Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2003 Dec;185(24):7092–7102. doi: 10.1128/JB.185.24.7092-7102.2003

XopC and XopJ, Two Novel Type III Effector Proteins from Xanthomonas campestris pv. vesicatoria

Laurent Noël 1,†, Frank Thieme 1, Jana Gäbler 1,‡, Daniela Büttner 1, Ulla Bonas 1,*
PMCID: PMC296255  PMID: 14645268

Abstract

Pathogenicity of the gram-negative plant pathogen Xanthomonas campestris pv. vesicatoria depends on a type III secretion (TTS) system which translocates bacterial effector proteins into the plant cell. Previous transcriptome analysis identified a genome-wide regulon of putative virulence genes that are coexpressed with the TTS system. In this study, we characterized two of these genes, xopC and xopJ. Both genes encode Xanthomonas outer proteins (Xops) that were shown to be secreted by the TTS system. In addition, type III-dependent translocation of both proteins into the plant cell was demonstrated using the AvrBs3 effector domain as a reporter. XopJ belongs to the AvrRxv/YopJ family of effector proteins from plant and animal pathogenic bacteria. By contrast, XopC does not share significant homology to proteins in the database. Sequence analysis revealed that the xopC locus contains several features that are reminiscent of pathogenicity islands. Interestingly, the xopC region is flanked by 62-bp inverted repeats that are also associated with members of the Xanthomonas avrBs3 effector family. Besides xopC, a second gene of the locus, designated hpaJ, was shown to be coexpressed with the TTS system. hpaJ encodes a protein with similarity to transglycosylases and to the Pseudomonas syringae pv. maculicola protein HopPmaG. HpaJ secretion and translocation by the X. campestris pv. vesicatoria TTS system was not detectable, which is consistent with its predicted Sec signal and a putative function as transglycosylase in the bacterial periplasm.


Pathogenicity of many gram-negative bacterial pathogens of animals and plants depends on a specialized type III secretion (TTS) system which spans both bacterial membranes and is associated with an extracellular appendage (15, 24). The TTS system mediates Sec-independent protein secretion into the extracellular medium as well as the translocation of so-called effector proteins into the host cell. Bacterial mutants that are specifically affected in type III translocation are no longer pathogenic, indicating that the functions of effector proteins inside the host cell are globally essential for the successful outcome of the infection (9, 24). Recent comparative sequence analyses have uncovered homologies between effectors from different plant pathogens. Among these, several effector classes are also present in animal bacterial pathogens (7). The first reported example is the YopJ/AvrRxv family of effector proteins, which presumably function as proteases (33). YopJ from Yersinia pestis suppresses host defense responses by downregulating multiple mitogen-activated protein kinases and inhibiting the activation of the transcription factor NF-κB (41).

While the repertoire of effector proteins appears to be relatively limited in animal pathogens (e.g., six known effectors in Yersinia spp. [29]), an unexpectedly high number of effectors is found in plant pathogens (e.g., approximately 40 candidates each in Ralstonia solanacearum and Pseudomonas syringae [14, 47]). Due to the low in vitro secretion efficiency, the identification of effector proteins by biochemical approaches has been difficult. Furthermore, genetic strategies have not uncovered a significant number of effectors, probably due to redundant functions or a minor contribution to pathogenicity under laboratory conditions. In plant pathogens, many effectors have been identified as the products of avirulence (avr) genes that betray the pathogen to the surveillance system of resistant plants. Recognition of Avr proteins by corresponding plant resistance (R) gene products leads to the specific induction of defense responses that often culminate in the hypersensitive response (HR), a rapid local cell death at the infection site concomitant with arrest of bacterial growth (30, 49).

Recently, the availability of genomic sequence information for several plant pathogens (Xanthomonas campestris pv. campestris strain ATCC 33913, X. axonopodis pv. citri strain 306, R. solanacearum strain GMI1000, and P. syringae pv. tomato strain DC3000) has marked a milestone for the identification of putative effectors by bioinformatic approaches (14, 17, 47). Effector gene candidates have been discovered due to homologies to known effectors or the presence of eukaryotic motifs that suggest a function inside the host cell. Furthermore, many effector genes differ in G+C content and codon usage from the average genomic DNA and are associated with mobile genetic elements, indicating their acquisition by horizontal gene transfer. These genomic regions, which presumably contribute to the evolution of virulence, are generally referred to as pathogenicity islands (PAIs) (27).

Our laboratory studies the TTS system and the type III secretome of X. campestris pv. vesicatoria, the causal agent of bacterial spot disease in pepper and tomato (8). The X. campestris pv. vesicatoria TTS system is encoded by a 23-kb chromosomal hrp (hypersensitive response and pathogenicity) gene cluster which contains six operons, hrpA to hrpF (5, 21, 22, 28, 45; U. Bonas, unpublished data). Among the more than 20 proteins encoded by the hrp gene cluster, nine are highly conserved in plant and animal pathogenic bacteria. These genes were renamed hrc (hrp conserved) and probably encode the core components of the secretion apparatus (3). The role of nonconserved Hrp proteins is less clear. HrpE1 is predicted to be the major subunit of the Hrp pilus, an extracellular appendage that is associated with the TTS apparatus and probably serves as a conduit for secreted proteins moving to the plant cell surface (32; E. Weber, T. Ojanen-Reuhs, R. Koebnik, and U. Bonas, unpublished data). Protein translocation into the plant cell cytosol is presumably mediated by the type III translocon, a predicted channel-like protein complex that inserts into the host cell membrane (9). Recently, HrpF has been proposed to be the pore-forming component of the type III translocon (10). Besides hrc and hrp genes, analysis of nonpolar mutants in the hrp gene cluster also identified hpa (hrp associated) genes that might contribute to, but are not essential for, the interaction with the plant (28, 40; U. Bonas, unpublished data). Sequence analysis of the left hrp-flanking region revealed the presence of an insertion sequence (IS)-like element as well as putative effector genes with low G+C content compared to the genomic average (64% over 100 kb [39]), indicating acquisition of this region by horizontal gene transfer (40).

hrp gene expression is induced in planta (48) and is controlled by the regulatory genes hrpG and hrpX, which are located outside of the hrp gene cluster. The HrpG protein belongs to the OmpR family of two-component regulatory systems (54) and controls the expression of a large gene regulon including hrpX. The AraC-type transcriptional activator HrpX regulates the expression of the operons hrpB to hrpF (52) and of most members of the hrpG regulon (39, 40). Many hrpX-regulated genes contain a PIP box (plant-inducible promoter box; consensus TTCG-N16-TTCG) in their promoters, which has been proposed to serve as a regulatory element. However, this motif is neither necessary nor sufficient to confer HrpX inducibility (8).

Many hrpG-regulated genes have been identified by cDNA-amplified fragment length polymorphism (AFLP)-based analysis of the expression profiles of two isogenic X. campestris pv. vesicatoria strains, 85-10 and 85*, which differ in their hrp gene expression status (39). Strain 85* carries hrpG*, a mutated form of the key regulatory gene hrpG that leads to the constitutive expression of hrp and other genes (39, 53). Members of the genome-wide hrpG regulon encode proteins with homology to transcriptional regulators, degradative enzymes, an adhesin, and type III effectors from other plant pathogens (39). So far, the products of three new hrpG-regulated genes have been shown to be secreted by the TTS system and have therefore been designated Xanthomonas outer protein (Xop) A, XopB, and XopD (39, 40).

In this study, we performed a detailed analysis of two hrpG-regulated genes, xopC and xopJ, which were previously identified by cDNA-AFLP (39). We confirm that the expression of both genes is regulated by HrpG and HrpX. Furthermore, we demonstrate that XopC and XopJ are two new effector proteins that are secreted and translocated by the TTS system into the plant cell. XopJ is homologous to members of the AvrRxv/YopJ family of type III effectors. In contrast, XopC appears to be unique to X. campestris pv. vesicatoria. DNA sequence analysis of the xopC region revealed that this locus is a PAI which is homologous to DNA regions in X. axonopodis pv. citri.

MATERIALS AND METHODS

Bacterial strains, growth conditions, and plasmids.

The published bacterial strains and plasmids used in this study are described in Table 1. Escherichia coli cells were cultivated at 37°C in Luria-Bertani medium, and X. campestris pv. vesicatoria strains were cultivated at 30°C in NYG (16) or in minimal medium A (1) supplemented with sucrose (10 mM) and Casamino Acids (0.3%). Plasmids were introduced into E. coli by electroporation and into X. campestris pv. vesicatoria by conjugation by using pRK2013 as a helper plasmid in triparental matings (20, 23). The following antibiotics were added to the media at the indicated final concentrations: ampicillin, 100 μg/ml; chloramphenicol, 30 μg/ml; kanamycin, 25 μg/ml; rifampin, 100 μg/ml; spectinomycin, 100 μg/ml; streptomycin, 25 μg/ml; and tetracycline, 10 μg/ml.

TABLE 1.

Published strains and plasmids used in this study

Strain or plasmid Relevant characteristic(s)a Reference or source
X. campestris pv. vesicatoria
    75-3 Tomato race 1; wild type; Rifr 35
    85-10 Pepper race 2; wild type; Rifr 12
    82-8 Pepper race 1; wild type; Rifr 35
    85-10ΔhrpA-C 85-10 derivative; carries a deletion of operons hrpA to hrpC; Rifr D. Nennstiel and U. Bonas, unpublished data
    85* 85-10 derivative containing the hrpG* mutation; constitutive hrp gene expression; Rifr 53
    85*ΔhrpX 85* derivative; carries a hrpX deletion; Rifr 39
    85*ΔhrcV 85* derivative; carries a nonpolar hrcV deletion; nonfunctional TTS system; Rifr 46
    85*ΔhrpF 85* derivative; carries a nonpolar hrpF deletion; translocation mutant; Rifr 10
Escherichia coli
    DH10B F−mcrA Δ(mrr-hsdRMS-mcrBC) φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR D(ara, leu)7697 araΔ139 Δ(ara, leu)7697 galU galKλ−nupG rpsL; Strr Invitrogen, Carlsbad, Calif.
    DH5α F− φ80dlacZΔM15 Δ(lacZYA-argF) U169 endA1 recA1 deoR hdsR17(rk− mk+) phoA supE44 λ−thi-1 gyrA96 relA1; Nalr Invitrogen
    DH5α λpir DH5α derivative for replication of pIC1, pRO1, and pOK derivatives 34
    DB3.1 F−gyrA462 endA1 Δ(sr1-recA) mcrB mrr hsdS20(rB− mB−) supE44 ara-14 galK2 lacY1 proA2 rpsL20(Smr) xyl-5 λ−leu mtl-1; for replication of GATEWAY cassette-containing vectors (pAG35P/pL6GW356); Smr Invitrogen
Plasmids
    pLAFR6 RK2 replicon, Mob+ Tra−; multicloning site flanked by transcription terminators; Tcr 6
    pXV845, pXV238, pXV789 pLAFR3 derivatives; cosmid clones containing xopC from X. campestris pv. vesicatoria strain 75-3 35
    pDSK602 Contains triple lacUV5 promoter; Smr 37
    pDhrpFN356 pDSK602 derivative; expresses the fusion between HrpF (aa 1-387) and AvrBs3Δ2 10
    pCR2.1 Apr, Kmr Invitrogen
    pBluescript II KS or SK Phagemid, pUC derivative; Apr Stratagene, La Jolla, Calif.
    pBX1 pBluescript II KS; carries a 9.4-kb insert containing hrpX 52
    pBΔX1 pBX1 derivative; carries a 2.4-kb insert with a 7-kb deletion including hrpX 52
    pRK2013 Helper plasmid; ColE1 replicon TraRK+ Mob+; Kmr 23
    pRO1 Suicide vector; Smr 53
    pRX1 pRO1 derivative; carries a 2.4-kb insert from pBΔX1 with a 7-kb deletion including hrpX 39
    pOK Suicide vector; pKNG1O1 derivative; Smr, Sucs 28
    pOG pOK derivative; carries wild-type hrpG 39
    pIC1 Suicide vector; carries a triple c-myc epitope followed by a promoterless uidA gene; Tcr 39
a

Ap, ampicillin; Cm, chloramphenicol; Km, kanamycin; Nal, nalidixic acid; Rif, rifampin; Sm, spectinomycin; Str, streptomycin; Suc, sucrose; Tc, tetracycline; r, resistant; s, sensitive.

Plant material and plant inoculations.

Inoculation of the near-isogenic pepper cultivars Early Cal Wonder (ECW), ECW-10R, which carries the Bs1 resistance gene, and ECW-30R, which carries the Bs3 resistance gene, were performed as described previously (5). Bacteria were grown overnight on NYG agar and resuspended in 1 mM MgCl2. For the analysis of X. campestris pv. vesicatoria mutant strains, bacterial suspensions at a density of 108 CFU/ml were infiltrated into leaves by using a needleless syringe. The appearances of the HR and disease symptoms were monitored 2 and 3 days postinoculation, respectively. For translocation assays, bacteria were infiltrated into leaves at a bacterial density of 5 × 108 CFU/ml. Leaves were harvested and bleached in ethanol 2 days postinoculation to facilitate visualization of the HR. In planta growth of X. campestris pv. vesicatoria was determined in ECW as described previously (5) by using 104 CFU/ml. Experiments were reproduced at least three times.

Sequencing of the xopC region.

For sequencing of the xopC region, cosmid clones hybridizing to hgi 37/41 were isolated from a genomic cosmid library of X. campestris pv. vesicatoria strain 75-3 in pLAFR3 (pXV238, pXV789, and pXV845 [35]). EcoRI/HindIII fragments derived from pXV845, pXV238, and pXV789 and containing hgi 37 and hgi 41 were subcloned into pBluescript II KS (pB-KS), giving pB37A (8-kb insert), pB37B (7-kb insert), and pB37C (4-kb insert), respectively. The sequence of the xopC region was determined by shotgun cloning of pB37A, pB37B, and pB37C and sequencing of the subclones by using an ABI 377 Prism DNA sequencer (Applied Biosystems Inc., Foster City, Calif.). The initial contig was extended in both directions by primer walking, using pXV238 as the template. Sequences were analyzed with Sequencher software (Gene Codes Corp., Ann Arbor, Mich.) and the DNASTAR package (DNASTAR Inc., Madison, Wis.). The inverted repeats (IRs) in the xopC region were searched using Megalign, Genequest (DNASTAR Inc.), and Blast algorithms (http://www.ncbi.nlm.nih.gov/blast/).

Generation of mutations in xopC and xopJ.

A 1.0-kb deletion encompassing the promoter region and 540 bp of the xopC open reading frame (ORF) was achieved by Eco72I digestion and religation of pB37B, giving pB37BΔxopC. The pB37BΔxopC 3.1-kb NheI/XbaI fragment was cloned into the suicide plasmid pOK (28), giving pO37, and introduced into strain 85-10 by double crossover, creating 85-10ΔxopC.

To mutate xopJ, a 1.4-kb SalI/BglII fragment containing xopJ was amplified from X. campestris pv. vesicatoria strain 85-10 genomic DNA by PCR using the primers 11.Bgl (GAAGATCTTGACTGGCGATCAGAGATAGC) and 11.Sal (ACGCGTCGACTCCAAGACTTCGCACCGAAG) (underlined sequences indicate engineered restriction sites) and cloned into pCR2.1 (Invitrogen, Carlsbad, Calif.), giving pC11. A frameshift mutation was introduced at codon 128 by Bsp1407I digestion of pC11, fill-in, and religation, resulting in pCxopJFS. This mutation results in a premature stop codon after 143 codons. The pCxopJFS 1.4-kb SalI/BglII fragment was then cloned into pOK, giving pO11, and introduced into strain 85-10 by double crossover, giving 85-10xopJFS.

Epitope tagging of XopC and XopJ.

The 1.4-kb SalI/BglII fragment of pIC11 encompassing xopJ and a 1.6-kb XhoI/BglII fragment encompassing the first 466 codons of xopC amplified by PCR from X. campestris pv. vesicatoria strain 85-10 genomic DNA using the primers 37.Bgl (GAAGATCTCCTTCGAGAACTTTCGCAATC) and 37.Xho (CCGCTCGAGCTCTTAAGTGTGCGTCTACTG) (underlined sequences indicate engineered restriction sites) were cloned into pIC1 (39) in frame with a triple c-myc epitope, giving pIC11 and pIC37, respectively. pIC37 and pIC11 were conjugated into strain 85*, giving 85*::pIC37 and 85*::pIC11, respectively. The corresponding 85-10 derivatives were generated by restoring the wild-type hrpG allele using pOG (39). hrpX was deleted from strains 85*::pIC37 and 85*::pIC11 by using pRX1, thus giving 85*ΔhrpX::pIC37 and 85*ΔhrpX::pIC11, respectively.

Construction of AvrBs3Δ2 fusion proteins.

To create fusions with avrBs3Δ2, the GATEWAY (Invitrogen) attR reading frame cassette B fused in frame with avrBs3Δ2 was introduced into pLAFR6, giving pL6GW356. The following promoters and 5′ sequences of xop genes were amplified from genomic DNA of X. campestris pv. vesicatoria strain 75-3 by primers containing attB sites: the first 200 codons of xopC and 592-bp upstream sequence, the first 121 codons of hpaJ and 1,506-bp upstream sequence, and the first 155 codons of xopJ and 720-bp upstream region. Genomic DNA of strain 82-8 was used to amplify the first 200 codons of avrBs3 and 315-bp upstream sequence. Primer sequences are available from the authors upon request. The attB-flanked PCR products were recombined into a donor vector and then transferred to pL6GW356 by recombination to create the expression clones pL6xopC356, pL6hpaJ356, pL6xopJ356, and pL6avrBs3356.

RNA analyses.

RNA extraction, cDNA synthesis, and reverse transcription (RT)-PCRs were performed as described previously (39). Primer sequences are available from the authors upon request. General molecular biology experiments were performed according to standard protocols (1).

GUS assays.

β-Glucuronidase (GUS) assays were performed with exponentially growing X. campestris pv. vesicatoria as described previously (46). One GUS unit is defined as 1 nmol of 4-methylumbelliferone released per minute per bacterium.

Protein analysis and secretion experiments.

Secretion experiments and Western blot analyses were performed as described previously (46). The following primary antibodies were used: polyclonal anti-AvrBs3 antibody (31), monoclonal anti-c-myc antibody (Roche, Mannheim, Germany), and polyclonal anti-HrcN antiserum (46). Horseradish peroxidase-labeled goat anti-mouse or goat anti-rabbit antibodies were used as secondary antibodies. Reactions were visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech, Piscataway, N.J.).

Nucleotide sequence accession number.

The sequence of the 12.5-kb xopC region from X. campestris pv. vesicatoria strain 75-3 has been submitted to GenBank and assigned accession number AY389509.

RESULTS

xopJ and xopC are not conserved in xanthomonads.

The function of most hrpG-induced (hgi) genes known so far remains to be elucidated. In this study, we characterized xopJ and hgi 37/41 (hereafter designated xopC; see below), which were identified by cDNA-AFLP-based transcriptome analysis (39). Both genes have a significantly lower G+C content (54 and 47%, respectively) than the genomic average of 64%, indicating that they have been acquired by horizontal gene transfer. xopJ encodes a predicted protein with homology to members of the YopJ/AvrRxv family of effector proteins (39), which presumably function as cysteine proteases (41). In contrast, the predicted protein encoded by xopC does not share any homology to known proteins in the databases (Table 2). Since the original cDNA-AFLP amplicon corresponding to xopC did not span the whole gene, we analyzed the sequence of the complete ORF by sequencing of cosmid clones, which were isolated from a genomic library of X. campestris pv. vesicatoria strain 75-3 (see Materials and Methods for details). The xopC ORF is 2,505 bp long and lacks any PIP box motif in the predicted promoter region.

TABLE 2.

Characteristics of predicted genes in the xopC region from X. campestris pv. vesicatoria

Gene Characteristic(s) Closest protein homologue(s) (organism; accession no.)a Amino acid identity/similarity (%)b
ORFA (hpaJ) 425 aa; putative Sec signal; hrpG/hrpX-dependent Transglycosylase (X. axonopodis pv. citri; AAM38069, AAM39253) 98/99
    expression HopPmaG (P. syringae pv. maculicola; AAL84245) 57/70
ORFB 996 aa Tn5044 transposase (X. axonopodis pv. citri; AAM39254) 99/99
ORFC 424 aa Integrase-like protein (X. axonopodis pv. citri; AAM39255) 91/93
ORFD 351 aa Cointegrate resolution protein T (X. axonopodis pv. citri; AAM39256) 95/97
ORFE 320 aa; flanked by 24-bp IRs; belongs to ISXc7-2 Putative transposase (X. campestris pv. mangiferaeindicae; AAF65225) 99/99
xopC 47% G+C; hrpG/hrpX-dependent expression; 834 aa; encodes an effector protein Hypothetical protein (R. solanacearum; CAD18390) 46/64c
ORFF 219 aa; encodes a putative truncated transposase IS1478 transposase (X. campestris pv. campestris; AAM40932) 84/87d
a

Closest homologous protein found by using the BlastX algorithm (http://www.ncbi.nlm.nih.gov/blast/) in nonredundant databases.

b

Identities and similarities between the respective proteins were determined using the Blast2 Sequences algorithm (51).

c

Comparison between the last 360 aa of XopC and the first 360 aa of the 894-aa predicted protein CAD18390 of R. solanacearum.

d

Comparison over the first 164 aa of ORFF.

Southern blot analyses revealed that the sequences corresponding to xopJ and xopC are conserved in X. campestris pv. vesicatoria strains 75-3, 85-10, 82-8, and 81-23 (data not shown). However, DNA-DNA blast searches did not reveal homologous genes in X. axonopodis pv. citri strain 306 and X. campestris pv. campestris strain ATCC 33913, suggesting that both xopJ and xopC are unique to X. campestris pv. vesicatoria.

To confirm hrpG-dependent regulation of xopC, we performed RT-PCRs. After bacterial growth in NYG medium, the xopC transcript was detectable in strain 85* but not, or in small amounts, in strain 85-10 and the hrpX deletion mutant 85*ΔhrpX (Fig. 1A). This indicates that expression of xopC is controlled by both HrpG and HrpX, as has previously been shown for xopJ (39). For a quantitative analysis of the induction levels of both genes, we created transcriptional fusions to a promoterless GUS gene and introduced the corresponding constructs into the genomes of strains 85-10, 85*, and 85*ΔhrpX (see Materials and Methods). The analysis of GUS activities after bacterial growth in NYG medium showed that xopC and xopJ expression in 85* was 10 and 42 times higher, respectively, than in the hrpG wild-type background (Fig. 1B). Deletion of the hrpX gene (strains 85*ΔhrpX::pIC37 and 85*ΔhrpX::pIC11) reduced GUS activities to the levels observed in 85-10 (Fig. 1B), confirming that gene expression is controlled by both hrpG and hrpX.

FIG. 1.

FIG. 1.

Expression of xopC, xopJ, and hpaJ (ORFA) is regulated by hrpG and hrpX. (A) cDNA-AFLP (AFLP) and RT-PCR (RT) analyses of hgi 37/41 (corresponds to xopC) and hpaJ (ORFA) in X. campestris pv. vesicatoria strains 85-10, 85*, and 85*ΔhrpX, all grown in NYG medium. cDNA-AFLP amplicons were visualized by autoradiography. RT-PCR samples were separated on a 1.5% agarose gel and stained with ethidium bromide. 16S ribosomal DNA was used as a standard (rDNA). (B) Analysis of promoter activities of xopC and xopJ using the uidA reporter gene. Strains 85-10, 85*, and 85*ΔhrpX containing pIC37 and pIC11, respectively, were grown in NYG medium. Specific GUS activities are the average of two cultures with duplicates. Values are displayed using a logarithmic scale, and error bars represent the standard deviations. GUS activities below 0.1 U/1010 CFU are considered as background. One unit is defined as 1 nmol of 4-methylumbelliferone released per minute per bacterium.

xopJ and xopC encode type III-secreted proteins.

For the analysis of the predicted proteins encoded by xopJ and xopC, both genes were translationally fused to a c-myc epitope-encoding sequence in the genome of strain 85* and the TTS mutant 85*ΔhrcV by using the suicide vector pIC1. As shown in Fig. 2, proteins of 56 and 45 kDa, compatible with the predicted sizes of the XopC protein fused to c-myc (51 kDa plus 5-kDa epitope; first 466 amino acids [aa] only) and XopJ-c-myc (40 kDa plus 5-kDa epitope), respectively, were detected in total cell extracts. The homology of XopJ to type III effectors as well as the finding that several hgi genes encode type III-secreted proteins (39, 40) prompted us to investigate the secretion of XopJ and XopC. Therefore, the corresponding 85* and 85*ΔhrcV derivatives were incubated in secretion medium and total cell extracts and culture supernatants were analyzed by immunoblotting. Both proteins could be detected in the culture supernatants of the corresponding 85* strain derivative but not in culture supernatants of 85*ΔhrcV strains (Fig. 2), indicating that secretion depends on a functional TTS system. HrcN, an intracellular protein, was not detectable in the culture supernatants, suggesting that no bacterial lysis had occurred. These data indicate that xopJ and xopC encode type III-secreted proteins.

FIG. 2.

FIG. 2.

XopC and XopJ are secreted by the TTS system. Strains 85* and 85*ΔhrcV containing pIC37 (A) and pIC11 (B), respectively, were incubated in secretion medium. Total protein extracts (10× concentrated) and supernatants (200× concentrated) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (10% polyacrylamide) and analyzed by immunoblotting using the c-myc antibody. Membranes were reprobed with a specific antibody against the cytoplasmic protein HrcN to ensure that no bacterial lysis had occurred. Molecular mass of proteins is given in kilodaltons.

The N termini of XopJ and XopC contain type III translocation signals.

To investigate whether XopJ and XopC are not only secreted but also translocated into the plant cell, we constructed fusion proteins by using an N-terminal deletion derivative of the X. campestris pv. vesicatoria effector protein AvrBs3 as a reporter in an HR induction assay. AvrBs3 induces the HR in ECW-30R pepper plants, which express the resistance gene Bs3 (35). The N-terminal deletion derivative AvrBs3Δ2, which lacks aa 2 to 153, is no longer delivered by the TTS system. However, it is still capable of inducing the HR when expressed in resistant plant cells by using Agrobacterium-mediated gene transfer and hence contains the effector domain (50). The fusion of a functional TTS and translocation signal to AvrBs3Δ2 should therefore restore its delivery by the TTS system and thus the ability to induce the HR in resistant plants.

Here, the N termini of XopJ and XopC were fused to AvrBs3Δ2 (Fig. 3A). In addition, as a positive control, the first 200 aa of AvrBs3 were fused to AvrBs3Δ2 (AvrBs3200-AvrBs3Δ2). As a negative control, we used the HrpF387-AvrBs3Δ2 fusion protein, which was previously shown to be secreted by the TTS system but does not induce the HR when delivered by X. campestris pv. vesicatoria into Bs3-expressing pepper plants. Since the fusion protein still induces the HR when directly expressed in resistant plants by use of Agrobacterium-mediated gene transfer, it has been suggested that the N terminus of HrpF lacks a functional translocation signal (10). The AvrBs3Δ2 fusion constructs were introduced into X. campestris pv. vesicatoria strains 85*, 85*ΔhrcV, and 85*ΔhrpF. Western blot analysis of total protein extracts demonstrated that the XopJ155-, XopC200-, and AvrBs3200-AvrBs3Δ2 fusion proteins were expressed (Fig. 3B). After incubation of the bacteria in secretion medium, XopJ155-AvrBs3Δ2 and XopC200-AvrBs3Δ2 were detected in the culture supernatants of the 85* and 85*ΔhrpF strain derivatives, but not in those of the corresponding 85*ΔhrcV strain derivatives (Fig. 3B). These results show that the TTS signals of XopJ and XopC are located in the N-terminal regions.

FIG. 3.

FIG. 3.

XopC and XopJ N termini target AvrBs3Δ2 into the plant cell. (A) Schematic representation of AvrBs3Δ2 fusion proteins. The N termini of AvrBs3, HrpF, XopC, HpaJ, and XopJ were fused to AvrBs3Δ2 and tested for secretion in vitro and the induction of the HR in Bs3-expressing pepper plants. The central repeat region of AvrBs3 is indicated by the striped box. White boxes correspond to the N-terminal part of the tested fusion partner. Numbers refer to amino acid positions at the fusion points. A plus sign indicates the ability of fusion protein to be secreted and/or to induce the HR on ECW-30R plants when delivered by X. campestris pv. vesicatoria strain 85*. A minus sign indicates no secretion of fusion proteins and/or no HR induction. (B) Western blot analysis of AvrBs3Δ2 fusions expressed in strain 85*, the secretion mutant 85*ΔhrcV, and 85*ΔhrpF under control of the native promoters. After incubation of the bacteria in secretion medium, total protein extracts (10× concentrated) and supernatants (200× concentrated) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (8% polyacrylamide) and analyzed by immunoblotting using the AvrBs3-specific antibody. Membranes were reprobed with a specific antibody against the cytoplasmic protein HrcN to ensure that no bacterial lysis had occurred (data not shown). (C) HR induction in the resistant pepper plant ECW-30R. X. campestris pv. vesicatoria strains were inoculated at 5 × 108 CFU/ml. Two days after inoculation, the leaves were bleached in ethanol.

To test for type III-dependent translocation, strain 85* carrying the different fusion constructs was inoculated into leaves of different pepper plants. As shown in Fig. 3C, strain 85* delivering AvrBs3200-AvrBs3Δ2, XopJ155-AvrBs3Δ2, and XopC200-AvrBs3Δ2 induced the HR in the Bs3-expressing pepper cultivar ECW-30R but not in susceptible ECW plants (data not shown). This indicates that the reporter protein was translocated into the plant cell and was specifically recognized by Bs3. No HR induction was observed in leaves of ECW and ECW-30R plants infected with strain 85* delivering HrpF387-AvrBs3Δ2 (data not shown). Furthermore, the secretion mutant 85*ΔhrcV and the translocation mutant 85*ΔhrpF expressing the chimeric proteins did not elicit the HR in ECW-30R plants (Fig. 3C), indicating that translocation of the reporter protein into the plant cell depends on a functional TTS system. These experiments demonstrate that the N termini of XopC and XopJ contain signals for type III-dependent secretion and translocation and validate the AvrBs3Δ2 protein as a suitable reporter for the analysis of type III effector protein translocation.

Contribution of XopJ and XopC to bacterial virulence.

The type III-dependent translocation of XopJ and XopC into the plant cell suggests that both proteins play a role in the plant-pathogen interaction. To study their contribution to bacterial virulence, a frameshift mutation in xopJ and a deletion in xopC, respectively, were introduced into the genome of X. campestris pv. vesicatoria strain 85-10. The resulting mutants were tested for symptom formation and in planta growth in susceptible pepper plants (ECW) as well as for HR elicitation in resistant pepper plants (ECW-10R). Strain 85-10 expresses avrBs1, which is recognized by the Bs1 resistance gene in ECW-10R (35). The mutations in xopJ and xopC had no visible effect on the phenotype and timing of the appearance of disease symptoms in susceptible plants and the HR induction in resistant plants compared to what was seen with the wild-type strain 85-10 (data not shown). Furthermore, the growth of both mutant strains in susceptible pepper plants ECW was not significantly altered (Fig. 4). Thus, we could not observe any obvious contribution of XopJ and XopC to X. campestris pv. vesicatoria virulence under the conditions tested.

FIG. 4.

FIG. 4.

Analysis of xopJ and xopC mutants for growth in planta. X. campestris pv. vesicatoria wild-type and mutant strains were inoculated at 104 CFU/ml in 1 mM MgCl2 into the intercellular spaces of fully expanded leaves of susceptible ECW plants. Growth of strains 85-10, 85-10ΔhrpA-C, 85-10ΔxopC, and 85-10xopJFS was monitored over a period of 8 days. Values represent the mean of three samples from three different plants, and error bars indicate the standard deviations. For the sake of clarity, error bars for strains 85-10ΔxopC and 85-10xopJFS were omitted. Results shown are from one representative experiment.

Sequence analysis of genes in the xopC region.

The unusually low G+C content of xopC (47% G+C) suggests that this gene is located in a PAI. Since PAIs often contain clusters of virulence genes, we sequenced a 12.5-kb region encompassing xopC from X. campestris pv. vesicatoria strain 75-3 (see Materials and Methods for details). Besides xopC, this region contains six ORFs, designated ORFA to ORFF (Fig. 5A), with an overall G+C content of 59%. Homology searches revealed that the predicted ORFA (hpaJ) product shares similarity with transglycosylases and contains a putative Sec signal (Table 2). Furthermore, it is similar to HopPmaG, a type III effector candidate from P. syringae (Table 2) (26). The predicted gene products of ORFB to ORFF from X. campestris pv. vesicatoria share homology with proteins that are often associated with genetic mobile elements (Table 2). ORFE is flanked by 24-bp IRs and encodes a predicted protein which shares 99% aa identity to the ISXc7 transposase encoded in the hrp PAI from X. campestris pv. vesicatoria (40). Therefore, the IR-flanked region including ORFE was designated ISXc7-2. Interestingly, DNA-DNA homology searches revealed that sequences homologous to the region from ORFA to ORFD from X. campestris pv. vesicatoria are present in the chromosome and on the plasmid pXAC64 of X. axonopodis pv. citri strain 306. Both regions are associated with putative type III effector genes (Fig. 5B).

FIG. 5.

FIG. 5.

Comparison between the xopC region from X. campestris pv. vesicatoria strain 75-3 and corresponding regions from X. axonopodis pv. citri strain 306. (A) Schematic overview of the X. campestris pv. vesicatoria xopC region. The locations of hgi 37 and hgi 41 (xopC) are indicated by grey circles. The insertion site of the c-myc coding sequence in pIC37 is indicated by a thin arrow. White single-headed arrows represent ORFs with high coding probability (DNAStar package) and the direction of transcription (Table 2). Black arrows indicate putative effector genes. The double-headed arrow represents an IS element. Open triangles indicate 62-bp IRs. The G+C content of the region was calculated over 100-bp windows (59% on average) and displayed using Genequest (DNAStar). Scale is given in kilobases. (B) Schematic overview of the regions from X. axonopodis pv. citri strain 306 (Xac) corresponding to the hpaJ to ORFD sequences. The sequences are derived from plasmid pXAC64 (GenBank accession no AE008925; 3,594 to 18,000 bp) and the chromosomal section 346 (chrom.; GenBank accession no. AE011968; 1 to 10,000 bp). Open circles denote PIP boxes. The grey area represents colinear DNA regions (more than 85% identity on the DNA level).

Identification of a new hrpG-regulated gene in the xopC region.

To study the expression of predicted genes in the xopC region from X. campestris pv. vesicatoria, we performed RT-PCRs using RNA isolated from strains 85-10, 85*, and 85*ΔhrpX after growth in NYG medium. ORFB, ORFC, and ORFD transcripts were amplified at comparable levels in the three different strains, indicating that gene expression was constitutive (data not shown). By contrast, no transcript could be amplified for ORFE under the RT-PCR conditions used (data not shown). The ORFA (hpaJ) transcript was detected only in strain 85*, demonstrating that expression of the corresponding gene is regulated by HrpG and HrpX (Fig. 1A). ORFA was therefore designated hpaJ.

The homology of HpaJ to the type III effector candidate HopPmaG from P. syringae pv. maculicola (Table 2) prompted us to investigate TTS and translocation of HpaJ. Therefore, the N terminus of HpaJ was fused to AvrBs3Δ2 (Fig. 3A) and the corresponding fusion protein was expressed in strains 85*, 85*ΔhrcV, and 85*ΔhrpF. HpaJ121-AvrBs3Δ2 was expressed in all strains but could not be detected in the culture supernatant of strain 85* (Fig. 3B). Since HrpF, a substrate of the TTS system, was detected in the supernatant (data not shown), we conclude that lack of detection of HpaJ121-AvrBs3Δ2 in the culture supernatant was not due to a general defect in TTS. When infiltrated into pepper plants that express the Bs3 gene, strain 85* carrying HpaJ121-AvrBs3Δ2 did not induce the AvrBs3-specific HR (Fig. 3C). Taken together, these results suggest that the N terminus of HpaJ does not contain a functional TTS and translocation signal.

The xopC region is flanked by IRs that are associated with putative effectors in different xanthomonads.

Interestingly, the xopC region of X. campestris pv. vesicatoria is flanked by 62-bp IRs (Fig. 5) that were initially identified in the vicinity of effector genes belonging to the avrBs3 family in Xanthomonas spp. (IR-L and IR-R [4, 18]). In addition to the xopC region, we also found single copies of these IRs next to xopB and avrBsT (Table 3). Furthermore, homology searches revealed the presence of 13 copies (eight flanking avrBs3 homologues and five in the region corresponding to the xopC locus from X. campestris pv. vesicatoria) in the genome of X. axonopodis pv. citri strain 306 (Fig. 5) (Table 3). In the genome of X. campestris pv. campestris strain ATCC 33913, we identified five IRs, four of which are present as single copies next to genes encoding putative type III-secreted proteins: AvrXccE1 (homologous to AvrPphE from P. syringae pv. phaseolicola), AvrBs1, AvrXccB (homologous to effectors of the YopJ/AvrRxv family), and AvrXccC (homologous to AvrC from P. syringae pv. glycinea). Using sequence alignments and informative polymorphic sites analysis, one can distinguish between IR-L- and IR-R-like repeats (Table 3). While most of the avrBs3 homologues are flanked by both IR-L (5′) and IR-R (3′) sequences, the majority of other putative type III effector genes is flanked by a single IR-L repeat in the 3′ region of the coding sequence. Blast searches did not reveal homologous IRs in other plant pathogens, suggesting that these sequences are restricted to xanthomonads.

TABLE 3.

Specific IRs associated with genes coding for Xops

Organism and gene Relative position of IR to gene or ORFa Type of IR IR sequenceb
X. campestris pv. vesicatoria
    avrBs3* 5′ IR-L GAGGGTCGGCAGGGATTCGTGTAAAAAACAGCCAAAAGTGAGCTAACTCGCTGTCAGCACAG
    avrBs3* 3′ IR-R -----GA----------T----------------------G----------------T-A--
    avrBs4* 5′ IR-L -----------------G--------------------------------------------
    avrBs4* 3′ IR-R -----GA----------T----------------------G----------------T-A--
    hpaJ 3′ IR-L --------A--------T-------------------T--------A--T----T--A-A--
    xopC 5′ IR-L --------------------------g-----------------------------T--A--
    xopB 3′ IR-L -----------------.-------c-----------------------T-------AGAGa
    avrBsT 3′ IR-L -----C---------------c------a----------tG-a-----T-----T--T-A--
X. axonopodis pv. citri strain 306
    pthA1* 5′ IR-L --------------------------------------------------------------
    pthA1* 3′ IR-R -----GA----------T----------------------G----------------T-A--
    pthA2* 5′ IR-L --------------------------------------------------------------
    pthA3* 5′ IR-L --------------------------------------------------------------
    pthA3* 3′ IR-R -----GA----------T----------------------G----------------T-A--
    pthA4* 5′ IR-L --------------------------C----------------------C------A-TA--
    pthA4* 5′ IR-L -----------------G--------------------------------------------
    pthA4* 3′ IR-R -----GA----------T----------------------G----------------T-A--
    mlt 3′ IR-L --------A--------T-------------------T--------A--T----T--A-A--
    avrXacE3 3′ IR-L --------------------------C----------------------C--------TA--
    XACa0010 5′ IR-R -----GA----------T--------------------------------------------
    XACb0027 5′ IR-R -----GA----------T--------------------------------------------
    XAC3230 3′ IR-L --a--C--------------T--------------------------------------A--
X. campestris pv. campestris strain ATCC 33913
    avrXccB 3′ IR-L A---T------a--------------------A--------------------------A--
    avrXccC 3′ IR-L -------------------------------tA-------G-------T-----T---CA--
    avrBs1 3′ IR-L ---------a----------T---------------------------G---c------A--
    XCC1633 3′ IR-L A---g-----------------------------------------tcGCTgttggTAGtG-
    XCC2094 5′ IR-L ---aT-A-------------a----------------------------a-c----AT-A--
a

The IRs were identified by Blast search in nonredundant databases (http://www.ncbi.nlm.nih.gov/blast/). The nearest gene or ORF and the relative position of the IR (5′ or 3′) are indicated. Asterisks indicate avrBs3 homologues.

b

Bases differing from the avrBs3 IR-L repeat are displayed. Capital letters indicate informative polymorphic bases, i.e., polymorphisms which are found in at least two sequences. The dots indicate an inserted gap.

DISCUSSION

In this study, we identified XopJ and XopC, two novel type III effectors from X. campestris pv. vesicatoria. The corresponding genes were initially uncovered by transcriptome analysis due to their coregulation with the TTS system. Here, we confirmed that expression of xopJ and xopC is regulated by HrpG and HrpX and demonstrated that the corresponding gene products are secreted by the TTS system. In addition, we provide evidence for the type III-dependent translocation of XopJ and XopC by using a truncated version of the AvrBs3 effector protein as a reporter. AvrBs3 was recently detected in nuclei of infected plant cells by immunocytochemistry, thus providing direct evidence for effector protein translocation (50). So far, translocation of effectors from plant pathogenic bacteria has been demonstrated by the use of reporter proteins such as adenylate cyclase and an N-terminal deletion derivative of the effector protein AvrRpt2 from P. syringae (13, 25, 36). One limitation of the latter reporters is that localization of protein fusions to the plasma membrane without full translocation into the cytoplasm is sufficient for reporter activity. By contrast, AvrBs3 as a reporter requires nuclear localization for activity (50).

The signals that target XopJ and XopC for type III-dependent secretion and translocation reside in the N-terminal protein regions as has already been described for several effector proteins from plant and animal pathogenic bacteria (15). However, the nature of the secretion signal still remains enigmatic since type III-secreted proteins in both plant and animal pathogens do not share any N-terminal consensus sequence. Recently, comparative analyses of N-terminal amino acid compositions of P. syringae type III-secreted proteins revealed some similarities, such as a relatively high content of serine residues in the first 50 aa (26, 43). This is also true for the N-terminal regions of the Xanthomonas effectors XopC (16% serine) and XopJ (12% serine).

The functions of XopJ and XopC inside the plant cell remain to be investigated. Both genes appear to be restricted to X. campestris pv. vesicatoria strains, suggesting a specific role for xopJ and xopC in the interaction of X. campestris pv. vesicatoria with its respective host plants. Preliminary dipping experiments seem to confirm this for xopC (D. Büttner and U. Bonas, unpublished data). However, xopC and xopJ mutant strains were not affected in bacterial growth and symptom formation on susceptible plants after infiltration, indicating subtle contributions to bacterial virulence or functional redundancy. The latter might indeed be the case for XopJ, which belongs to the large YopJ/AvrRxv effector protein family (for a review, see reference 33), four members of which have been identified in X. campestris pv. vesicatoria (8). YopJ from Yersinia pestis presumably acts as a cysteine protease (42), and the putative catalytic residues are conserved in all homologues including XopJ. So far, a potential plant target of the predicted proteolytic activity has been identified only for PopP2 from R. solanacearum, which physically interacts with the corresponding resistance protein RRS1-R from Arabidopsis thaliana (19).

For XopC, we found no homology to proteins with known function in the database. Due to the low G+C content of xopC as well as the absence of homologous genes in other xanthomonads, xopC might have been acquired by horizontal gene transfer. Indeed, the xopC region contains typical features of PAIs, including sequences with low G+C content, an IS element, and genes encoding integrases and cointegrases. In addition to xopC, we identified hpaJ as a new hrpG-regulated gene in this region. Mutant studies will help to clarify whether HpaJ plays a role during the interaction with the plant, as is suggested by its coregulation with the TTS system. The presence of a Sec signal as well as the homology of HpaJ to transglycosylases suggests that it is secreted by the Sec system into the periplasm. Here, it might contribute to the remodeling of the peptidoglycan layer, a process that is presumably involved in the assembly of the TTS system (44). A similar scenario has been proposed for the flagellar assembly in Salmonella enterica, which requires periplasmic peptidoglycan-degrading enzymes (38). Furthermore, predicted peptidoglycan hydrolases in P. syringae and X. campestris pv. vesicatoria contribute to bacterial virulence (2, 40).

We did not observe secretion and translocation of HpaJ by the TTS system, which is consistent with its predicted function in the periplasm. However, the HpaJ homologue HopPmaG from P. syringae pv. maculicola, which also contains a Sec signal (predicted by the SignalP program [http://www.cbs.dtu.dk/services/SignalP/]), was recently shown to be translocated into the plant cell by use of the AvrRpt280-255 reporter (26). Since only 14 aa of HopPmaG were fused to the reporter, which is usually not sufficient to target a protein for type III-dependent translocation, it cannot be excluded that the delivery of the HopPmaG14-AvrRpt280-255 fusion into the plant was due to residual export signals in the AvrRpt280-255 reporter protein.

The region from hpaJ to ORFD in the xopC locus is more than 85% identical to sequences in the chromosome and the plasmid pXAC64 from X. axonopodis pv. citri (Fig. 5). It is intriguing that genes encoding effector protein candidates such as the AvrBs3 homologue PthA3 as well as AvrXacE2 and AvrXacE3, which are homologous to the effector protein AvrPphE from P. syringae pv. phaseolicola, are located next to these regions. Approximately 200 bp of the 5′ sequence including promoter and coding regions of avrXacE3 and XAC3230 from X. axonopodis pv. citri are more than 85% identical to the corresponding region of xopJ, which is a member of the hrpG regulon from X. campestris pv. vesicatoria. It is therefore tempting to speculate that avrXacE3 and XAC3230 are also regulated by HrpG. Taken together, the low G+C content, the association with genetic mobile elements, the presence of putative effector and/or virulence genes, and the sequence diversity of this locus among different xanthomonads indicate that the xopC region in X. campestris pv. vesicatoria as well as the corresponding sequences in X. axonopodis pv. citri are PAIs.

Interestingly, the xopC region is flanked by IRs, which are also present in the corresponding regions of X. axonopodis pv. citri. Sequence analysis revealed that these IRs are often located in the vicinity of effector genes and thus might provide a useful search criterion for the identification of effector candidates by genomic approaches. In X. campestris pv. vesicatoria, the full set of type III effectors is not known yet. In this study, the products of two hrpG-induced genes were shown to be translocated into the plant cell, indicating that the hrpG regulon is a precious resource for the identification of type III effectors. More than 25 hgi genes still await characterization. In the future, sequence analyses will be greatly facilitated by the availability of the genomic sequence of X. campestris pv. vesicatoria strain 85-10 (in progress [http://www.genetik.uni-Bielefeld.de/GenoMik/partner/halle.html]) (11). This will provide the unique opportunity to identify specific virulence genes and host range determinants by comparative sequence analysis of different members of the genus Xanthomonas.

Acknowledgments

L.N. and F.T. contributed equally to this work.

We thank C. Kretschmer and B. Rosinsky for excellent technical assistance.

This work was funded by a grant from the Deutsche Forschungsgemeinschaft (SFB 363) and the Bundesministerium für Bildung und Forschung to U.B.

REFERENCES

  • 1.Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1996. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
  • 2.Boch, J., V. Joardar, L. Gao, T. L. Robertson, M. Lim, and B. N. Kunkel. 2002. Identification of Pseudomonas syringae pv. tomato genes induced during infection of Arabidopsis thaliana. Mol. Microbiol. 44:73-88. [DOI] [PubMed] [Google Scholar]
  • 3.Bogdanove, A., S. V. Beer, U. Bonas, C. A. Boucher, A. Collmer, D. L. Coplin, G. R. Cornelis, H.-C. Huang, S. W. Hutcheson, N. J. Panopoulos, and F. Van Gijsegem. 1996. Unified nomenclature for broadly conserved hrp genes of phytopathogenic bacteria. Mol. Microbiol. 20:681-683. [DOI] [PubMed] [Google Scholar]
  • 4.Bonas, U., J. Conrads-Strauch, and I. Balbo. 1993. Resistance in tomato to Xanthomonas campestris pv. vesicatoria is determined by alleles of the pepper-specific avirulence gene avrBs3. Mol. Gen. Genet. 238:261-269. [DOI] [PubMed] [Google Scholar]
  • 5.Bonas, U., R. Schulte, S. Fenselau, G. V. Minsavage, B. J. Staskawicz, and R. E. Stall. 1991. Isolation of a gene-cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on pepper and tomato. Mol. Plant-Microbe Interact. 4:81-88. [Google Scholar]
  • 6.Bonas, U., R. E. Stall, and B. Staskawicz. 1989. Genetic and structural characterization of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria. Mol. Gen. Genet. 218:127-136. [DOI] [PubMed] [Google Scholar]
  • 7.Büttner, D., and U. Bonas. 2003. Common infection strategies of plant and animal pathogenic bacteria. Curr. Opin. Plant Biol. 6:312-319. [DOI] [PubMed] [Google Scholar]
  • 8.Büttner, D., and U. Bonas. 2002. Getting across—bacterial type III effector proteins on their way to the plant cell. EMBO J. 21:5313-5322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Büttner, D., and U. Bonas. 2002. Port of entry—the type III secretion translocon. Trends Microbiol. 10:186-192. [DOI] [PubMed] [Google Scholar]
  • 10.Büttner, D., D. Nennstiel, B. Klüsener, and U. Bonas. 2002. Functional analysis of HrpF, a putative type III translocon protein from Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 184:2389-2398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Büttner, D., L. Noël, F. Thieme, and U. Bonas. Genomic approaches in Xanthomonas campestris pv. vesicatoria allow fishing for virulence genes. J. Biotechnol., in press. [DOI] [PubMed]
  • 12.Canteros, B. J. 1990. Diversity of plasmids and plasmid-encoded phenotypic traits in Xanthomonas campestris pv. vesicatoria. Ph.D. thesis. University of Florida, Gainesville.
  • 13.Casper-Lindley, C., D. Dahlbeck, E. T. Clark, and B. Staskawicz. 2002. Direct biochemical evidence for type III secretion-dependent translocation of the AvrBs2 effector protein into plant cells. Proc. Natl. Acad. Sci. USA 99:8336-8341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Collmer, A., M. Lindeberg, T. Petnicki-Ocwieja, D. Schneider, and J. Alfano. 2002. Genomic mining type III secretion system effectors in Pseudomonas syringae yields new picks for all TTSS prospectors. Trends Microbiol. 10:462-469. [DOI] [PubMed] [Google Scholar]
  • 15.Cornelis, G. R., and F. Van Gijsegem. 2000. Assembly and function of type III secretory systems. Annu. Rev. Microbiol. 54:735-774. [DOI] [PubMed] [Google Scholar]
  • 16.Daniels, M. J., C. E. Barber, P. C. Turner, M. K. Sawczyc, R. J. W. Byrde, and A. H. Fielding. 1984. Cloning of genes involved in pathogenicity of Xanthomonas campestris pv. campestris using the broad host range cosmid pLAFR1. EMBO J. 3:3323-3328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Da Silva, A. C., J. A. Ferro, F. C. Reinach, C. S. Farah, L. R. Furlan, R. B. Quaggio, C. B. Monteiro-Vitorello, M. A. Sluys, N. F. Almeida, L. M. Alves, et al. 2002. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature 417:459-463. [DOI] [PubMed] [Google Scholar]
  • 18.De Feyter, R., Y. O. Yang, and D. W. Gabriel. 1993. Gene-for-genes interactions between cotton R-genes and Xanthomonas campestris pv. malvacearum avr genes. Mol. Plant-Microbe Interact. 6:225-237. [DOI] [PubMed] [Google Scholar]
  • 19.Deslandes, L., J. Olivier, N. Peeters, D. X. Feng, M. Khounlotham, C. Boucher, I. Somssich, S. Genin, and Y. Marco. 2003. Physical interaction between RRS1-R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proc. Natl. Acad. Sci. USA 100:8024-8029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ditta, G., S. Stanfield, D. Corbin, and D. Helinski. 1980. Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77:7347-7351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Fenselau, S., I. Balbo, and U. Bonas. 1992. Determinants of pathogenicity in Xanthomonas campestris pv. vesicatoria are related to proteins involved in secretion in bacterial pathogens of animals. Mol. Plant-Microbe Interact. 5:390-396. [DOI] [PubMed] [Google Scholar]
  • 22.Fenselau, S., and U. Bonas. 1995. Sequence and expression analysis of the hrpB pathogenicity operon of Xanthomonas campestris pv. vesicatoria which encodes eight proteins with similarity to components of the Hrp, Ysc, Spa, and Fli secretion systems. Mol. Plant-Microbe Interact. 8:845-854. [DOI] [PubMed] [Google Scholar]
  • 23.Figurski, D., and D. R. Helinski. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76:1648-1652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Galán, J. E., and A. Collmer. 1999. Type III secretion machines: bacterial devices for protein delivery into host cells. Science 284:1322-1328. [DOI] [PubMed] [Google Scholar]
  • 25.Guttman, D. S., and J. T. Greenberg. 2001. Functional analysis of the type III effectors AvrRpt2 and AvrRpm1 of Pseudomonas syringae with the use of a single-copy genomic integration system. Mol. Plant-Microbe Interact. 14:145-155. [DOI] [PubMed] [Google Scholar]
  • 26.Guttman, D. S., B. A. Vinatzer, S. F. Sarkar, M. V. Ranall, G. Kettler, and J. T. Greenberg. 2002. A functional screen for the type III (Hrp) secretome of the plant pathogen Pseudomonas syringae. Science 295:1722-1726. [DOI] [PubMed] [Google Scholar]
  • 27.Hacker, J., and J. B. Kaper. 2000. Pathogenicity islands and the evolution of microbes. Annu. Rev. Microbiol. 54:641-679. [DOI] [PubMed] [Google Scholar]
  • 28.Huguet, E., K. Hahn, K. Wengelnik, and U. Bonas. 1998. hpaA mutants of Xanthomonas campestris pv. vesicatoria are affected in pathogenicity but retain the ability to induce host-specific hypersensitive reaction. Mol. Microbiol. 29:1379-1390. [DOI] [PubMed] [Google Scholar]
  • 29.Juris, S. J., F. Shao, and J. E. Dixon. 2002. Yersinia effectors target mammalian signalling pathways. Cell. Microbiol. 4:201-211. [DOI] [PubMed] [Google Scholar]
  • 30.Klement, Z. 1982. Hypersensitivity, p. 149-177. In M. S. Mount and G. H. Lacy (ed.), Phytopathogenic prokaryotes, vol. 2. Academic Press, New York, N.Y.
  • 31.Knoop, V., B. Staskawicz, and U. Bonas. 1991. Expression of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria is not under the control of hrp genes and is independent of plant factors. J. Bacteriol. 173:7142-7150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Koebnik, R. 2001. The role of bacterial pili in protein and DNA translocation. Trends Microbiol. 9:586-590. [DOI] [PubMed] [Google Scholar]
  • 33.Lahaye, T., and U. Bonas. 2001. Molecular secrets of bacterial type III effector proteins. Trends Plant Sci. 6:479-485. [DOI] [PubMed] [Google Scholar]
  • 34.Meinhardt, L. W., H. B. Krishnan, P. A. Balatti, and S. G. Pueppke. 1993. Molecular cloning and characterization of a sym plasmid locus that regulates cultivar-specific nodulation of soybean by Rhizobium fredii USDA257. Mol. Microbiol. 9:17-29. [DOI] [PubMed] [Google Scholar]
  • 35.Minsavage, G. V., D. Dahlbeck, M. C. Whalen, B. Kearny, U. Bonas, B. J. Staskawicz, and R. E. Stall. 1990. Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv. vesicatoria-pepper interactions. Mol. Plant-Microbe Interact. 3:41-47. [Google Scholar]
  • 36.Mudgett, M. B., O. Chesnokova, D. Dahlbeck, E. T. Clark, U. Bonas, and B. J. Staskawicz. 2000. Molecular signals required for type III secretion and translocation of the Xanthomonas campestris AvrBs2 protein to pepper plants. Proc. Natl. Acad. Sci. USA 97:13324-13329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Murillo, J., H. Shen, D. Gerhold, A. Sharma, D. A. Cooksey, and N. T. Keen. 1994. Characterization of pPT23B, the plasmid involved in syringolide production by Pseudomonas syringae pv. tomato PT23. Plasmid 31:275-287. [DOI] [PubMed] [Google Scholar]
  • 38.Nambu, T., T. Minamino, R. M. Macnab, and K. Kutsukake. 1999. Peptidoglycan-hydrolyzing activity of the FlgJ protein, essential for flagellar rod formation in Salmonella typhimurium. J. Bacteriol. 181:1555-1561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Noël, L., F. Thieme, D. Nennstiel, and U. Bonas. 2001. cDNA-AFLP analysis unravels a genome-wide hrpG-regulon in the plant pathogen Xanthomonas campestris pv. vesicatoria. Mol. Microbiol. 41:1271-1281. [DOI] [PubMed] [Google Scholar]
  • 40.Noël, L., F. Thieme, D. Nennstiel, and U. Bonas. 2002. Two novel type III-secreted proteins of Xanthomonas campestris pv. vesicatoria are encoded within the hrp pathogenicity island. J. Bacteriol. 184:1340-1348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Orth, K. 2002. Function of the Yersinia effector YopJ. Curr. Opin. Microbiol. 5:38-43. [DOI] [PubMed] [Google Scholar]
  • 42.Orth, K., Z. Xu, M. B. Mudgett, Z. Q. Bao, L. E. Palmer, J. B. Bliska, W. F. Mangel, B. Staskawicz, and J. E. Dixon. 2000. Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like protein protease. Science 290:1594-1597. [DOI] [PubMed] [Google Scholar]
  • 43.Petnicki-Ocwieja, T., D. J. Schneider, V. C. Tam, S. T. Chancey, L. Shan, Y. Jamir, L. M. Schechter, M. D. Janes, C. R. Buell, X. Tang, A. Collmer, and J. R. Alfano. 2002. Genomewide identification of proteins secreted by the Hrp type III protein secretion system of Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA 99:7652-7657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Pucciarelli, M. G., and F. Garcia-Del Portillo. 2003. Protein-peptidoglycan interactions modulate the assembly of the needle complex in the Salmonella invasion-associated type III secretion system. Mol. Microbiol. 48:573-585. [DOI] [PubMed] [Google Scholar]
  • 45.Rossier, O., G. Van den Ackerveken, and U. Bonas. 2000. HrpB2 and HrpF from Xanthomonas are type III-secreted proteins and essential for pathogenicity and recognition by the host plant. Mol. Microbiol. 38:828-838. [DOI] [PubMed] [Google Scholar]
  • 46.Rossier, O., K. Wengelnik, K. Hahn, and U. Bonas. 1999. The Xanthomonas Hrp type III system secretes proteins from plant and mammalian pathogens. Proc. Natl. Acad. Sci. USA 96:9368-9373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Salanoubat, M., S. Genin, F. Artiguenave, J. Gouzy, S. Mangenot, M. Arlat, A. Billault, P. Brottier, J. C. Camus, L. Cattolico, M. Chandler, N. Choisne, C. Claudel-Renard, S. Cunnac, N. Demange, C. Gaspin, M. Lavie, A. Moisan, C. Robert, W. Saurin, T. Schiex, P. Siguier, P. Thebault, M. Whalen, P. Wincker, M. Levy, J. Weissenbach, and C. A. Boucher. 2002. Genome sequence of the plant pathogen Ralstonia solanacearum. Nature 415:497-502. [DOI] [PubMed] [Google Scholar]
  • 48.Schulte, R., and U. Bonas. 1992. Expression of the Xanthomonas campestris pv. vesicatoria hrp gene cluster, which determines pathogenicity and hypersensitivity on pepper and tomato, is plant inducible. J. Bacteriol. 174:815-823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Staskawicz, B. J. 2001. Genetics of plant-pathogen interactions specifying plant disease resistance. Plant Physiol. 125:73-76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Szurek, B., O. Rossier, G. Hause, and U. Bonas. 2002. Type III-dependent translocation of the Xanthomonas AvrBs3 protein into the plant cell. Mol. Microbiol. 46:13-23. [DOI] [PubMed] [Google Scholar]
  • 51.Tatusova, T. A., and T. L. Madden. 1999. Blast 2 sequences—a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174:247-250. [DOI] [PubMed] [Google Scholar]
  • 52.Wengelnik, K., and U. Bonas. 1996. HrpXv, an AraC-type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 178:3462-3469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Wengelnik, K., O. Rossier, and U. Bonas. 1999. Mutations in the regulatory gene hrpG of Xanthomonas campestris pv. vesicatoria result in constitutive expression of all hrp genes. J. Bacteriol. 181:6828-6831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wengelnik, K., G. Van den Ackerveken, and U. Bonas. 1996. HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two-component response regulators. Mol. Plant-Microbe Interact. 9:704-712. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES