Skip to main content
NCBI home page
Plant Physiology logoLink to Plant Physiology
. 2003 Feb;131(2):793–802. doi: 10.1104/pp.014530

cor Gene Expression in Barley Mutants Affected in Chloroplast Development and Photosynthetic Electron Transport1

Cristina Dal Bosco 1,2, Marco Busconi 1,2, Chiara Govoni 1,1, Paolo Baldi 1, A Michele Stanca 1, Cristina Crosatti 1, Roberto Bassi 1, Luigi Cattivelli 1,*
PMCID: PMC166855  PMID: 12586903

Abstract

The expression of several barley (Hordeum vulgare) cold-regulated (cor) genes during cold acclimation was blocked in the albino mutant an, implying a chloroplast control on mRNAs accumulation. By using albino and xantha mutants ordered according to the step in chloroplast biogenesis affected, we show that the cold-dependent accumulation of cor14b, tmc-ap3, and blt14 mRNAs depends on plastid developmental stage. Plants acquire the ability to fully express cor genes only after the development of primary thylakoid membranes in their chloroplasts. To investigate the chloroplast-dependent mechanism involved in cor gene expression, the activity of a 643-bp cor14b promoter fragment was assayed in wild-type and albino mutant an leaf explants using transient β-glucuronidase reporter expression assay. Deletion analysis identified a 27-bp region between nucleotides −274 and −247 with respect to the transcription start point, encompassing a boundary of some element that contributes to the cold-induced expression of cor14b. However, cor14b promoter was equally active in green and in albino an leaves, suggesting that chloroplast controls cor14b expression by posttranscriptional mechanisms. Barley mutants lacking either photosystem I or II reaction center complexes were then used to evaluate the effects of redox state of electron transport chain components on COR14b accumulation. In the mutants analyzed, the amount of COR14b protein, but not the steady-state level of the corresponding mRNA, was dependent on the redox state of the electron transport chain. Treatments of the vir-zb63 mutant with electron transport chain inhibitors showed that oxidized plastoquinone promotes COR14b accumulation, thus suggesting a molecular relationship between plastoquinone/plastoquinol pool and COR14b.

Plastid proteins are encoded by both nuclear and plastid genomes. Interaction between the two genetic systems is therefore needed for a coordinated response to environmental factors affecting chloroplast biogenesis (Goldschmidt-Clermont, 1998). Impaired plastid function leads to a decline of many mRNAs encoded in the nucleus, suggesting that plastid signals are required for the nuclear gene expression (Oelmüller et al., 1986). In barley (Hordeum vulgare), the albostrians mutant, lacking plastid ribosomes, showed an altered expression of many nuclear genes when compared with the corresponding wild type, as shown by the decreased level of nuclear gene transcripts encoding chloroplast as well as a few non-chloroplast proteins. Thus, a role for plastid factors in the control of the nuclear genome was inferred (Hess et al., 1994).

In the chloroplast membranes, environmental conditions (e.g. excess light and/or low temperature) affect light-induced electron transport rate, and thus the plastoquinone redox state reflects the balance between light harvesting and energy use. Over-reduction of plastoquinone pool causes photoinhibition of photosynthesis (Huner et al., 1996). The redox state of the plastoquinone controls several functions involved in chloroplast biogenesis: the transcription rate of the chloroplast psaB gene (Tullberg et al., 2000), the transcription (Escoubas et al., 1995) of nuclear genes encoding chloroplast proteins, and also posttranscriptional modification processes (Dickey et al., 1998).

Changes in plastoquinone redox state elicit stress response mechanisms (Huner et al., 1996). In maize (Zea mays), the cold/light-induced phosphorylation of CP29 is promoted by the over-reduction of the plastoquinone pool (Bergantino et al., 1995; Mauro et al., 1998). In winter rye (Secale cereale), it has been suggested that photosystem II (PSII) excitation pressure, rather than growth temperature per se, regulates the expression of the low temperature-induced gene wcs19 (Gray et al., 1997).

Exposure to low, nonfreezing temperatures induces a process known as cold acclimation (hardening) that improves frost resistance of over-winter plants through the expression of cold-responsive genes (Thomashow, 1999). A number of genes triggered by cold (cold-regulated [cor] genes) or by cold and dehydration have been reported (Cattivelli et al., 2002). In barley, many nuclear-encoded cor genes have been described, among them are cor14b, blt14, and tmc-ap3. Cor14b encodes a soluble protein of unknown function localized in the stroma compartment of the chloroplast (Crosatti et al., 1995, 1999), whereas tmc-ap3 encodes a putative channel protein of the chloroplast outer envelope selective for amino acids (Baldi et al., 1999). Blt14 is a component of a gene family encoding proteins predicted to be secreted into the apoplast (Phillips et al., 1997); at least five different blt14-related sequences (blt14.0, blt14.1, blt14.2, ao86, and ao29) have been described (Phillips et al., 1997; Grossi et al., 1998).

Previous studies have shown that the expression of cor14b, blt14, and tmc-ap3 is affected by both light and chloroplast development. The expression of cor14b in etiolated plants was enhanced by a short exposure to red (but not far-red) or blue light before cold treatment (Crosatti et al., 1999). Furthermore, the expression of all three genes was impaired in the barley albino mutant an, suggesting the involvement of a chloroplast factor in the activation of these cor genes (Grossi et al., 1998; Baldi et al., 1999; Crosatti et al., 1999).

In this work, we report on the expression of cor genes in a series of barley mutants altered either on chloroplast development or photosynthetic activity. By using albino and xantha mutants, we show that the cold-dependent accumulation of cor14b, tmc-ap3, and blt14 mRNAs depends on plastid developmental stage. This effect reveals a chloroplast control on mRNA level. The study of mutants blocked on photosynthetic electron transport revealed a further step of regulation: The amount of COR14b gene product was enhanced by conditions leading to oxidized plastoquinone without influencing mRNA level.

RESULTS

Plastid Control on the Expression of Low Temperature-Specific cor Genes

A differential display reverse transcriptase-PCR experiment was initially carried out to compare the mRNA profile of green plants grown at 20°C with those of green and albino plants exposed at 3°C. This search yielded two fragments whose expression, although dependent on cold treatment, was equally induced in wild-type and albino plants, implying that their expression was independent from the chloroplast. The first DNA fragment corresponded to the dehydrin 8 (dhn8) sequence (Zhu et al., 2000), whereas the second one, still unknown when originally discovered, was used for the isolation of a full-length sequence by screening a cDNA library. The full-length cDNA was 672 bp long and contained a single open reading frame of 164 amino acids (18 kD). This gene has been named cor18. The expression of dhn8 and cor18 was used to tag the chloroplast-independent cold signal transduction pathway. Accumulation of dhn8 and cor18 mRNAs was never affected by the mutation at the an locus during either cold or dehydration stress (Fig. 1, A and B). In both green and albino leaves, the cold-induction kinetic of cor18 mRNA is characterized by a fast and transient induction during the first 7 h, followed by a permanent induction after 1 d. The expression pattern of cor18 and dhn8 was then compared with that of three barley genes, cor14b, tmc-ap3, and blt14, previously suggested to be dependent on chloroplast function because their expression was impaired in albino plants (Grossi et al., 1998; Baldi et al., 1999; Crosatti et al., 1999). In wild-type barley, cold treatment in the presence of light induces the appearance of cor14b, tmc-ap3, and blt14 transcripts, which is sustained during the treatment. On the contrary, plants homozygous for the an gene, which blocks the chloroplast development at a very early stage, show strong changes in the expression profile of the same genes. Albino an plants had a minimal induction of cor14b after 1 and 3 d, whereas longer exposure to low temperature led to full repression of this gene. The expression of tmc-ap3 in the leaves of the mutant exposed to cold was similar to that of cor14b, except for the presence of a basal mRNA level. The expression of blt14-related mRNAs was reduced and delayed (Fig. 1A).

Figure 1.

Figure 1

Open in a new tab

mRNA expression analysis of the cold-regulated genes cor14b, tmc-ap3, blt14, dhn8, and cor18 in green leaves of barley and in albino plants carrying the mutation an. The same filter, loaded with 0.5 μg of poly(A) RNA, was subsequently hybridized with all probes. Equal loading was assessed through hybridization with the barley gene coding for the ribosomal protein 12 of the large subunit (RPL12). A, Expression at low temperature. Lanes 1 through 8, Green plants (winter barley cv Nure) grown at 20°C/16°C (lane 1) and then hardened at 3°C/1°C from 7 h until d 15 (lanes 2–8). Lanes 9 through 16, albino plants carrying the mutation an grown at 20°C/16°C (lane 9) and then hardened at 3°C/1°C from 7 h until d 15 (lanes 10–16). B, Expression during dehydration. Lanes 1 through 3, Green plants (winter barley cv Nure) during the dehydration from fully watered (control) until 7% water loss. Lanes 4 through 7, albino plants carrying the mutation an during the dehydration from fully watered (control) until 7% water loss.

When the expression of the cor genes was analyzed in both albino and wild-type dehydrated plants, cor18 and dhn8 responded to dehydration by increasing their mRNA level, whereas cor14b, tmc-ap3 and blt14 did not (Fig. 1B). On the basis of these results, we suggest that chloroplast activity exhibits control on cor gene expression only on sequences specifically induced by low temperature. In fact, none of the sequences whose cold-induced expression was impaired in the albino plants was also expressed during the dehydration response (Fig. 1B). In the following, we present a detailed analysis of the effects of mutations affecting the chloroplast development on cor gene expression.

Plastid Developmental Transition to Primary Thylakoid State Is Required for the Accumulation of Low Temperature-Specific cor mRNAs

The expression of cor14b, tmc-ap3, and blt14 was followed in a collection of albino and xantha mutants of barley previously characterized at biochemical and ultrastructural level (Henningsen et al., 1993). A simplified plastid development pathway showing the steps affected by the different xantha and albino mutants of barley used in this work (alb-e16, alb-f17, xan-u21, xan-s46, xan-g45, xan-l35, and xan-b12) is presented in Figure 2A. The mutants are ordered according to the affected step in chloroplast biogenesis. Genotypes e16 and an are characterized by the absence of pigments and of primary lamellae. The b12 genotype contains about 50% of chlorophyll and small grana discs. Genotypes alb-f17, xan-u21, xan-s46, xan-g45, and xan-l35 are intermediate between e16 and b12, each representing a distinct step of increasing development (Henningsen et al., 1993). The accumulation of cor14b, blt14, and tmc-ap3 mRNAs was evaluated in mutant seedlings as compared with the corresponding wild type after 8 d of cold treatment (Fig. 2B). A clear step enhancement in the accumulation of cor14b and blt14 transcripts upon cold plus light treatment was associated with the transition between xantha mutants f-17 and s-46. Accumulation of tmc-ap3 was partially induced in the xantha mutant f-17 although the full expression of the gene was obtained with the xantha mutant s-46. Taken together, these results suggest that a common, chloroplast mediated, mechanism is involved in the cold-dependent accumulation of cor14b, blt14, and tmc-ap3 mRNAs. This machinery is associated with the development of primary thylakoid membranes.

Figure 2.

Figure 2

Open in a new tab

Cold-dependent expression of cor14b, tmc-ap3, and blt14 in a collection of barley albino and xantha mutants. A, Simplified plastid development pathway showing the steps affected by the different xantha and albino mutants of barley used in this work (alb-e16, alb-f17, xan-u21, xan-s46, xan-g45, xan-l35, and xan-b12). Modified from Henningsen et al. (1993). B, Accumulation of cor14b, tmc-ap3, and blt14 mRNA in the mutants after 8 d at 3°C/1°C. The filter was loaded with 0.5 μg of poly(A) RNA. Lanes 1 and 2, Green plants (winter barley cv Nure) grown at 20°C/16°C or hardened at 3°C/1°C. Lanes 3 and 4, albino plants carrying the mutation an and the corresponding wild type (wt) grown at 20°C/16°C. Lanes 5 through 20, albino and xantha mutants hardened at 3°C/1°C evaluated in comparison with the corresponding wild type (wt). Equal loading was assessed through hybridization with the barley gene coding for the ribosomal protein 12 of the large subunit (RPL12). C, Accumulation of the protein COR14b in the mutants after 8 d at 3°C/1°C. Samples as in B. Top panels, The loading standard represented by a polypeptide of 29 kD recognized by the COR14b polyclonal antibody whose expression was not affected by either cold or plastid development.

An immunoblot experiment was performed on the same mutant collection to follow COR14b protein accumulation (Fig. 2C). After 8 d of exposure to low temperatures, mutants blocked in the early stages of the chloroplast biogenesis, at earlier steps than formation of primary thylakoid membranes (up to mutant f-17), accumulated only traces of COR14b. Nevertheless, the polypeptide identified by the antibody in these samples showed the same apparent Mr in SDS-PAGE as the mature form of COR14b in wild-type plants, suggesting that the protein was correctly processed and imported into the plastids. The mutation at s-46 or later steps, showing plastids with primary thylakoid membranes (xantha-s46, -g45, -l35, and -b12), showed a level of COR14b at least equal to that of the corresponding wild type. Therefore the enhancement in COR14b accumulation matches the parallel enhancement in mRNA expression.

A selection of mutants unable (albino an and -e16) and able (xantha-s46, -l35, and -b12) to fully accumulate cor14b, tmc-ap3, and blt14 mRNAs were acclimated for 21 d and then tested for their frost tolerance in comparison with wild-type green and etiolated plants (Fig. 3). All mutants were heavily damaged even when frozen at −6°C, suggesting that the accumulation of the chloroplast-dependent cor mRNAs per se is not sufficient to confer frost tolerance. Etiolated plants showed a level of frost resistance intermediate between those of green and albino/xantha mutants, as previously reported (Grossi et al., 1998).

Figure 3.

Figure 3

Open in a new tab

Frost resistance, measured as relative membrane injury, of several albino and xantha barley mutants in comparison with the corresponding wild types (WT) after 21 d of cold acclimation. Nonacclimated (N/A) and cold-acclimated (A) samples of green and etiolated plants from the winter barley cv Nure were also included. Plants have been frozen at −6°C (black bars) or at −8°C (white bars). lsd0.05 = 7.8.

Chlorophyll Precursors Levels Are Not Affected by Chloroplast Development Mutations

Previous work has suggested that nuclear gene expression might be controlled by the levels of the chlorophyll precursor protoporphyrin IX (Lermontova and Grimm, 2000). To verify whether the differences in cor14b accumulation among albino and xantha mutants could be correlated with protoporphyrin IX levels, we have determined protoporphyrin IX levels in xantha f17 and xantha-s46 before and after cold stress treatment by using the method of Lermontova and Grimm (2000). Protoporphyrin IX content of leaves was the same within 10% range.

The Promoter of cor14b Is Equally Active in Albino and Wild-Type Leaves

Differential mRNA accumulation could either be due to transcriptional or posttranscriptional regulation. Dunn et al. (1994) and Phillips et al. (1997) have previously shown that the accumulation of blt14 mRNAs is due to increase mRNA stability at low temperature rather than to gene induction. To clarify this point, we studied the expression of a chimeric synthetic gene carrying the uidA coding region under the control of the cor14 promoter sequence in leaves of green and albino plants.

A genomic clone, cor14b-G1, corresponding to the cor14b cDNA was isolated and characterized. The structure of cor14b-G1 was determined by comparing its sequence with that of the corresponding cDNA. Determination of the transcription start point was performed by a primer extension experiment. Cor14b-G1 contains 643 bp upstream to the transcription start point, 101 nucleotides (nts) of 5′-untranslated region (UTR), and a single intron between position +312 (nts from the transcription start point) and position +466. The region upstream the transcription start point shows a typical TATA-box (central position −32). To determine which region of the cor14b promoter contributes to the regulation of gene expression, a deletion series of five chimeric reporter constructs, with varying lengths of promoter fused to the β-glucuronidase (GUS) reported gene, were initially analyzed by transient expression in green leaves of the winter barley cv Nure. Leaves grown at control temperature were bombarded with gold particle coated with one of the construct and then transferred to either 25°C or 2°C before assaying GUS expression by histochemical staining. Average data from five experiments normalized using the rice (Oryza sativa) ubiquitin promoter-uidA construct as external standard are presented in Figure 4. All constructs showed very low, if any, activity at 25°C and a clear cold induction at 2°C. GUS activity at low temperature was not significantly different between constructs B (−349) and C (−274) and between constructs D (−247) and E (−156). The activity of B and C was significantly higher than that of A (−643), whereas the activity of D and E was significantly lower than that of A, B, and C. Taken together, these data indicate that the region between nts −274 and −247 (AGCTTACCCAAAGGTACGTGAGGTCGG) contains sequences necessary for the low temperature-dependent expression of cor14b. The −274/−247 region notably contains the ACGT element, a cis-acting motif recognized by basic Leu zipper proteins (Foster et al., 1994). The reduced level of expression of constructs A, with respect to construct B, indicates the presence of a negative regulatory element between nts −643 and −349. The activity of the constructs A, C, and D in leaves of plants carrying the mutation at the an locus was similar to activity in wild type. The activity of the 643-bp promoter fragment of cor14b was, therefore, not affected by the albino mutation affecting chloroplast development. Although the cor14b mRNA steady-state level in the albino leaves is less than 5% with respect to wild type, these plants are able to correctly activate the responsive elements present in the cor14b promoter fragment, thus suggesting that the chloroplast control on cor14b expression does not act at the transcriptional level.

Figure 4.

Figure 4

Open in a new tab

Transient reporter gene expression analysis of the cor14b promoter sequences in leaves of green and albino plants. Five promoter/GUS constructs (A–E, size in nts from the transcription start point indicated) were generated as described in “Materials and Methods” and delivered to barley leaf explants through particle bombardment. Transient reporter gene expression in winter barley cv Nure, albino an plants and corresponding wild-type leaf explants. Expression (blue cell cluster count per experiment) is shown as mean value of five experiments ± se. In each experiment, about 12 cm2 of leaf explants were exposed to particle bombardment.

Effects of the Chloroplast Redox State on cor14b Expression

The redox state of the electron transport chain components is known to affect gene expression (Escoubas et al., 1995; Pfannschmidt et al., 1999, 2001). Two barley viridis mutants in which the synthesis of either photosystem I (PSI; zb63; Skovgaard Nilsen et al., 1996) or PSII (vir-115; Gamble and Mullet, 1989) components was impaired thus leading to either reduction or oxidation of the plastoquinone pool was analyzed by northern blotting with a cor14b probe (Fig. 5A). It is shown that cor14b mRNA accumulated to the same level in wild-type and mutant genotypes upon cold treatment, regardless of the presence of a mutation affecting the electron transport chain. These results imply that the changes in the redox state of the electron transport chain components caused by viridis mutations do not affect the steady-state mRNA level of cor14b.

Figure 5.

Figure 5

Open in a new tab

Cold-dependent accumulation of cor14b in barley viridis mutants. A, Accumulation of cor14b mRNA in the mutants after 8 d at 3°C/1°C. The filter was loaded with 0.5 μg of poly(A) RNA. Lanes 1 through 5, mRNA isolated from winter barley Nure, two viridis mutants and in the corresponding wild type grown at 20°C/16°C. Lanes 6 through 10, mRNA isolated from winter barley Nure, two viridis mutants and in the corresponding wild type hardened 8 d at 3°C/1°C. Equal loading was assessed through hybridization with the barley gene coding for the ribosomal protein 12 of the large subunit (RPL12). B, Accumulation of the protein COR14b in the mutants after 8 d at 3°C/1°C. Sample as in A. Top panels, The loading standard represented by a polypeptide of 29 kD recognized by the COR14b polyclonal antibody whose expression was not affected by either cold or plastid development. C, Effects of DCMU and DBMIB treatment on the accumulation of cor14b mRNA in the barley viridis mutants vir-zb63 after 8 d of hardening. Lanes 1 and 2, Control and hardened wild-type plants. Lanes 3 and 4, Wild-type and mutated zb63 plants hardened in presence of 50 μm DCMU. Lanes 5 and 6, Wild-type and mutated zb63 plants hardened in presence of 30 μm DBMIB. Equal loading was assessed through hybridization with the barley gene coding for the ribosomal protein 12 of the large subunit (RPL12). D, Effects of DCMU and DBMIB treatment on the accumulation of COR14b protein in the barley viridis mutants vir-zb63 after 8 d of hardening. Samples as in C. Top panels, The loading standard represented by a polypeptide of 29 kD recognized by the COR14b polyclonal antibody whose expression was not affected by either cold or plastid development.

The same viridis mutants were used to evaluate of the effects of the redox state of electron transport components on COR14b. COR14b antibody reaction (Fig. 5B) showed that the protein is absent in wild-type and mutant plants grown at 20°C, whereas after 8 d of cold acclimation, COR14b accumulated to the same extent in vir-zb63 (a mutant devoid of PSI activity and therefore having plastoquinone and cytochrome [cyt] b6/f complex in the reduced form) and in the corresponding wild type. A slight, but reproducible increase in COR14b protein accumulation was obtained in the vir-115 mutant with defective PSII and therefore characterized by oxidized electron transport chain components. These results prompt us to the verify whether variation in the redox state could affect the accumulation of COR14b. Because the viridis mutant vir-zb63 exhibits only 2% of the wild-type electron transport rate (Skovgaard et al., 1996), this genotype could represent a suitable tool to magnify any effects of chemical inhibitors of the electron transport chain. Wild-type and vir-zb63 plants were germinated and cold acclimated for 8 d in presence of 50 μm 3-(3′,4′-dichlorophenyl)-1,1-dimethylurea (DCMU) or 30 μm 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB). None of these treatments altered the steady-state level of cor14b mRNA (Fig. 5C). No effects were detected also at protein level after the DBMIB treatment, an inhibitor that promotes the reduction of plastoquinone (a condition already present in vir-zb63 plants as consequence of the mutation) and the oxidation of cyt b6/f. On the contrary, application of DCMU, leading to oxidized plastoquinone, promotes COR14b overaccumulation in the mutant (Fig. 5D). DCMU treatment in wild-type plants did not lead to an increase of COR14b amount, suggesting that the non-physiological condition of the chloroplast of viridis mutants is required to magnify the effects of the chemical inhibitors.

DISCUSSION

Mutation analysis is a major tool for dissection of the molecular mechanisms of biological processes. In this work, we used barley mutants to clarify the regulatory mechanisms controlling the expression of several cor genes. Barley genetic stocks offer a unique collection of chloroplast-deficient mutants, most of them characterized at genetic and biochemical levels; although these mutations are generally lethal, the large endosperm of barley seeds support plant growth for several weeks allowing the molecular analysis of the mutants. We have previously shown that plants carrying a mutation preventing chloroplast development, besides the expected albino phenotype, are also impaired in the expression of several cor genes (Grossi et al., 1998; Baldi et al., 1999; Crosatti et al., 1999). In the present study, a detailed analysis of cor gene expression in albino, xantha, and viridis barley mutants leads to the identification of several chloroplast-dependent mechanisms involved in the accumulation of cor mRNAs and proteins.

First, the analysis of the expression of drought- and/or cold-regulated genes in albino barley plants demonstrates that different regulatory mechanisms are involved in the control of the low temperature response with respect to the drought response. In fact, whereas the expression of three unrelated cor genes (cor14b, tmc-ap3, and blt14) was severely inhibited in albino plants, the cold- and drought-dependent induction of dhn-like and of cor18 sequences in the same genotype was normal, showing that the corresponding signal transduction pathway is not affected by chloroplast developmental state or photosynthetic activity. In Arabidopsis, most cold-regulated genes respond to dehydration and, conversely, most dehydration-induced genes also respond to cold stress, suggesting that a common set of genes, although controlled by two independent pathways, is responsible for both drought and cold tolerance (for review, see Shinozaki and Yamaguchi-Shinozaki, 2000). In barley, at least three cor genes expressed only upon exposure to low temperature (cor14b, tmc-ap3, and blt14) are under the control of a signal transduction pathway involving a chloroplast component. This pathway acts independently from the pathway controlling the expression of cold/drought-inducible genes.

The analysis of the chloroplast developmental mutant collection suggests that a step in chloroplast development, associated to the formation of the primary thylakoid membranes (corresponding to condition of the xantha mutant s-46), confers the ability of correctly expressing cor14b, tmc-ap3, and blt14. Inability to accumulate the mRNAs of these genes has only been found in some albino and xantha mutants and it is not reproducible in etiolated leaves. The induction of cor14b was only partially reduced in etiolated seedlings (Crosatti et al., 1999), whereas the expression of tmc-ap3 and blt14 was respectively unaffected and enhanced by etiolated conditions (Grossi et al., 1998; Baldi et al., 1999).

The plastid signals may act either by enhancing transcription or by increasing the mRNA stability. Plastid-dependent regulation of nuclear genes has been previously described. In Chlamydomonas reinhardtii, the chlorophyll precursors act as intermediates in the light-regulated signaling pathway controlling the transcription rate of the nuclear heat shock genes hsp70a (cytosolic) and hsp70b (chloroplastic; Kropat et al., 1997). Light regulation of Fed-1 (chloroplastic ferredoxin) mRNA abundance in leaves of green plants is posttranscriptionally regulated. Fed-1 mRNAs are stable when associated to ribosomes in illuminated leaves, but in darkness ribosomes release the Fed-1 mRNAs, and the transcripts are degraded by a process involving a CATT element in 5′-UTR of the mRNA (Dickey et al., 1998). In barley, it has been demonstrated that both transcriptional ad posttranscriptional mechanisms are involved in regulation of low temperature-responsive genes (Dunn et al., 1994). It has been reported that the low-temperature accumulation of blt14 transcripts results from an increased mRNA stability due a low temperature-dependent protein factors (Phillips et al., 1997). On the other hand, our results show that expression of cor14b involves an increased gene expression in response to cold, and a 27-bp region encompassing a boundary of some element that contributes to cold-induced expression was identified in the cor14b promoter. Therefore when the cold-dependent accumulation of blt14 and cor14b transcripts is investigated in wild-type plants, the genes reveal two different regulatory mechanisms: The transcription of blt14 is constitutive and the mRNA accumulation is due to a posttranscriptional process (Dunn et al., 1994; Phillips et al., 1997), whereas accumulation of cor14b transcripts is primarily due to cold-induced gene transcription. Nevertheless, when blt14 and cor14b expression was assayed in the collection of chloroplast development mutants, the same dependence on chloroplast development was observed. Because the cor14b promoter was equally active in transient expression experiments using both green and albino an leaf explants, we suggest that a posttranscriptional regulation depending on a chloroplast-deriving factor may be also involved in the accumulation of the cor transcripts examined in this work. Thus a two-step control could be hypothesized to be active in the regulation of cor14b mRNA level: A cold-dependent transcription effect might allow for mRNA synthesis, whereas synthesis of the COR14b protein and its accumulation at its chloroplast site are further controlled by light though a functional chloroplast. Such a control mechanism would be consistent with a possible function of COR14b in photoprotection/repair of light-induced photoinhibition, which is enhanced by cold stress (Bergantino et al., 1995; Huner et al., 1996). We have, at present, no data for suggesting which is the molecular identity of the chloroplast signal exiting the chloroplast. Previous works have suggested that protoporphyrin IX may act as a possible diffusing compound reaching the cytoplasm through an envelope-localized ABC transporter (Kropat et al., 1997; Moller et al., 2001). However, we did not observe changes in protoporphyrin IX levels in barley mutants impaired in chloroplast-dependent cor gene expression.

Chloroplast control on cor mRNA accumulation affects nuclear genes encoding chloroplast-localized proteins (i.e. cor14b and tmc-ap3); although evidence suggests that the cold-dependent expression of several genes encoding non-chloroplast proteins may also be chloroplast regulated. In fact, the blt14 gene family encodes proteins that are predicted to be secreted (Phillips et al., 1997). This is consistent with the recent report that the cold-dependent up-regulation of the elongation factor 1Bβ and of the ribosomal protein S7 and L7A transcripts is controlled by a chloroplast-related pathway impaired in albino mutants (Baldi et al., 2001). It can be hypothesized that cor genes whose expression is controlled by a chloroplast factor are coordinately expressed in different cell compartments to prevent/repair light-induced damages from the oxidative stress deriving from the operation of the photosynthesis at low temperature. Analysis of the biochemical function of individual cor genes is required to confirm this hypothesis.

A distinct mechanism was disclosed through the analysis of barley viridis mutants, controlling the level of COR14b protein on the basis of redox state of the photosynthetic electron transport chain components. Chloroplast redox state is known to influence gene expression at different levels. The transcription rate of the nuclear genes coding for the light-harvesting complex II (Lhc; Escoubas et al., 1995) and for PSI subunits (PsaD and PsaF; Pfannschmidt et al., 2001) as well as of the chloroplast genes encoding the reaction center apoproteins of PSI and PSII (Pfannschmidt et al., 1999) is controlled by the redox state of the plastoquinone. A posttranscriptional redox state-dependent regulation has been shown for the chloroplast gene petB encoding the cyt b6 protein (Tullberg et al., 2000). Changes in the environmental conditions affect the redox state of the chloroplast, whereas exposure to low temperature under light conditions leads to an over-reduction state of the PSII (Gray et al., 1996, 1998). It is therefore not surprising that a number of stress-responsive mechanisms are controlled by the chloroplast redox state. In the case of COR14b, the effect of the chloroplast redox state does not influence the steady-state transcript level but does affect protein accumulation. This effect might thus be due to either a control of the protein degradation rate or changes on mRNA translational efficiency. The amount of COR14b protein was slightly enhanced in the viridis-115 mutant characterized by oxidized electron transport chain components. Treatments with electron transport chain inhibitors (DCMU and DBMIB) at low temperature suggest that, at least in the vir-zb63 chloroplast (a mutant exhibiting only 2% of the wild-type electron transport rate; Skovgaard Nilsen et al., 1996), oxidized plastoquinone promotes COR14b overaccumulation. These results, although obtained in plant with non-physiological chloroplast conditions, suggest a possible molecular relationship between plastoquinone and COR14b. Photoinhibition deriving for light plus cold conditions is mediated by plastoquinone over-reduction (Gray et al., 1996, 1998; Huner et al., 1996) thus apparently contrasting with the increased cor14b levels observed in condition of oxidized plastoquinone. The biochemical function of cor14b in the chloroplast stroma compartment is still unknown: We suggest that it might be involved in a detoxification mechanism involving its own degradation to explain the reverse relationship with photoinhibitory conditions.

Taken together, the experimental data describing the expression of cor14b depict a multiple-level regulation system where different environmental cues and chloroplast factors act together to fine tune the amount of COR14b protein into the chloroplast.

MATERIALS AND METHODS

Genetic Materials, Growth Conditions, and Freezing Test

The analyses were performed using winter barley (Hordeum vulgare cv Nure) and a collection of albino, xantha, and viridis mutants. The albino mutants alb-e16 and alb-f17 and the xantha mutants xan-u21, xan-s46, xan-g45, xan-l35, and xan-b12 were described by Henningsen et al. (1993) and located in the chloroplast biogenesis pathway as reported in Figure 2A. The albino mutant an was reported by Burnham et al. (1971) and also in our previous work (Crosatti et al., 1999). The viridis mutants vir-zb63, a PSI-type mutant with the electron transport components in a reduced state, and vir-115, a PSII-type mutant with electron transport components in a oxidized state, were previously characterized (Gamble and Mullet, 1989; Skovgaard Nilsen et al., 1996). All mutants, but albino an, were obtained after chemical mutagenesis, in the genetic background of barley cv Bonus (Simpson and von Wettstein, 1991). Albino an is a spontaneous mutation found in Hordeum distichum nigrinudum (Burnham et al., 1971). Mutants were maintained as heterozygous, and after germination, a 3:1 segregation was observed. Because mutagenized genotypes can carry an unpredictable number of mutations besides that responsible for chloroplast phenotype, green plants segregating from each of the genetic stock containing the mutation were used as the most appropriate wild type for each mutant.

Hardening experiments were performed on barley plants grown for 7 d in peat at 20°C/16°C, 9 h of light (200 μmol m−2 s−1)/15 h of dark. Plants were then hardened for different times from 7 h to 15 d at 3°C/1°C, 9 h of light (200 μmol m−2 s−1)/15 h of dark.

Plants were also treated with chemical inhibitors of the electron transport chain: 30 μm DBMIB and 50 μm DCMU. DBMIB binds the cyt b6/f complex, preventing the electron transfer from plastoquinone, so that it is constitutively reduced (Schoepp et al., 1999). DCMU binds the D1 protein of PSII at the binding site of the quinone B, preventing electron transfer to plastoquinone leading to oxidation of the electron transport chain components downstream (Zer and Itzhak, 1995).

Barley seeds sterilized with 4% (w/v) sodium hypochlorite grown on filter paper (20°C/16°C, 9 h of light/15 h of dark) were used for dehydration experiments. Fully expanded first leaves were cut and air desiccated after Grossi et al. (1995). The progress of drought stress was followed measuring water loss.

The frost resistance of some chloroplast developmental mutants was tested in comparison with green and etiolated plants after 21 d of cold-acclimation, measuring the relative membrane injury through the rate increase in ion release according to Rizza et al. (1994). Cold-acclimated plants were stored at −3°C for 16 h and then subjected to a gradual 2°C h−1 lowering of the temperature down to −6°C or −8°C; the plants were kept in these conditions for 18 h in the dark. After gradual thawing, a sample of 35 leaf segments of about 0.5 cm for each replication (four replications in total) were placed in a vial containing 25 mL of de-ionized water, degassed under vacuum for 20 min, and stirred at 25°C for 2 h and 30 min. Ion release was measured by a digital conductivity meter, and membrane damage was determined as the percentage of maximum possible injury induced by autoclaving of samples. Data were subjected to ANOVA.

Gene Isolation and Northern Analysis

The cor18 gene and a sequence identical to published dhn8 gene (Zhu et al., 2000) were isolated by differential display comparing the mRNAs isolated from leaves of green plants grown at 20°C/16°C (control) with those isolated from leaves of either green or albino cold-treated (3 d at 3°C) plants. Differential display reverse transcriptase-PCR was performed as described by Baldi et al. (1999). Cor18 full-length clone (accession no. AJ291295) was isolated from a custom Uni-Zap XR cDNA library (Stratagene, La Jolla, CA). All other clones used in this work blt14, cor14b, and tmc-ap3, were previously described (Grossi et al., 1998; Baldi et al., 1999; Crosatti et al., 1999). blt14 represents a cold-regulated gene family; in the present work, expression analysis of blt14-corresponding mRNAs was assessed using the ao86 cDNA as probe. Under the condition used in the present work, the signal detected by this probe summarizes the expression of all gene families (Grossi et al., 1998).

Poly(A) RNAs were isolated from frozen leaves, ground in liquid nitrogen, and suspended in 0.05 m Tris, 0.01 m EDTA, 0.1 m NaCl, and 2% (w/v) SDS. After phenol-chloroform extractions, the poly(A) RNAs were isolated by chromatography on oligo(dT)-cellulose (Roche Diagnostics, Mannheim, Germany) according to published methods (Sambrook et al., 1989). Equal amounts of poly(A) RNAs for each sample (usually 0.2–0.5 μg) were separated on an agarose formaldehyde gel and were transferred to a positively charged nylon filter (Hybond N+, Amersham Biosciences AB, Uppsala). Radioactive probes were obtained by oligolabeling of cDNA clones, and the hybridization was performed at 65°C in 6× SSC, 2× Denhardt's solution (Sambrook et al., 1989), 0.1% (w/v) SDS, and 100 g mL−1 denatured herring sperm DNA. Filters were then washed at 65°C with 0.5 × SSC and 0.1% (w/v) SDS. For each northern experiment, a single filter was produced and subsequently hybridized with all the probes required. DNA probes were removed from filters by washing them in 0.5% (w/v) SDS at 100°C. To control the amount of poly(A) RNA loaded in each lane, the filters were hybridized with a barley cDNA probe coding for the protein 12 of the ribosomal large subunit (RPL12) whose expression was proven to be unaffected by low temperature (Baldi et al., 2001).

Isolation of the Genomic Clone and Promoter Analysis

A genomic library of the barley cv Aurea was constructed in the λ-vector EMBL4 and screened using the cor14b cDNA as probe. The cor14b genomic clone was purified to homogeneity with a subsequent round of screening and designed cor14b-G1. A 1.4-kb BglII-BglII fragment (accession no. AJ512944) was subcloned in pBluescipt II KS and sequenced in both directions using Big Dye Terminator Cycle Sequencing Kit and ABI 310 capillary sequencer (Applied Biosystems, Foster City, CA) following the instruction manuals. The transcription start point was determined with a primer extension experiment performed according to Sambrook et al. (1989) using a 20-mer primer (5′-AGGGAGCTGAATCTATCAGT-3′) corresponding to position 59 to 40 of the cor14b cDNA clone. Chimeric genes were constructed using a pUC19 vector containing the uidA (GUS) gene together with nopaline synthase (nos) gene 3′-non-coding region obtained as EcoRI-HindIII fragment from pBI101.3 (Jefferson et al., 1987). Five cor14b-G1 fragments containing 643, 349, 274, 247, and 156 bp upstream the transcription start point and 49 bp of the 5′-UTR were cloned in the pUC19-uidA-nos vector using either existing or PCR-generated restriction sites. Identity of all constructs was confirmed by DNA sequence.

Activity of cor14b promoter-uidA constructs after microprojectile bombardment was assayed on leaf segments dissected from the winter barley cv Nure from albino plants an and from the corresponding wild type. Seeds were surface sterilized with household bleach for 35 min, rinsed well with de-ionized water, planted on 1% (w/v) agar, and grown for 6 d (until the first true leaf appeared) at 25°C/20°C in 12 h of light (100 μmol m−2 s−1)/12 h of dark.

Microprojectile bombardment was performed using the Biolistic Particle Delivery System PDS1000/He (Bio-Rad, Hercules, CA; Lemaux et al., 1996). Barley leaf explants (2 cm long) were dissected from control tissue and placed on Murashige and Skoog medium containing 3% (w/v) maltose and 0.4% (w/v) Phytagel in 90-mm-diameter petri dishes. Four leaf explants were arranged in the center of each dish. Microcarriers gold (1 μm diameter) were prepared according to Lemaux et al. (1996); 35 μL of resuspended microcarrier (60 mg mL−1 ethanol) was mixed with 25 μL of plasmid DNA (1 μg μL−1), 250 μL of 2.5 m CaCl2, and 50 μL of 0.1 m spermidine. The microcarrier-DNA mixture was vortexed for 1 h and spun for 5 min in a microfuge. The supernatant was then removed, and gold particles were resuspended in 600 μL of ethanol, briefly vortexed, and spun again. The microcarriers were finally resuspended in 36 μL of ethanol and three 12-μL aliquots were load onto macrocarriers and delivered to barley leaves for each construct in each experiment. A petri dish containing the plant tissue was placed 6 cm below the microcarrier launch assembly, and the particles were fired using 900-psi rupture discs (Bio-Rad) with a partial vacuum of 28 mm Hg.

After bombardment, petri dishes were incubated for 48 h either at +2°C or at 25°C. Histochemical detection of GUS activity was performed using 5-bromo-4-chloro-3-indoyl glucuronide (Inalco, Milano) as described by Jefferson et al. (1987). UidA expression was scored by counting blue spots under a dissection microscope. Each experiment was repeated five times, and values were normalized using the rice (Oryza sativa) ubiquitin promoter fused to uidA as a biolistic control in parallel bombardment. This control was used in preference to internal standard according to Dunn et al. (1998) and Brown et al. (2001), to avoid differences in expression that may arise by differential posttranscription processing of different transcripts at low temperatures.

Protein Extraction and Western Analysis

Protein extraction and western analysis was as previously described (Crosatti et al., 1999). Barley leaves were ground to a fine powder in liquid nitrogen. The powder was washed several times with acetone containing 0.07% (v/v) β-mercaptoethanol and dried completely under a vacuum. Five milligrams of dried powder was solubilized using 280 μL of loading buffer (4% [w/v] SDS, 12% [w/v] glycerol, 50 mm Tris, pH 6.8, 2% [v/v] β-mercaptoethanol, and 0.01% [w/v] bromphenol blue), Twenty microliters of supernatant was loaded onto a 10% (w/v) Tricine-SDS-PAGE gel overlaid with a 4% (w/v) stacking gel, according to the method of Schagger and von Jagow (1987). Proteins were electroblotted onto a nitrocellulose membrane (BA83, Schleicher & Schuell, Dassel, Germany) according to the method of Szewczyk and Kozloff (1985) and probed with the COR14 polyclonal antibody. The preparation of the antibody was previously described (Crosatti et al., 1995).

Western blotting was performed after Crosatti et al. (1999) with enhanced chemiluminescence kits (ECL, Amersham Biosciences AB), and the working dilution of the antibody was 1:3,500. In addition to the COR14 proteins, the COR14 polyclonal antibody cross-reacted with an additional polypeptide of about 29 kD, the expression of which was not affected by either cold or chloroplast development. This anonymous protein was used as a loading control for all western experiments. In all analyses, filters were exposed to Kodak X-Omat film (Eastman Kodak, Rochester, NY) for a few minutes. Densitometric scanning of films after antibody exposure was performed with Molecular Analyst software (v1.5, Bio-Rad).

Protoporphyrin IX Determination

Protoporphyrin IX determination was performed by HPLC analysis of the methanol-acetone leaf extract according to Lermontova and Grimm (2000). Peak identification was carried on using absorption spectra detected on-line by a diode array Beckman 168 unit connected to a System Gold HPLC system. Separation was performed on a reversed-phase C-18 column ODS-1.

ACKNOWLEDGMENTS

We acknowledge Dr. Antonella Portesi (Istituto Sperimentale per la Cerealicoltura, Fiorenzuela, Italy) for her helpful collaboration during the isolation of the genomic clone. Tomas Morosinotto (Universita Di Verona, Italy) is thanked for performing Protoporphyrin IX determination. We thank Prof. Diter von Wettstein (Washington State University, Pullman) and Dr. David Simpson (Carlsberg Research Laboratory, Copenhagen) for the kind gift of barley mutants.

Footnotes

1

This work was supported by Consiglio Nazionale delle Ricerche Agenzia 2000 and Ministero dell'Istruzione dell'Universitá e della Ricerca Progetto Fondo Investimenti Ricerca di Base (no. RBAU01E3CX).

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.014530.

LITERATURE CITED

  1. Baldi P, Grossi M, Pecchioni N, Valè G, Cattivelli L. High expression level of a gene coding for chloroplastic amino acid selective channel protein is correlated to cold acclimation in cereals. Plant Mol Biol. 1999;41:233–243. doi: 10.1023/a:1006375332677. [DOI] [PubMed] [Google Scholar]
  2. Baldi P, Valè G, Mazzucotelli E, Govoni C, Faccioli P, Stanca AM, Cattivelli L. The transcripts of several components of the protein synthesis machinery are cold regulated in a chloroplast-dependent manner in barley and wheat. J Plant Physiol. 2001;158:1541–1546. [Google Scholar]
  3. Bergantino E, Dainese P, Cerovic Z, Sechi S, Bassi R. A post-transcriptional modification of the photosystem II subunit CP29 protect maize from cold stress. J Biol Chem. 1995;265:8474–8481. doi: 10.1074/jbc.270.15.8474. [DOI] [PubMed] [Google Scholar]
  4. Brown APC, Dunn MA, Goddard NJ, Hughes MA. Identification of a novel low-temperature-response element in the promoter of the barley (Hordeum vulgare L) gene blt101.1. Planta. 2001;213:770–780. doi: 10.1007/s004250100549. [DOI] [PubMed] [Google Scholar]
  5. Burnham CR, Eslick RF, Haus TE, Hockett EA, Jarvi AJ, McProud WL, Tsushiya T. Description of genetic stocks in the barley genetic stock center at Fort Collins, Colorado. Barley Genet News. 1971;1:103–193. [Google Scholar]
  6. Cattivelli L, Baldi P, Crosatti C, Di Fonzo N, Faccioli P, Grossi M, Mastrangelo AM, Pecchioni N, Stanca AM. Chromosome regions and stress-related sequences involved in resistance to abiotic stress in Triticeae. Plant Mol Biol. 2002;48:649–665. doi: 10.1023/a:1014824404623. [DOI] [PubMed] [Google Scholar]
  7. Crosatti C, Polverino de Laureto P, Bassi R, Cattivelli L. The interaction between cold and light controls the expression of the cold-regulated barley gene cor14b and the accumulation of the corresponding protein. Plant Physiol. 1999;119:671–680. doi: 10.1104/pp.119.2.671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Crosatti C, Soncini C, Stanca AM, Cattivelli L. The accumulation of a cold-regulated chloroplastic protein is light-dependent. Planta. 1995;196:458–463. doi: 10.1007/BF00203644. [DOI] [PubMed] [Google Scholar]
  9. Dickey LF, Petrackek ME, Nguyen TT, Hansen ER, Thompson WF. Light regulation of Fed-1 mRNA requires an element in the 5′untranslated region and correlates with differential polyribosome association. Plant Cell. 1998;10:475–484. doi: 10.1105/tpc.10.3.475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dunn MA, Goddard NJ, Zhang L, Pearce RS, Hughes MA. Low-temperature-responsive barley genes have different control mechanisms. Plant Mol Biol. 1994;24:879–888. doi: 10.1007/BF00014442. [DOI] [PubMed] [Google Scholar]
  11. Dunn MA, White AJ, Vural S, Hughes MA. Identification of promoter elements in a low-temperature-responsive gene (blt4.9) from barley (Hordeum vulgare L.) Plant Mol Biol. 1998;38:551–564. doi: 10.1023/a:1006098132352. [DOI] [PubMed] [Google Scholar]
  12. Escoubas JM, Lomas M, LaRoche J, Falkowski PG. Light intensity regulation of cab gene transcription is signaled by the redox state of the plastoquinone pool. Proc Natl Acad Sci USA. 1995;92:10237–10241. doi: 10.1073/pnas.92.22.10237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Foster R, Izawa T, Chua NH. Plant bZIP proteins gather at ACGT elements. FASEB J. 1994;8:192–200. doi: 10.1096/fasebj.8.2.8119490. [DOI] [PubMed] [Google Scholar]
  14. Gamble PE, Mullet JE. Translation and stability of proteins encoded by the plastid psbA and psbB genes are regulated by a nuclear gene during light-induced chloroplast development in barley. J Biol Chem. 1989;264:7236–7243. [PubMed] [Google Scholar]
  15. Goldschmidt-Clermont M. Coordination of nuclear and chloroplast gene expression in plant cells. Int Rev Cytol. 1998;177:155–180. doi: 10.1016/s0074-7696(08)62232-9. [DOI] [PubMed] [Google Scholar]
  16. Gray GR, Chauvin LP, Sarhan F, Huner NPA. Cold acclimation and freezing tolerance: a complex interaction of light and temperature. Plant Physiol. 1997;114:467–474. doi: 10.1104/pp.114.2.467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gray GR, Ivanov AG, Krol M, Huner NPA. Adjustment of thylakoid plastoquinone content and photosystem I electron donor pool size in response to growth temperature and growth irradiance in winter rye. Photosynth Res. 1998;56:209–221. [Google Scholar]
  18. Gray GR, Savitch LV, Ivanov AG, Huner NPA. Photosystem II excitation pressure and development of resistance to photoinhibition: II. Adjustment of photosynthetic capacity in winter wheat and winter rye. Plant Physiol. 1996;110:61–71. doi: 10.1104/pp.110.1.61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Grossi M, Giorni E, Rizza F, Stanca AM, Cattivelli L. Wild and cultivated barleys show differences in the expression pattern of a cold-regulated gene family under different light and temperature conditions. Plant Mol Biol. 1998;38:1061–1069. doi: 10.1023/a:1006079916917. [DOI] [PubMed] [Google Scholar]
  20. Grossi M, Gulli M, Stanca AM, Cattivelli L. Characterization of two barley genes that respond rapidly to dehydration stress. Plant Sci. 1995;105:71–80. [Google Scholar]
  21. Henningsen KW, Boyton JE, von Wettstein D. Mutants at xantha and albino Loci in Relation to Chloroplast Biogenesis in Barley (Hordeum vulgare L.). Copenhagen: The Royal Danish Academy of Sciences and Letters; 1993. [Google Scholar]
  22. Hess WR, Muller A, Nagy F, Borner T. Ribosome-deficient plastids affect transcription of light-induced nuclear genes: genetic evidence form a plastid-derived signal. Mol Gen Genet. 1994;242:305–312. doi: 10.1007/BF00280420. [DOI] [PubMed] [Google Scholar]
  23. Huner NPA, Maxwell DP, Gray GR, Savitch LV, Krol M, Ivanov AG, Falk S. Sensing environmental temperature change through imbalances between energy supply and energy consumption: redox state of photosystem II. Physiol Plant. 1996;98:358–364. [Google Scholar]
  24. Jefferson RA, Kavanagh T, Bevan M. GUS fusion: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987;6:3901–3907. doi: 10.1002/j.1460-2075.1987.tb02730.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kropat J, Oster U, Rudiger W, Beck CF. Chlorophyll precursors are signals of chloroplast origin involved in light induction of nuclear heath-shock genes. Proc Natl Acad Sci USA. 1997;94:14168–14172. doi: 10.1073/pnas.94.25.14168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lemaux PG, Cho M-J, Louwerse JD, Williams R, Wan Y. Bombardment mediated transformation methods for barley. BioRad US/EG Bulletin. 1996;2007:1–6. [Google Scholar]
  27. Lermontova I, Grimm B. Overexpression of plastidic protoporphyrinogen IX oxidase leads to resistance to the diphenyl-ether herbicide acifluorfen. Plant Physiol. 2000;122:75–83. doi: 10.1104/pp.122.1.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mauro S, Dainese P, Lannoye R, Bassi R. Cold-resistant and cold-sensitive maize lines differ in the phosphorylation of the photosystem II subunit, CP29. Plant Physiol. 1998;115:171–180. doi: 10.1104/pp.115.1.171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Moller SG, Kunkel T, Chua NH. A plastidic ABC protein involved in the intercompartmental communication of light signaling. Genes Dev. 2001;15:90–103. doi: 10.1101/gad.850101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Oelmüller R, Levitan I, Bergfeld R, Rajasekhar VK, Mohr H. Expression of nuclear genes as affected by treatments acting on plastids. Planta. 1986;168:482–492. doi: 10.1007/BF00392267. [DOI] [PubMed] [Google Scholar]
  31. Pfannschmidt T, Nilsson A, Allen JF. Photosynthetic control of chloroplast gene expression. Nature. 1999;397:625–628. [Google Scholar]
  32. Pfannschmidt T, Schutze K, Brost M, Oelmüller R. A novel mechanism of nuclear photosynthesis gene regulation by redox signal from the chloroplast during photosystem stoichiometry adjustment. J Biol Chem. 2001;276:36125–36130. doi: 10.1074/jbc.M105701200. [DOI] [PubMed] [Google Scholar]
  33. Phillips JR, Dunn MA, Hughes MA. mRNA stability and localisation of the low-temperature-responsive barley gene family blt14. Plant Mol Biol. 1997;33:1013–1023. doi: 10.1023/a:1005717613224. [DOI] [PubMed] [Google Scholar]
  34. Rizza F, Crosatti C, Stanca AM, Cattivelli L. Studies for assessing the influence of hardening on cold tolerance of barley genotypes. Euphytica. 1994;75:131–138. [Google Scholar]
  35. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Ed 2. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  36. Schagger H, von Jagow G. Tricine-sodium dodecyl sulphate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem. 1987;166:368–379. doi: 10.1016/0003-2697(87)90587-2. [DOI] [PubMed] [Google Scholar]
  37. Schoepp B, Brugna M, Riedel A, Nitschke A, Kramer DM. The Q(o)-site inhibitor DBMIB favours the proximal position of the chloroplast reiske protein and induces a pK-shift of the redox-linked proton. FEBS Lett. 1999;450:245–250. doi: 10.1016/s0014-5793(99)00511-6. [DOI] [PubMed] [Google Scholar]
  38. Shinozaki K, Yamaguchi-Shinozaki K. Molecular responses to dehydration and low temperature: differences and cross-talk between two stress signalling pathways. Curr Opin Plant Biol. 2000;3:217–223. [PubMed] [Google Scholar]
  39. Simpson DJ, von Wettstein D. Coodinator's report: nuclear genes affecting the chloroplast. Stock list of mutants kept at the Carlsberg Laboratory. Barley Genet News. 1991;21:102–108. [Google Scholar]
  40. Skovgaard Nilsen V, Vibe Scheller H, Lindberg Moller B. The photosystem I mutant viridis-zb-63 of barley (Hordeum vulgare) contains low amounts of active but unstable photosystem I. Physiol Plant. 1996;98:637–644. [Google Scholar]
  41. Szewczyk B, Kozloff LM. A method for the efficient blotting of strongly basic proteins from sodium dodecyl sulfate-polyacrylamide gels to nitrocellulose. Anal Biochem. 1985;148:403–407. doi: 10.1016/0003-2697(85)90528-7. [DOI] [PubMed] [Google Scholar]
  42. Thomashow MF. Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Physiol Plant Mol Biol. 1999;50:571–599. doi: 10.1146/annurev.arplant.50.1.571. [DOI] [PubMed] [Google Scholar]
  43. Tullberg A, Alexciev K, Pfannschmidt T, Allen JF. Photosynthetic electron flow regulates transcription of the psaB gene in pea (Pisum sativum L.) chloroplast through the redox state of plastoquinone. Plant Cell Physiol. 2000;41:1045–1054. doi: 10.1093/pcp/pcd031. [DOI] [PubMed] [Google Scholar]
  44. Zer H, Itzhak O. Photoinactivation of photosystem II induces changes in the photochemical reaction centre II abolishing the regulatory role of the Q-B site in the D1 protein degradation. Eur J Biochem. 1995;231:448–453. doi: 10.1111/j.1432-1033.1995.tb20718.x. [DOI] [PubMed] [Google Scholar]
  45. Zhu B, Choi D-W, Fenton R, Close TJ. Expression of the barley dehydrin multigene family and the development of freezing tolerance. Mol Gen Genet. 2000;264:145–153. doi: 10.1007/s004380000299. [DOI] [PubMed] [Google Scholar]

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES