoter regions of the hrp operons hrpB to hrpF, which contain a perfect PIP box (hrpB to hrpE) or an imperfect PIP box (hrpF). HrpX displayed strongly impaired binding to mutant variants of the PIP box in which the TT motif of the first or second half-site had been replaced by AG. Simultaneous replacements of the TT motif of both half-sites abolished binding of HrpX. These results fit with previous findings for R. solanacearum, where identical replacements in the hrp_II box resulted in drastically reduced activity of the hrpY promoter (7). From these results, we conclude that the Xanthomonas PIP box and the Ralstonia hrp_II box are functionally equivalent and serve as DNA targets for binding of the corresponding AraC-type transcriptional activators, HrpX and HrpB, respectively. This conclusion is supported by the observation that an hrpX mutant of X. campestris pv. vesicatoria was partially complemented by the homologous hrpB gene from R. solanacearum (42). The fact that complementation was only partial is possibly due to suboptimal interaction of the Ralstonia HrpB protein with the Xanthomonas RNA polymerase.

How might HrpX bind to the PIP box? Most AraC-type regulators form dimers and have a typical modular structure with an N-terminal dimerization domain and a C-terminal DNA-binding domain, including two helix-turn-helix DNA-binding motifs, HTH-1 and HTH-2 (17). Both protein domains are also present in HrpX. AraC-type regulators can activate transcription by different mechanisms. In class I promoters, binding occurs upstream of the −35 region (usually in a backward orientation, as defined by Martin and coworkers), whereas in class II promoters, binding occurs in forward orientation and overlaps with the −35 region (23, 24). In a well-studied case, activation by the catabolite activator protein (CAP) involves the interaction of alternative CAP surfaces with subunits of the RNA polymerase (4). Activation at sites upstream of the −35 region (class I) involves contacts between CAP and the carboxy-terminal domain of the α subunit of RNA polymerase. Activation at sites overlapping the −35 region (class II) involves contacts between CAP and the N-terminal domain of the α subunit of RNA polymerase. Class II activation additionally involves contacts of the activator with the RNA polymerase σ factor (3).

We suggest that HrpX binds as a homodimer to the PIP box in a such way that the well-conserved HTH-1 motifs of both subunits contact the two conserved PIP box half-sites (Fig. 5). Both half-sites, which are typically separated by 15 bp, would be presented on the same side of the DNA double helix, with an offset of two helical turns. Because of the fixed spacing of 30 to 32 bp between the PIP box and the −10 promoter motif, which would result in an overlap of the HrpX binding site with the −35 region, we suggest that HrpX-dependent activation follows the class II mode (Fig. 5). In the opposite orientation, the distance between the −35 region and the HrpX binding site would be much smaller than that observed for the well-characterized class I promoters of the mar/sox/rob regulon promoters (24). At present, how HrpX binds to the hrpF promoter is an enigma. In contrast to perfect PIP boxes, the hrpF PIP box consists of two half-sites which are separated by only 8 bp, thus being shifted with respect to each other by about 85° along the axis of the DNA double helix. Possibly, a twisted HrpX dimer binds to this promoter. Biochemical approaches using purified HrpX are needed to uncover the details of the protein-DNA interactions. For this purpose, the hexahistidine-tagged variant of HrpX will be instrumental.

FIG. 5. — Model of binding of HrpX to PIP boxes of the *hrp* operons of *X. campestris* pv. vesicatoria. In cases of class I activation, a HrpX homodimer would bind in a backward orientation with the HTH-1 motif of each subunit contacting the two conserved half-sites of the PIP box. In cases of class II activation, a HrpX homodimer would bind in a forward orientation, thus overlapping with the −35 region and making direct contact with the sigma factor. A schematic DNA double helix illustrating the periodicity of 10.5 bp per helical turn and sequences of the promoter regions of the *hrpB* to *hrpE* operons are shown below. Mapped transcriptional start sites are shown in bold (13; Bonas, unpublished data).

In a cDNA-AFLP screen, 26 HrpX-dependently induced genes were identified in X. campestris pv. vesicatoria (31; U. Bonas, unpublished data). Since the screen was not saturating, the number of hrpG- and hrpX-regulated genes is certainly higher. Bioinformatic approaches revealed 24 perfect candidate PIP box-regulated promoters in the chromosome of X. campestris pv. vesicatoria strain 85-10 (40; see supplementary Table 1 at http://www.biologie.uni-halle.de/genet/plant/research/supplementary/). In this study, the hrpX-dependent expression of seven of the corresponding genes and of two genes with slight deviations from the consensus PIP box-regulated promoter (Table 3) has been confirmed. Some of the associated genes encode proteins with putative roles in pathogenicity, such as plant cell wall-degrading enzymes (the polygalacturonase XCV0722, putative pectate lyase XCV2569, polygalacturonase XCV2571, and putative xylosidase XCV2728) and the putative avirulence protein AvrRxo1 (XCV4428). Recently, a NUDIX hydrolase from R. solanacearum, Hpx26, was found to be HrpB-dependently synthesized and secreted by the T3SS (39). We speculate, therefore, that the NUDIX hydrolase XCV0537 might represent a novel type III effector of X. campestris pv. vesicatoria. We were surprised to find the trp operon (XCV0505 to XCV0518) among the hrpX-dependent genes. Interestingly, there is a complete type 1 restriction-modification system inserted in the trp operon of X. campestris pv. vesicatoria. A closely related type 1 restriction-modification system is found only in X. campestris pv. campestris, where it is inserted at the same position in the trp operon. In contrast, the trp operon of Xanthomonas axonopodis pv. citri appears to be intact and that of Xanthomonas oryzae pv. oryzae is inactivated by an insertion sequence. We do not know if the type 1 restriction-modification system contributes to the fitness of the Xanthomonas population in the plant-pathogen ecosystem or to genome evolution (20).

Most known or predicted type III effector genes of X. campestris pv. vesicatoria are probably associated with PIP box-regulated promoters (Table 3). For five type III effector genes (xopB, xopC, xopD, xopJ, and xopQ), HrpX-dependent expression has now been confirmed experimentally (30-32; this study). Surprisingly, avrRxv and ecf were not upregulated in hrp-inducing minimal medium, although they contain candidate PIP box-regulated promoters (6, 27). One explanation might be that the predicted promoters are not functional, as indicated by their exceptionally short or long distance to the predicted translational start codons. Alternatively, the experimental results may not represent the natural situation, because the assays with avrRxv and ecf have been performed with plasmid-encoded systems, thus facing the problem of possible titration effects. The avrBs1 gene does not contain a candidate PIP box-regulated promoter and, as expected, is constitutively expressed (12). Hence, most, but not all, type III effector genes are HrpX-dependently coregulated with the T3SS.

Analysis of the X. campestris pv. vesicatoria chromosome for candidate plant-inducible promoters, with one allowed mismatch in the PIP box or in the −10 region, predicts 198 candidate PIP box-regulated promoters (data not shown). This number is on the same order of magnitude as the number of genes that have been identified as HrpB upregulated in a genome-wide analysis of gene expression in R. solanacearum (33). In addition to new candidate type III effector genes, a number of genes governing chemotaxis, biosynthesis, or catabolism of various low-molecular-weight chemical compounds and siderophore production and uptake were found among the 143 HrpB-upregulated genes of R. solanacearum. The 198 candidate PIP box-regulated promoters of X. campestris pv. vesicatoria would drive the expression of a similarly diverse set of genes. Thus, hrpX may act as a key regulatory gene controlling a large regulon which extends beyond T3SS-related functions.

After completing this report, we became aware of a study from the laboratory of Seiji Tsuge describing novel members of the HrpX regulon of X. oryzae pv. oryzae (15). Using a similar approach to that presented in this study, they predicted 15 HrpX-dependent genes and confirmed HrpX-dependent expression of 9 of them by using a gus reporter system. Furthermore, they provide experimental evidence that both the PIP box and the −10 region are essential for HrpX-dependent gene activation in Xanthomonas, a finding that supports the approach and conclusions of our study.

Acknowledgments

We thank Hannelore Espenhahn for technical assistance and Bianca Rosinsky for greenhouse work. We are grateful to Jens Boch for critically reading the manuscript and to Steffen Schaffer (Research Center Jülich, Germany) for providing experimental details of the DNA affinity enrichment procedure.

This work was funded in part by grants from the Deutsche Forschungsgemeinschaft (SFB 363 and 648) and the Federal Ministry of Education and Research (BMBF GenoMik initiative) to U.B.

REFERENCES

1.Bogdanove, A. J., S. V. Beer, U. Bonas, C. A. Boucher, A. Collmer, D. L. Coplin, G. R. Cornelis, H. C. Huang, S. W. Hutcheson, N. J. Panopoulos, and F. Van Gijsegem. 1996. Unified nomenclature for broadly conserved hrp genes of phytopathogenic bacteria. Mol. Microbiol. 20:681-683. [DOI] [PubMed] [Google Scholar]
2.Bonas, U., R. Schulte, S. Fenselau, G. V. Minsavage, B. J. Staskawicz, and R. E. Stall. 1991. Isolation of a gene cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on pepper and tomato. Mol. Plant-Microbe Interact. 4:81-88. [Google Scholar]
3.Browning, D. F., and S. J. Busby. 2004. The regulation of bacterial transcription initiation. Nat. Rev. Microbiol. 2:57-65. [DOI] [PubMed] [Google Scholar]
4.Busby, S., and R. H. Ebright. 1997. Transcription activation at class II CAP-dependent promoters. Mol. Microbiol. 23:853-859. [DOI] [PubMed] [Google Scholar]
5.Canteros, B. J. 1990. Diversity of plasmids and plasmid-encoded phenotypic traits in Xanthomonas campestris pv. vesicatoria. Ph.D. thesis. University of Florida, Gainesville.
6.Ciesiolka, L. D., T. Hwin, J. D. Gearlds, G. V. Minsavage, R. Saenz, M. Bravo, V. Handley, S. M. Conover, H. Zhang, J. Caporgno, N. B. Phengrasamy, A. O. Toms, R. E. Stall, and M. C. Whalen. 1999. Regulation of expression of avirulence gene avrRxv and identification of a family of host interaction factors by sequence analysis of avrBsT. Mol. Plant-Microbe Interact. 12:35-44. [DOI] [PubMed] [Google Scholar]
7.Cunnac, S., C. Boucher, and S. Genin. 2004. Characterization of the cis-acting regulatory element controlling HrpB-mediated activation of the type III secretion system and effector genes in Ralstonia solanacearum. J. Bacteriol. 186:2309-2318. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Daniels, M. J., C. E. Barber, P. C. Turner, M. K. Sawczyc, R. J. W. Byrde, and A. H. Fielding. 1984. Cloning of genes involved in pathogenicity of Xanthomonas campestris pv. campestris using the broad host range cosmid pLAFR1. EMBO J. 3:3323-3328. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Ditta, G., S. Stanfield, D. Corbin, and D. R. Helinski. 1980. Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77:7347-7351. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Dmitrova, M., G. Younes-Cauet, P. Oertel-Buchheit, D. Porte, M. Schnarr, and M. Granger-Schnarr. 1998. A new LexA-based genetic system for monitoring and analyzing protein heterodimerization in Escherichia coli. Mol. Gen. Genet. 257:205-212. [DOI] [PubMed] [Google Scholar]
11.Engels, S., J. E. Schweitzer, C. Ludwig, M. Bott, and S. Schaffer. 2004. clpC and clpP1P2 gene expression in Corynebacterium glutamicum is controlled by a regulatory network involving the transcriptional regulators ClgR and HspR as well as the ECF sigma factor sigmaH. Mol. Microbiol. 52:285-302. [DOI] [PubMed] [Google Scholar]
12.Escolar, L., G. Van den Ackerveken, S. Pieplow, O. Rossier, and U. Bonas. 2001. Type III secretion and in planta recognition of the Xanthomonas avirulence proteins AvrBs1 and AvrBsT. Mol. Plant Pathol. 2:287-296. [DOI] [PubMed] [Google Scholar]
13.Fenselau, S., and U. Bonas. 1995. Sequence and expression analysis of the hrpB pathogenicity operon of Xanthomonas campestris pv. vesicatoria which encodes eight proteins with similarity to components of the Hrp, Ysc, Spa, and Fli secretion systems. Mol. Plant-Microbe Interact. 8:845-854. [DOI] [PubMed] [Google Scholar]
14.Figurski, D. H., and D. R. Helinski. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76:1648-1652. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Furutani, A., T. Nakayama, H. Ochiai, H. Kaku, Y. Kubo, and S. Tsuge. 2006. Identification of novel HrpXo regulons preceded by two cis-acting elements, a plant-inducible promoter box and a −10 box-like sequence, from the genome database of Xanthomonas oryzae pv. oryzae. FEMS Microbiol. Lett. 259:133-141. [DOI] [PubMed] [Google Scholar]
16.Gabrielsen, O. S., E. Hornes, L. Korsnes, A. Ruet, and T. B. Oyen. 1989. Magnetic DNA affinity purification of yeast transcription factor τ—a new purification principle for the ultrarapid isolation of near homogeneous factor. Nucleic Acids Res. 17:6253-6267. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Gallegos, M. T., R. Schleif, A. Bairoch, K. Hofmann, and J. L. Ramos. 1997. AraC/XylS family of transcriptional regulators. Microbiol. Mol. Biol. Rev. 61:393-410. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Gürlebeck, D., F. Thieme, and U. Bonas. 2006. Type III effector proteins from the plant pathogen Xanthomonas and their role in the interaction with the host plant. J. Plant Physiol. 163:233-255. [DOI] [PubMed] [Google Scholar]
19.Huguet, E., and U. Bonas. 1997. hrpF of Xanthomonas campestris pv. vesicatoria encodes an 87-kDa protein with homology to NoIX of Rhizobium fredii. Mol. Plant-Microbe Interact. 10:488-498. [DOI] [PubMed] [Google Scholar]
20.Kobayashi, I. 2001. Behavior of restriction-modification systems as selfish mobile elements and their impact on genome evolution. Nucleic Acids Res. 29:3742-3756. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop II, and K. M. Peterson. 1995. Four new derivatives of the broad- host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176. [DOI] [PubMed] [Google Scholar]
22.Lindgren, P. B., R. C. Peet, and N. J. Panopoulos. 1986. Gene cluster of Pseudomonas syringae pv. “phaseolicola” controls pathogenicity of bean plants and hypersensitivity of nonhost plants. J. Bacteriol. 168:512-522. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Martin, R. G., W. K. Gillette, N. I. Martin, and J. L. Rosner. 2002. Complex formation between activator and RNA polymerase as the basis for transcriptional activation by MarA and SoxS in Escherichia coli. Mol. Microbiol. 43:355-370. [DOI] [PubMed] [Google Scholar]
24.Martin, R. G., W. K. Gillette, S. Rhee, and J. L. Rosner. 1999. Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter. Mol. Microbiol. 34:431-441. [DOI] [PubMed] [Google Scholar]
25.Metz, M., D. Dahlbeck, C. Q. Morales, B. Al Sady, E. T. Clark, and B. J. Staskawicz. 2005. The conserved Xanthomonas campestris pv. vesicatoria effector protein XopX is a virulence factor and suppresses host defense in Nicotiana benthamiana. Plant J. 41:801-814. [DOI] [PubMed] [Google Scholar]
26.Minsavage, G. V., D. Dahlbeck, M. C. Whalen, B. Kearny, U. Bonas, B. J. Staskawicz, and R. E. Stall. 1990. Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv. vesicatoria-pepper interactions. Mol. Plant-Microbe Interact. 3:41-47. [Google Scholar]
27.Morales, C. Q., J. Posada, E. Macneale, D. Franklin, I. Rivas, M. Bravo, J. Minsavage, R. E. Stall, and M. C. Whalen. 2005. Functional analysis of the early chlorosis factor gene. Mol. Plant-Microbe Interact. 18:477-486. [DOI] [PubMed] [Google Scholar]
28.Mudgett, M. B. 2005. New insights to the function of phytopathogenic bacterial type III effectors in plants. Annu. Rev. Plant Biol. 56:509-531. [DOI] [PubMed] [Google Scholar]
29.Mukaihara, T., N. Tamura, Y. Murata, and M. Iwabuchi. 2004. Genetic screening of Hrp type III-related pathogenicity genes controlled by the HrpB transcriptional activator in Ralstonia solanacearum. Mol. Microbiol. 54:863-875. [DOI] [PubMed] [Google Scholar]
30.Noël, L., F. Thieme, J. Gäbler, D. Büttner, and U. Bonas. 2003. XopC and XopJ, two novel type III effector proteins from Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 185:7092-7102. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Noël, L., F. Thieme, D. Nennstiel, and U. Bonas. 2001. cDNA-AFLP analysis unravels a genome-wide hrpG-regulon in the plant pathogen Xanthomonas campestris pv. vesicatoria. Mol. Microbiol. 41:1271-1281. [DOI] [PubMed] [Google Scholar]
32.Noël, L., F. Thieme, D. Nennstiel, and U. Bonas. 2002. Two novel type III-secreted proteins of Xanthomonas campestris pv. vesicatoria are encoded within the hrp pathogenicity island. J. Bacteriol. 184:1340-1348. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Occhialini, A., S. Cunnac, N. Reymond, S. Genin, and C. Boucher. 2005. Genome-wide analysis of gene expression in Ralstonia solanacearum reveals that the hrpB gene acts as a regulatory switch controlling multiple virulence pathways. Mol. Plant-Microbe Interact. 18:938-949. [DOI] [PubMed] [Google Scholar]
34.Roden, J. A., B. Belt, J. B. Ross, T. Tachibana, J. Vargas, and M. B. Mudgett. 2004. A genetic screen to isolate type III effectors translocated into pepper cells during Xanthomonas infection. Proc. Natl. Acad. Sci. USA 101:16624-16629. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Ronald, P. C., and B. J. Staskawicz. 1988. The avirulence gene avrBs1 from Xanthomonas campestris pv. vesicatoria encodes a 50-kD protein. Mol. Plant-Microbe Interact. 1:191-198. [PubMed] [Google Scholar]
36.Schulte, R., and U. Bonas. 1992. Expression of the Xanthomonas campestris pv. vesicatoria hrp gene cluster, which determines pathogenicity and hypersensitivity on pepper and tomato, is plant inducible. J. Bacteriol. 174:815-823. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Swords, K. M., D. Dahlbeck, B. Kearney, M. Roy, and B. J. Staskawicz. 1996. Spontaneous and induced mutations in a single open reading frame alter both virulence and avirulence in Xanthomonas campestris pv. vesicatoria avrBs2. J. Bacteriol. 178:4661-4669. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Tampakaki, A. P., V. E. Fadouloglou, A. D. Gazi, N. J. Panopoulos, and M. Kokkinidis. 2004. Conserved features of type III secretion. Cell. Microbiol. 6:805-816. [DOI] [PubMed] [Google Scholar]
39.Tamura, N., Y. Murata, and T. Mukaihara. 2005. Isolation of Ralstonia solanacearum hrpB constitutive mutants and secretion analysis of hrpB-regulated gene products that share homology with known type III effectors and enzymes. Microbiology 151:2873-2884. [DOI] [PubMed] [Google Scholar]
40.Thieme, F., R. Koebnik, T. Bekel, C. Berger, J. Boch, D. Büttner, C. Caldana, L. Gaigalat, A. Goesmann, S. Kay, O. Kirchner, C. Lanz, B. Linke, A. C. McHardy, F. Meyer, G. Mittenhuber, D. H. Nies, U. Niesbach-Klösgen, T. Patschkowski, C. Rückert, O. Rupp, S. Schneiker, S. C. Schuster, F. Vorhölter, E. Weber, A. Pühler, U. Bonas, D. Bartels, and O. Kaiser. 2005. Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J. Bacteriol. 187:7254-7266. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Tsuge, S., S. Terashima, A. Furutani, H. Ochiai, T. Oku, K. Tsuno, H. Kaku, and Y. Kubo. 2005. Effects on promoter activity of base substitutions in the cis-acting regulatory element of HrpXo regulons in Xanthomonas oryzae pv. oryzae. J. Bacteriol. 187:2308-2314. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Wengelnik, K., and U. Bonas. 1996. HrpXv, an AraC-type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 178:3462-3469. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Wengelnik, K., C. Marie, M. Russel, and U. Bonas. 1996. Expression and localization of HrpA1, a protein of Xanthomonas campestris pv. vesicatoria essential for pathogenicity and induction of the hypersensitive reaction. J. Bacteriol. 178:1061-1069. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Wengelnik, K., O. Rossier, and U. Bonas. 1999. Mutations in the regulatory gene hrpG of Xanthomonas campestris pv. vesicatoria result in constitutive expression of all hrp genes. J. Bacteriol. 181:6828-6831. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Wengelnik, K., G. Van den Ackerveken, and U. Bonas. 1996. HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two-component response regulators. Mol. Plant-Microbe Interact. 9:704-712. [DOI] [PubMed] [Google Scholar]
46.Whalen, M. C., J. F. Wang, F. M. Carland, M. E. Heiskell, D. Dahlbeck, G. V. Minsavage, J. B. Jones, J. W. Scott, R. E. Stall, and B. J. Staskawicz. 1993. Avirulence gene avrRxv from Xanthomonas campestris pv. vesicatoria specifies resistance on tomato line Hawaii 7998. Mol. Plant-Microbe Interact. 6:616-627. [DOI] [PubMed] [Google Scholar]
47.White, F. F., B. Yang, and L. B. Johnson. 2000. Prospects for understanding avirulence gene function. Curr. Opin. Plant. Biol. 3:291-298. [DOI] [PubMed] [Google Scholar]

[r1] 1.Bogdanove, A. J., S. V. Beer, U. Bonas, C. A. Boucher, A. Collmer, D. L. Coplin, G. R. Cornelis, H. C. Huang, S. W. Hutcheson, N. J. Panopoulos, and F. Van Gijsegem. 1996. Unified nomenclature for broadly conserved hrp genes of phytopathogenic bacteria. Mol. Microbiol. 20:681-683. [DOI] [PubMed] [Google Scholar]

[r2] 2.Bonas, U., R. Schulte, S. Fenselau, G. V. Minsavage, B. J. Staskawicz, and R. E. Stall. 1991. Isolation of a gene cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on pepper and tomato. Mol. Plant-Microbe Interact. 4:81-88. [Google Scholar]

[r3] 3.Browning, D. F., and S. J. Busby. 2004. The regulation of bacterial transcription initiation. Nat. Rev. Microbiol. 2:57-65. [DOI] [PubMed] [Google Scholar]

[r4] 4.Busby, S., and R. H. Ebright. 1997. Transcription activation at class II CAP-dependent promoters. Mol. Microbiol. 23:853-859. [DOI] [PubMed] [Google Scholar]

[r5] 5.Canteros, B. J. 1990. Diversity of plasmids and plasmid-encoded phenotypic traits in Xanthomonas campestris pv. vesicatoria. Ph.D. thesis. University of Florida, Gainesville.

[r6] 6.Ciesiolka, L. D., T. Hwin, J. D. Gearlds, G. V. Minsavage, R. Saenz, M. Bravo, V. Handley, S. M. Conover, H. Zhang, J. Caporgno, N. B. Phengrasamy, A. O. Toms, R. E. Stall, and M. C. Whalen. 1999. Regulation of expression of avirulence gene avrRxv and identification of a family of host interaction factors by sequence analysis of avrBsT. Mol. Plant-Microbe Interact. 12:35-44. [DOI] [PubMed] [Google Scholar]

[r7] 7.Cunnac, S., C. Boucher, and S. Genin. 2004. Characterization of the cis-acting regulatory element controlling HrpB-mediated activation of the type III secretion system and effector genes in Ralstonia solanacearum. J. Bacteriol. 186:2309-2318. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r8] 8.Daniels, M. J., C. E. Barber, P. C. Turner, M. K. Sawczyc, R. J. W. Byrde, and A. H. Fielding. 1984. Cloning of genes involved in pathogenicity of Xanthomonas campestris pv. campestris using the broad host range cosmid pLAFR1. EMBO J. 3:3323-3328. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r9] 9.Ditta, G., S. Stanfield, D. Corbin, and D. R. Helinski. 1980. Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77:7347-7351. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r10] 10.Dmitrova, M., G. Younes-Cauet, P. Oertel-Buchheit, D. Porte, M. Schnarr, and M. Granger-Schnarr. 1998. A new LexA-based genetic system for monitoring and analyzing protein heterodimerization in Escherichia coli. Mol. Gen. Genet. 257:205-212. [DOI] [PubMed] [Google Scholar]

[r11] 11.Engels, S., J. E. Schweitzer, C. Ludwig, M. Bott, and S. Schaffer. 2004. clpC and clpP1P2 gene expression in Corynebacterium glutamicum is controlled by a regulatory network involving the transcriptional regulators ClgR and HspR as well as the ECF sigma factor sigmaH. Mol. Microbiol. 52:285-302. [DOI] [PubMed] [Google Scholar]

[r12] 12.Escolar, L., G. Van den Ackerveken, S. Pieplow, O. Rossier, and U. Bonas. 2001. Type III secretion and in planta recognition of the Xanthomonas avirulence proteins AvrBs1 and AvrBsT. Mol. Plant Pathol. 2:287-296. [DOI] [PubMed] [Google Scholar]

[r13] 13.Fenselau, S., and U. Bonas. 1995. Sequence and expression analysis of the hrpB pathogenicity operon of Xanthomonas campestris pv. vesicatoria which encodes eight proteins with similarity to components of the Hrp, Ysc, Spa, and Fli secretion systems. Mol. Plant-Microbe Interact. 8:845-854. [DOI] [PubMed] [Google Scholar]

[r14] 14.Figurski, D. H., and D. R. Helinski. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76:1648-1652. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r15] 15.Furutani, A., T. Nakayama, H. Ochiai, H. Kaku, Y. Kubo, and S. Tsuge. 2006. Identification of novel HrpXo regulons preceded by two cis-acting elements, a plant-inducible promoter box and a −10 box-like sequence, from the genome database of Xanthomonas oryzae pv. oryzae. FEMS Microbiol. Lett. 259:133-141. [DOI] [PubMed] [Google Scholar]

[r16] 16.Gabrielsen, O. S., E. Hornes, L. Korsnes, A. Ruet, and T. B. Oyen. 1989. Magnetic DNA affinity purification of yeast transcription factor τ—a new purification principle for the ultrarapid isolation of near homogeneous factor. Nucleic Acids Res. 17:6253-6267. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r17] 17.Gallegos, M. T., R. Schleif, A. Bairoch, K. Hofmann, and J. L. Ramos. 1997. AraC/XylS family of transcriptional regulators. Microbiol. Mol. Biol. Rev. 61:393-410. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r18] 18.Gürlebeck, D., F. Thieme, and U. Bonas. 2006. Type III effector proteins from the plant pathogen Xanthomonas and their role in the interaction with the host plant. J. Plant Physiol. 163:233-255. [DOI] [PubMed] [Google Scholar]

[r19] 19.Huguet, E., and U. Bonas. 1997. hrpF of Xanthomonas campestris pv. vesicatoria encodes an 87-kDa protein with homology to NoIX of Rhizobium fredii. Mol. Plant-Microbe Interact. 10:488-498. [DOI] [PubMed] [Google Scholar]

[r20] 20.Kobayashi, I. 2001. Behavior of restriction-modification systems as selfish mobile elements and their impact on genome evolution. Nucleic Acids Res. 29:3742-3756. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r21] 21.Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop II, and K. M. Peterson. 1995. Four new derivatives of the broad- host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176. [DOI] [PubMed] [Google Scholar]

[r22] 22.Lindgren, P. B., R. C. Peet, and N. J. Panopoulos. 1986. Gene cluster of Pseudomonas syringae pv. “phaseolicola” controls pathogenicity of bean plants and hypersensitivity of nonhost plants. J. Bacteriol. 168:512-522. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r23] 23.Martin, R. G., W. K. Gillette, N. I. Martin, and J. L. Rosner. 2002. Complex formation between activator and RNA polymerase as the basis for transcriptional activation by MarA and SoxS in Escherichia coli. Mol. Microbiol. 43:355-370. [DOI] [PubMed] [Google Scholar]

[r24] 24.Martin, R. G., W. K. Gillette, S. Rhee, and J. L. Rosner. 1999. Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter. Mol. Microbiol. 34:431-441. [DOI] [PubMed] [Google Scholar]

[r25] 25.Metz, M., D. Dahlbeck, C. Q. Morales, B. Al Sady, E. T. Clark, and B. J. Staskawicz. 2005. The conserved Xanthomonas campestris pv. vesicatoria effector protein XopX is a virulence factor and suppresses host defense in Nicotiana benthamiana. Plant J. 41:801-814. [DOI] [PubMed] [Google Scholar]

[r26] 26.Minsavage, G. V., D. Dahlbeck, M. C. Whalen, B. Kearny, U. Bonas, B. J. Staskawicz, and R. E. Stall. 1990. Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv. vesicatoria-pepper interactions. Mol. Plant-Microbe Interact. 3:41-47. [Google Scholar]

[r27] 27.Morales, C. Q., J. Posada, E. Macneale, D. Franklin, I. Rivas, M. Bravo, J. Minsavage, R. E. Stall, and M. C. Whalen. 2005. Functional analysis of the early chlorosis factor gene. Mol. Plant-Microbe Interact. 18:477-486. [DOI] [PubMed] [Google Scholar]

[r28] 28.Mudgett, M. B. 2005. New insights to the function of phytopathogenic bacterial type III effectors in plants. Annu. Rev. Plant Biol. 56:509-531. [DOI] [PubMed] [Google Scholar]

[r29] 29.Mukaihara, T., N. Tamura, Y. Murata, and M. Iwabuchi. 2004. Genetic screening of Hrp type III-related pathogenicity genes controlled by the HrpB transcriptional activator in Ralstonia solanacearum. Mol. Microbiol. 54:863-875. [DOI] [PubMed] [Google Scholar]

[r30] 30.Noël, L., F. Thieme, J. Gäbler, D. Büttner, and U. Bonas. 2003. XopC and XopJ, two novel type III effector proteins from Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 185:7092-7102. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r31] 31.Noël, L., F. Thieme, D. Nennstiel, and U. Bonas. 2001. cDNA-AFLP analysis unravels a genome-wide hrpG-regulon in the plant pathogen Xanthomonas campestris pv. vesicatoria. Mol. Microbiol. 41:1271-1281. [DOI] [PubMed] [Google Scholar]

[r32] 32.Noël, L., F. Thieme, D. Nennstiel, and U. Bonas. 2002. Two novel type III-secreted proteins of Xanthomonas campestris pv. vesicatoria are encoded within the hrp pathogenicity island. J. Bacteriol. 184:1340-1348. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r33] 33.Occhialini, A., S. Cunnac, N. Reymond, S. Genin, and C. Boucher. 2005. Genome-wide analysis of gene expression in Ralstonia solanacearum reveals that the hrpB gene acts as a regulatory switch controlling multiple virulence pathways. Mol. Plant-Microbe Interact. 18:938-949. [DOI] [PubMed] [Google Scholar]

[r34] 34.Roden, J. A., B. Belt, J. B. Ross, T. Tachibana, J. Vargas, and M. B. Mudgett. 2004. A genetic screen to isolate type III effectors translocated into pepper cells during Xanthomonas infection. Proc. Natl. Acad. Sci. USA 101:16624-16629. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r35] 35.Ronald, P. C., and B. J. Staskawicz. 1988. The avirulence gene avrBs1 from Xanthomonas campestris pv. vesicatoria encodes a 50-kD protein. Mol. Plant-Microbe Interact. 1:191-198. [PubMed] [Google Scholar]

[r36] 36.Schulte, R., and U. Bonas. 1992. Expression of the Xanthomonas campestris pv. vesicatoria hrp gene cluster, which determines pathogenicity and hypersensitivity on pepper and tomato, is plant inducible. J. Bacteriol. 174:815-823. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r37] 37.Swords, K. M., D. Dahlbeck, B. Kearney, M. Roy, and B. J. Staskawicz. 1996. Spontaneous and induced mutations in a single open reading frame alter both virulence and avirulence in Xanthomonas campestris pv. vesicatoria avrBs2. J. Bacteriol. 178:4661-4669. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r38] 38.Tampakaki, A. P., V. E. Fadouloglou, A. D. Gazi, N. J. Panopoulos, and M. Kokkinidis. 2004. Conserved features of type III secretion. Cell. Microbiol. 6:805-816. [DOI] [PubMed] [Google Scholar]

[r39] 39.Tamura, N., Y. Murata, and T. Mukaihara. 2005. Isolation of Ralstonia solanacearum hrpB constitutive mutants and secretion analysis of hrpB-regulated gene products that share homology with known type III effectors and enzymes. Microbiology 151:2873-2884. [DOI] [PubMed] [Google Scholar]

[r40] 40.Thieme, F., R. Koebnik, T. Bekel, C. Berger, J. Boch, D. Büttner, C. Caldana, L. Gaigalat, A. Goesmann, S. Kay, O. Kirchner, C. Lanz, B. Linke, A. C. McHardy, F. Meyer, G. Mittenhuber, D. H. Nies, U. Niesbach-Klösgen, T. Patschkowski, C. Rückert, O. Rupp, S. Schneiker, S. C. Schuster, F. Vorhölter, E. Weber, A. Pühler, U. Bonas, D. Bartels, and O. Kaiser. 2005. Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J. Bacteriol. 187:7254-7266. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r41] 41.Tsuge, S., S. Terashima, A. Furutani, H. Ochiai, T. Oku, K. Tsuno, H. Kaku, and Y. Kubo. 2005. Effects on promoter activity of base substitutions in the cis-acting regulatory element of HrpXo regulons in Xanthomonas oryzae pv. oryzae. J. Bacteriol. 187:2308-2314. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r42] 42.Wengelnik, K., and U. Bonas. 1996. HrpXv, an AraC-type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 178:3462-3469. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r43] 43.Wengelnik, K., C. Marie, M. Russel, and U. Bonas. 1996. Expression and localization of HrpA1, a protein of Xanthomonas campestris pv. vesicatoria essential for pathogenicity and induction of the hypersensitive reaction. J. Bacteriol. 178:1061-1069. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r44] 44.Wengelnik, K., O. Rossier, and U. Bonas. 1999. Mutations in the regulatory gene hrpG of Xanthomonas campestris pv. vesicatoria result in constitutive expression of all hrp genes. J. Bacteriol. 181:6828-6831. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r45] 45.Wengelnik, K., G. Van den Ackerveken, and U. Bonas. 1996. HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two-component response regulators. Mol. Plant-Microbe Interact. 9:704-712. [DOI] [PubMed] [Google Scholar]

[r46] 46.Whalen, M. C., J. F. Wang, F. M. Carland, M. E. Heiskell, D. Dahlbeck, G. V. Minsavage, J. B. Jones, J. W. Scott, R. E. Stall, and B. J. Staskawicz. 1993. Avirulence gene avrRxv from Xanthomonas campestris pv. vesicatoria specifies resistance on tomato line Hawaii 7998. Mol. Plant-Microbe Interact. 6:616-627. [DOI] [PubMed] [Google Scholar]

[r47] 47.White, F. F., B. Yang, and L. B. Johnson. 2000. Prospects for understanding avirulence gene function. Curr. Opin. Plant. Biol. 3:291-298. [DOI] [PubMed] [Google Scholar]

PERMALINK

Specific Binding of the Xanthomonas campestris pv. vesicatoria AraC-Type Transcriptional Activator HrpX to Plant-Inducible Promoter Boxes^▿

Ralf Koebnik

Antje Krüger

Frank Thieme

Alexander Urban

Ulla Bonas

Abstract

MATERIALS AND METHODS