Skip to main content
NCBI home page
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2006 Nov;44(11):4101–4112. doi: 10.1128/JCM.01196-06

Molecular Characterization of Novel G5 Bovine Rotavirus Strains

Sung-Hee Park 1, Linda J Saif 2, Cheol Jeong 1, Guem-Ki Lim 1, Sang-Ik Park 1, Ha-Hyun Kim 1, Su-Jin Park 1, You-Jung Kim 1, Jae-Ho Jeong 1, Mun-Il Kang 1, Kyoung-Oh Cho 1,*
PMCID: PMC1698340  PMID: 16928963

Abstract

Group A rotaviruses are a major cause of acute gastroenteritis in young children as well as many domestic animals. The rotavirus genome is composed of 11 segments of double-stranded RNA and can undergo genetic reassortment during mixed infections, leading to progeny viruses with novel or atypical phenotypes. The aim of this study was to determine if the bovine group A rotavirus strains KJ44 and KJ75, isolated from clinically infected calves, share genetic features with viruses obtained from heterologous species. All 11 genes sequences of the KJ44 and KJ75 strains were sequenced and analyzed. The KJ44 VP4 had 91.7% to 96.3% deduced amino acid identity to the bovine related P[1] strain, whereas the KJ75 strain was most closely related to the bovine related P[5] strain (91.9% to 96.9% amino acid identity). Both KJ44 and KJ75 strains also contained the bovine related VP3 gene. The remaining 9 segments were closely related to porcine group A rotaviruses. The KJ44 and KJ75 strains showed high amino acid identity to the G5 rotaviruses, sharing 90.4% to 99.0% identity. In addition, these strains belonged to the NSP4 genotype B, which is typical of porcine rotaviruses and subgroup I, with the closest relationship to the porcine JL-94 strain. These results strongly suggest that bovine rotavirus strains with the G5 genotype occur in nature as a novel G genotype in cattle as a result of a natural reassortment between bovine and porcine strains.

Group A rotaviruses are a major cause of acute gastroenteritis in young children and in a wide variety of domestic animals (5, 22, 63). These viruses, belonging to the Reoviridae family, are nonenveloped, icosahedral particles consisting of 11 segments of double-stranded RNA (dsRNA) enclosed in a triple-layered protein capsid (8). The two outer capsid proteins, VP7 and VP4, independently elicit neutralizing antibodies, which induce protective immunity and are used to classify the rotavirus strains into G (for glycoprotein) and P (for protease sensitive) sero- or genotypes (8). The inner capsid protein, VP6, bears subgroup (SG) specificities that allow the classification of group A rotaviruses into SGI, SGII, both SGI and SGII, or neither SG based on reactivity with the SG-specific monoclonal antibodies (8).

The serotypic and genotypic characterization of rotavirus strains is important for determining the extent of the diversity in circulating strains. In extensive serological and genomic studies, 15 G serotypes and 26 P genotypes have been established for rotaviruses of humans and animals thus far (17, 27, 39, 40, 42, 44, 52, 53). The most common rotavirus G serotypes found in humans are G1, G2, G3, and G9. Although it was originally believed that animal rotaviruses did not infect humans under natural conditions (34), the intensification of rotavirus surveillance, together with the development of better characterization methods for typing previously nontypeable strains, has resulted in the detection of animal-like rotavirus strains such as porcine-like G5 and bovine-like G6, G8, and G10 in humans with either sporadic or nonsporadic occurrences (1, 3, 4, 12, 14, 20, 23, 24, 28, 30, 38, 48, 49, 56). This suggests that interspecies transmission of rotaviruses, either as whole virions or by gene segment reassortment, takes place in nature at a relatively high frequency, particularly in developing countries, where humans and animals often live in close physical contact and mixed infections are more common (32, 38, 59, 60).

Occasional outbreaks of human-like types G1 and G9 (9, 51, 55) and bovine-like types G6, G8, and G10 (23, 43, 50, 51, 62) have been reported in pigs, although the main G serotypes are G3, G4, G5, and G11 (19). The predominating G and P types of bovine rotaviruses in the field are G6, G8, G10, P[1], P[5], and P[11] (41, 53, 58). Human-like P[14] and porcine-like P[7] virus strains have been reported for bovine rotaviruses (15, 18). These findings suggest that all possible combinations of G and P types can occur in the field. Therefore, studying the distribution of rotavirus G and P types among various animal species is important for understanding rotavirus ecology and the mechanisms by which rotaviruses evolve, cross the species barriers, exchange their genes during reassortment, and mutate via the accumulation of single-point substitutions and/or via genetic rearrangements. In this study, during the course of characterizing the P and G types of rotavirus strains isolated from calves with diarrhea in South Korea, two novel bovine rotavirus strains having bovine P types and VP3 genes but whose other 9 genes belonged to porcine lineages, were isolated for the first time. Our findings contribute to the growing body of evidence suggesting that interspecies transmission and reassortment events between rotaviruses can occur in nature.

MATERIALS AND METHODS

Origin of virus strains.

Rotavirus-positive samples were collected from calves during outbreaks of diarrhea that occurred in different herds in South Korea from 2004 to 2005. The samples were collected directly from the rectums of calves with diarrhea. The reverse transcription (RT)-PCR assay with the primer pair specific for the VP7 gene of rotavirus was used to screen for rotavirus in the diarrheic fecal samples (33).

The bovine rotavirus strains, KJ44 and KJ75, were isolated from the fecal samples of two calves with diarrhea, which occurred in different cattle farms. The viruses were adapted to grow in African green monkey kidney (TF-104) cell monolayers and were passaged eight times in the presence of 1 μg/ml porcine trypsin (1:250; GIBCO Invitrogen Corporation, California), including triple plaque purification prior to characterization.

RNA extraction.

Rotavirus dsRNA was extracted from the lysates of rotavirus-infected TF-104 cells using the SV total RNA isolation system reagent (Promega Corporation, Madison, WI) according to the manufacturer's instructions. The total RNA recovered was suspended in 50 μl of RNase-free water and stored at −80°C until used.

RT-PCR.

The primers for sequencing all of the segment genes of the bovine rotavirus strains KJ44 and KJ75 were previously described and are listed in Table 1. Using these different primer sets, the purified dsRNA was reverse transcribed and amplified by PCR using the method described elsewhere (19).

TABLE 1.

List of the oligonucleotide primers designed from various genes of the rotavirus strains used for sequencing

Target genea Primer name Sequence (5′-3′)b Region (nt) Size (bp) Reference
VP1 CAAAGAGCGTTCATGTCTTT (F) 2371-2390 359 43a
GGTAGTGTTGGCATAAATTT (R) 2729-2710
VP2 CCTCAATGGCGTACAGGAA (F) 13-20 598 43a
ATTCTCTACAGCCATATCTT (R) 610-591
VP3 CCTGGATGGAAATTAACATAT (F) 407-427 583 43a
ATGGTGTGTCCAATGGATCC (R) 989-970
VP4 Con3 TGGCTTCGCTCATTATAGACA (F) 11-32 876 19
Con2 ATTTCGGACCATTTATAACC (R) 887-868
VP6 VP6-F GACGGVGCRACTACATGGT (F) 747-766 379 31
VP6-R GTCCAATTCATNCCTGGTGG (R) 1126-1106
VP7 GCCTTTAAAAGCGAGAATTT (F) 1-20 1,062 33
GGTCACATCATACAACTCTA (R) 1062-1043
NSP1 VF5F GAAAAGTCTTGTGGAAGCCATG (F) 14-35 1,034 61
VFI3 CTTAATTCTAAAATCATTCCAT (R) 1048-1023
VFI1 ATGATTCACACTTTTCCATTAATG (F) 702-725 866
VF5R GGTCACATTTTATGCTGCCTA (R) 1567-1547
NSP2 VF3F GGCTTTTAAAGCGTCTCAGTC (F) 1-21 1,058 61
VF3R GGTCACATAAGCGCTTTCTATTC (R) 1058-1036
NSP3 VF2F ATGCTCAAGATGGAGTCTACT (F) 1-21 1,050 61
VF2R GGTCACATAACGCCCCTATAG (R) 1050-1030
NSP4 10Beg16 TGTTCCGAGAGAGCGCGTG (F) 16-34 725 37
10End722c GACCATTCCTTCCATTAAC (R) 740-722
NSP5 VF1F GGCTTTTAAAGCGCTACAGTG (F) 1-21 664 61
VF1R GGTCACAAAACGGGAGTGGG (R) 664-645
Open in a new tab
a

The positions of the consensus sequences are represented with reference to known sequences.

b

F, forward; R, reverse.

DNA sequencing and molecular characterization.

The RT-PCR products from each gene fragment were purified using a QIAEX II gel extraction kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions. DNA sequencing was carried out using an automated DNA sequencer (ABI system 3700; Applied Biosystems, Inc., Foster City, CA). Using the DNA Basic module (DNAsis MAX; MiraiBio, Alameda, CA), each gene sequence of the KJ44 and KJ75 strains was compared with those of the other known group A rotaviruses (Table 2).

TABLE 2.

GenBank accession numbers of the KJ44 and KJ75 strains and the reference group A rotavirus strains used in phylogenetic analysis

Gene Strain Rotavirustype Origin GenBankaccession no. Gene Strain Rotavirustype Origin GenBankaccession no.
VP1 KJ44 Bovine DQ494405 Lp14 P[15] Ovine L11599
KJ75 Bovine DQ494406 Eb P[16] Murine L18992
B4106 Human AY740741 993/83 P[17] Bovine D16352
Fin-G4-84-Major Human AJ272452 L338 P[18] Equine D13399
Gottfried Porcine M32805 MC345 P[19] Human D38054
KU Human AB022765 EHP P[20] Murine U08424
PO-13 Avian AB009629 Hg18 P[21] Bovine AF237665
RF Bovine J04346 160/01 P[22] Lapine AF526374
SA11 Simian X16830 A34 P[23] Porcine AY174094
TB-Chen Human AY787653 TUCH P[24] Simian AY596189
UKtc Bovine X55444 Dhaka6 P[25] Human AY773004
YM Porcine X76486 134/04-15 P[26] Porcine DQ061053
VP2 KJ44 Bovine DQ494409 VP6 KJ44 SG1 Bovine DQ494413
KJ75 Bovine DQ494410 KJ75 SG1 Bovine DQ494414
B4106 Human AY740741 A253 SG1 Porcine AF317122
Fin-G1-81-Major Human AJ287448 H1 SG1 Equine AF242394
Fin-G4-84-Major Human AJ287449 JL94 SG1 Porcine AY538664
HP140 Porcine AY601118 NCDV SG1 Bovine AF317127
KU Human AB022766 OSU SG1 Porcine AF317123
PO-13 Avian AB009630 RMC321 SG1 Human AF531913
RF Bovine X14057 S2 SG1 Human Y00437
RMC321 Human AY601115 SA11 SG1 Simian AY187029
SA11 Simian X16831 UK SG1 Bovine X53667
TB-Chen Human AY787652 WC3 SG1 Bovine AF411322
UK Bovine X52589 YM SG1 Porcine X69487
WA Human X14942 FI-14 SG12 Equine D00323
VP3 KJ44 Bovine DQ494411 116E SG2 Human U85998
KJ75 Bovine DQ494412 A411 SG2 Porcine AF317125
69M Human AY277916 E210 SG2 Avian U36240
96H026 Human AB045214 Gottfried SG2 Porcine D00326
116E Human AY028978 Wa SG2 Human K02086
A64 Human AY277920 EW Non-SG12 Murine U36474
B4106 Human AY740739 VP7 KJ44 G5 Bovine DQ494393
Ch2 Avian AY277923 KJ75 G5 Bovine DQ494394
DS1 Human AY277914 Wa G1 Human M21843
Hochi Human AY277915 S2 G2 Human M11164
KU Human AB022767 HCR3 G3 Human L21666
L26 Human AY277918 Gottfried G4 Porcine X06386
L338 Equine AY277922 JL94 G5 Porcine AY538665
OSU Porcine AY277921 OSU G5 Porcine X04613
PO-13 Avian AB009631 A34 G5 Porcine L35059
RF Bovine AY116592 A46 G5 Porcine L35054
ST3 Human AY277919 C134 G5 Porcine L35058
TB-Chen Human AY787654 134/04-15 G5 Porcine DQ062572
UKtc Bovine AY300923 H1 G5 Equine AF242393
Wa Human AY267335 IAL-28 G5 Human L79916
WI-61 Human AY277917 NCDV G6 Bovine M12394
YM1 Porcine AY300922 Ch2 G7 Avian X56784
VP4 KJ44 P[1] Bovine DQ494407 B37 G8 Human J04334
KJ75 P[5] Bovine DQ494408 116E G9 Human L14072
BRV033 P[1] Bovine U62155 B223 G10 Bovine X57852
NCDV P[1] Bovine M63267 YM G11 Porcine M23194
PTRV P[1] Simian AB180975 L26 G12 Human M58290
SA11 P[2] Simian M23188 L338 G13 Equine D13549
RRV P[3] Simian M18736 FI23 G14 Equine M61876
RV-5 P[4] Human M32559 Hg18 G15 Porcine AF237666
CJN-M P[5] Bovine D16351 NSP1 KJ44 Bovine DQ494396
P343 P[5] Porcine U35850 KJ75 Bovine DQ494395
UK P[5] Bovine M22306 69M Human D38151
OSU P[7] Porcine X13190 A44 Bovine U23726
Wa P[8] Human L34161 B4106 Human AY740735
K8 P[9] Human D90260 EHP Murine U08423
69M P[10] Human M60600 EW Murine U08428
KK3 P[11] Bovine D13393 FI23 Equine D38156
FI23 P[12] Equine D16342 Gottfried Porcine U08431
MDR13 P[13] Porcine L07886 H1 Equine U23728
MC35 P[14] Human D14032 K8 Human D38152
L26 Human D38150 SA11-C14 Simian AY065843
M37 Human U11491 ST3 Human X81436
NR1 Human AF506017 TB-Chen Human AY787649
OSU Porcine U08432 Wa Human X81434
PO-13 Avian AB009633 WI-61 Human X81437
RMC100 Human AY601546 NSP4 KJ44 Bovine DQ494397
RMC321 Human AF506292 KJ75 Bovine DQ494398
RMC/G7 Human AY601547 1076 A Human U59105
RRV Simian U08433 B223 A Bovine AF144805
SA11-4F Simian AF290884 BRV033 A Bovine AF144804
ST3 Human U11492 C-11 A Lapin AF144793
T152 Human AB097459 CP-1 A Bovine AF448854
TB-Chen Human AY787647 A34 B Porcine AF165219
UK Bovine L11575 A131 B Porcine AF144798
Wa Human L18943 OSU B Porcine D88831
YM Porcine D38154 RMC321 B Human AF541921
NSP2 KJ44 Bovine DQ494401 RMC B Human AY601543
KJ75 Bovine DQ494402 Wa B Human K02032
B4106 Human AY740734 AU1 C Human D89873
IS2 Human X94562 FRV384 C Feline AB048203
KU Human AB022770 EC D Murine U96337
NR1 Human AF506018 EHP D Murine U96336
OSU Porcine X06722 Ch-1 E Avian AB065287
PO-13 Avian AB009625 NSP5 KJ44 Bovine DQ494399
RF Bovine Z21640 KJ75 Bovine DQ494400
RMC100 Human AF506014 87H134 Human AB091353
RMC321 Human AF506293 96H070 Human AB045220
SA11 Simian J02353 221-04-19 Porcine DQ189252
TB-Chen Human AY787648 221-04-20 Porcine DQ189253
Wa Human L04534 470 Human AB008663
NSP3 KJ44 Bovine DQ494403 512B Human AB008660
KJ75 Bovine DQ494404 512C Human AB008662
69M Human X81425 CC86 Porcine U92798
B4106 Human AY740733 CN86 Human U92797
GO Avian X81430 ES51-03 Porcine DQ189248
hg17 Human X81427 K8 Human AB008655
I231 Human X81433 KU Human AB008661
IGV-F Human AF190172 M318 Human AB008658
IS2 Human X76645 M Human AF338244
KU Human AB022771 Mc323 Human U54772
MP409 Human AF141917 O264 Human AB008657
NCDV Bovine X81429 OSU Porcine X15519
NR1 Human AF506019 PO-13 Avian AB009627
OSU Porcine X81431 RF Bovine AF188126
PO-13 Avian AB009626 RMC321 Human AY033396
PRICE Porcine X81432 RMC437 Human AY803730
RF Bovine Z21639 RRV Simian AF306492
RMC100 Human AF506015 SA11 Simian AF306493
RMC321 Human AF541920 V51 Human X76782
RRV Simian X81426 V183 Human X76779
S2 Human X81428
Open in a new tab

Phylogenetic analysis.

Phylogenetic analyses based on the nucleotide and deduced amino acid alignments were constructed using the neighbor-joining method of Molecular Evolutionary Genetics analysis (MEGA, version 3.1) (36). A sequence similarity search for the KJ44 and KJ75 strains was performed using the LALIGN Query program of the GENESTREAM network server at the Institut de Génétque Humaine, Montpellier, France (http://www.eng.uiowa.edu/∼tscheetz/sequence-analysis/examples/LALIGN/lalign-guess.html).

RESULTS

Sequence analysis of VP7 of KJ44 and KJ75 strains.

The VP7 gene of the KJ44 and KJ75 strains was 1,062 nucleotides (nt) long, with two in-phase open reading frames beginning at nt 49 and 136, and a single TAG codon at nt 1027. These nucleotide sequences encoded a predicted protein of 326 or 297 amino acid (aa) residues. When comparing the complete inferred deduced amino acid sequence of the KJ44 and KJ75 strains with those of the rotavirus strains representative of all 15 G serotypes, KJ44 and KJ75 strains showed high amino acid identities to the G5 rotaviruses including the porcine JL94, OSU, A34, A46, C134, and 134/04-15 strains, the equine H1 strain, and the human IAL-28 strain, sharing 90.4% to 99.0% deduced amino acid identity between KJ44 and the other G5 rotaviruses, and 91.1% to 98.7% between KJ75 and the other G5 rotaviruses (Table 3). In contrast, the KJ44 and KJ75 strains had comparatively low deduced amino acid identities with the other known G serotypes: the KJ44 strain shared 56.4% to 87.4% identity and the KJ75 strain shared 57.6% to 88.0%. This indicates that the G serotype of the KJ44 and KJ75 strains belongs to serotype G5, which is grouped together with the porcine JL94, OSU, A34, A46, C134, and 134/04-15 strains, the equine H1 strain, and the human IAL-28 strain. Phylogenetic analysis also confirmed that the VP7 gene of the KJ44 and the KJ75 strains was closely related to those of the G5 strains and clustered closely with the porcine G5 strain OSU (Fig. 1). Moreover, nine hypervariable regions (VR1 to VR9) of the linear amino acid sequence of VP7 were highly conserved in the rotavirus strains within the serotype G5 but were highly divergent with that of the other serotypes (Fig. 2). The KJ44 and KJ75 strains also shared the conserved features of hydrophobic and hydrophilic regions with all the known serotype G5 strains but not with the other G serotypes (Fig. 2).

TABLE 3.

Nucleotide and amino acid sequence comparison of the VP7 of the KJ44 and KJ75 strains with the VP7 of the other G serotypes

Strain G type Origin % Identity with straina:
KJ44
KJ75
nt aa nt aa
Wa G1 Human 76.1 76.3 76.6 77.6
S2 G2 Human 71.9 72.3 72.2 73.3
HCR3 G3 Human 76.9 84.3 77.1 84.9
Gottfried G4 Porcine 75.4 73.3 76.0 74.2
JL94 G5 Porcine 99.0 99.0 99.3 98.4
OSU G5 Porcine 98.9 98.1 99.2 98.7
A34 G5 Porcine 94.1 95.3 94.5 96.0
A46 G5 Porcine 92.0 95.0 92.4 95.7
C134 G5 Porcine 87.0 91.7 87.3 95.0
134/04-15 G5 Porcine 90.8 93.8 91.2 94.4
H1 G5 Equine 95.7 96.9 96.0 97.5
IAL-28 G5 Human 88.8 90.4 89.1 91.1
NCDV G6 Bovine 75.1 79.7 75.4 80.6
Ch2 G7 Avian 64.1 56.4 64.7 57.6
B37 G8 Human 73.9 77.3 74.2 77.9
116E G9 Human 77.5 78.8 78.0 79.4
B223 G10 Bovine 73.6 76.9 73.9 77.6
YM G11 Porcine 82.2 87.4 82.5 88.0
L26 G12 Human 75.0 78.5 82.5 79.1
L338 G13 Equine 74.9 76.3 75.4 76.9
FI23 G14 Equine 76.2 77.9 76.5 78.5
Hg18 G15 Porcine 74.4 76.6 74.5 77.3
Open in a new tab
a

The nucleotide and amino acid sequence identities of VP7 between the KJ44 and KJ75 strains were 99.4% and 98.7%, respectively.

FIG. 1.

FIG. 1.

Open in a new tab

Phylogenetic tree of the VP7 protein of the KJ44 and KJ75 strains indicating its genetic relationship with other G genotypes.

FIG. 2.

FIG. 2.

Open in a new tab

Comparison of the deduced amino acid sequence of the VP7 protein of the KJ44 and KJ75 strains with that of selected rotavirus strains that are representative of each G genotype identified. The highly conserved proline (•), cysteine (▪), and deduced glycosylation (▾) sites are indicated. The hydrophilic (solid horizontal bar) and hydrophobic (dashed horizontal bar) regions are noted. The variable regions (VRs) are indicated by brackets above the sequences.

A comparison of the deduced amino acid sequences of the VP7 protein from the rotavirus strains of 15 different G serotypes showed that the proline residue at aa 58 of the KJ44 strain was replaced with leucine among 8 proline residues (aa 58, 86, 131, 167, 197, 254, 275, and 279), which are known to be conserved in the serogroup A rotaviruses. An additional 4 proline residues (aa 46, 66, 112, and 266) were found, which were relatively well conserved in the rotavirus strains within the G5 serotype. The seven cysteine residues (aa 82, 135, 165, 191, 207, 244, and 249) were conserved in all rotaviruses within the G serogroup except at aa 82 (C→S) for the KJ44 and KJ75 strains. The KJ44 and KJ75 strains along with other rotavirus strains within the serotype G5 contained two potential N-glycosylation sites between aa 69 to 71 and aa 147 to 149. The KJ44 and KJ75 strains showed a close relationship with the G5 porcine rotaviruses in these antigenic regions with only a few amino acid changes. Only 1 aa change in the antigenic region D (aa 65 to 76) and no changes in the major antigenic region A (aa 87 to 101), B (aa 143 to 152), C (aa 208 to 221), and F (aa 233 to 242) were observed when the KJ44 and KJ75 amino acid sequences were compared with the sequence of the G5 porcine strain, OSU (Fig. 2).

Sequence analysis of VP4 of KJ44 and KJ75 strains.

The deduced amino acid sequence for the VP4 gene encoding 290 aa representing the VP8* and the amino terminus of VP5* of the KJ44 strain was compared with that of rotavirus strains representative of all 26 P genotypes. The KJ44 VP4 had 91.7% to 96.3% deduced amino acid (90.4% to 96.7% nucleotide) identity to the P[1] rotaviruses, including the NCDV, BRV033, and PTRV strains, but less than 78.4% deduced amino acid (74.5% nucleotide) identity to representatives of the other P genotypes (Table 4). The sequence of the KJ75 strain was most closely related to that of the bovine strain VMRI of P[5] (95.2% nucleotide and 96.9% amino acid identity) and CJN-M of P[5] (95.3% nucleotide and 96.2% amino acid identity), while the identity with the other P genotypes ranged from 54.5% to 67.9% in nucleotide sequences and from 39.7% to 69.1% in amino acid sequences (Table 4). The potential trypsin cleavage sites, Arg-231, Arg-247, and Arg-241, of KJ44 were conserved, and the potential trypsin cleavage site of KJ75 were conserved in the VP8* of P[5] strains (data not shown). The prolines at residues 68, 71, 225, and 226 and the cysteine at position 216 in VP8* of the KJ44 and KJ75 strains were conserved (data not shown). Phylogenetic analysis showed that VP4 of the strain KJ44 clustered most closely with the bovine P[1] genotype NCDV strain and that of KJ75 clustered most closely with the bovine P[5] genotype 678 strain (Fig. 3).

TABLE 4.

Nucleotide and amino acid sequence comparison of the VP4 of the KJ44 and KJ75 strains with the VP4 of the other P genotypes

Strain P type Origin % Identity with straina:
KJ44
KJ75
nt aa nt aa
BRV033 P[1] Bovine 90.4 91.7 66.3 64.5
NCDV P[1] Bovine 96.7 96.2 67.6 67.8
PTRV P[1] Simian 94.4 93.6 66.0 63.9
SA11 P[2] Simian 74.5 76.3 67.9 66.4
RRV P[3] Simian 74.3 78.4 67.3 67.1
RV-5 P[4] Human 67.4 60.2 64.4 59.5
CJN-M P[5] Bovine 67.5 67.4 95.3 96.2
P343 P[5] Porcine 67.6 64.8 92.0 91.9
UK P[5] Bovine 65.7 67.4 89.8 92.4
VMRI P[5] Bovine 67.6 67.8 95.2 96.9
Gottfried P[6] Porcine 67.1 62.5 63.2 58.7
OSU P[7] Porcine 71.9 76.3 64.3 61.3
Wa P[8] Human 66.3 60.9 64.2 58.9
K8 P[9] Human 65.1 64.0 66.2 58.2
69M P[10] Human 71.3 72.6 65.7 67.8
KK3 P[11] Bovine 56.7 42. 54.5 41.0
FI23 P[12] Equine 71.8 71.5 65.5 66.4
MDR13 P[13] Porcine 68.6 64.0 65.4 57.5
MC35 P[14] Human 65.2 64.0 62.5 57.5
Lp14 P[15] Ovine 72.5 76.3 67.3 69.1
Eb P[16] Murine 63.8 59.5 61.2 54.4
993/83 P[17] Bovine 59.4 44.1 56.2 39.7
L338 P[18] Equine 75.6 77.0 67.6 66.0
MC345 P[19] Human 66.3 62.5 64.1 59.4
EHP P[20] Murine 68.3 71.5 63.7 64.0
Hg18 P[21] Bovine 70.1 67.4 65.3 61.3
160/01 P[22] Lapin 67.0 61.9 65.5 58.9
A34 P[23] Porcine 72.9 74.8 64.5 64.0
TUCH P[24] Simian 71.4 74.6 66.3 68.4
Dhaka6 P[25] Human 63.1 59.2 60.5 56.1
134/04-15 P[26] Porcine 72.3 71.5 67.7 64.7
Open in a new tab
a

The nucleotide and amino acid sequence identities of VP4 between the KJ44 and KJ75 strains were 66.3% and 66.4%, respectively.

FIG. 3.

FIG. 3.

Open in a new tab

Phylogenetic tree of the VP4 protein of the KJ44 and KJ75 strains indicating its genetic relationship with other P genotypes.

Sequence analysis of VP6 of KJ44 and KJ75 strains.

Comparative analysis of the deduced amino acid sequences of a fragment of VP6 (aa 241 to 367) showed a correlation with the SG specificity (31). The precise nature of the VP6 of the KJ44 and KJ75 strains was determined by sequencing the RT-PCR-amplified 379-bp fragment of the VP6 gene of the KJ44 and KJ75 strains, which is associated with SG specificity. The sequences of the KJ44 and KJ75 strains were 100% homologous for nucleotide and amino acids with each other. The deduced amino acid sequence of the VP6 gene had 100% amino acid identity (99.0% nucleotide identity) to SGI porcine rotavirus JL94 (G5 serotype), 89.6% to 91.2% amino acid identity (77.4% to 79.0% nucleotide identity) to the other bovine SGI strains, UK, WC3, and NCDV, and 89.6% to 98.4% amino acid identity (78.2% to 90.5% nucleotide identity) to the human SG1 strains, S2 and RMC321. Phylogenetic analysis also showed that the KJ44 and KJ75 strains were clustered with the porcine strain JL-94 within the major branch of the SGI rotaviruses (Fig. 4A). The bovine SG1 strains, UK, WC3, and NCDV, and the human SGI strains, S2 and RMC321, were clustered on a separate major branch.

FIG. 4.

FIG. 4.

Open in a new tab

Phylogenetic trees of the VP6 protein (A) and NSP4 protein (B) of the KJ44 and KJ75 strains indicating their genetic relationship with other selected group A rotavirus strains.

Sequence analysis of NSP4 of KJ44 and KJ75 strains.

Sequence analyses of the NSP4 gene identified at least five genetic groups (13, 26, 35). The NSP4 nucleotide sequences and the deduced amino acid sequences of the KJ44 and KJ75 NSP4 gene were compared with the published NSP4 sequences of the representative rotavirus strains to determine the genetic grouping of the KJ44 and KJ75 strains. The KJ44 and KJ75 strains showed 100% amino acid identity between themselves and 95.9% to 96.6% amino acid (89.8% to 94.2% nucleotide) identity with the NSP4 genotype B, where all the porcine rotaviruses are assigned (data not shown). In contrast, the KJ44 and KJ75 strains showed only 82.2% to 85.5% amino acid (76.6% to 82.2% nucleotide) identity with the NSP4 genotype A, to which all the bovine rotaviruses belonged. Phylogenetically, the KJ44 and KJ75 strains were clustered within NSP4 genogroup B, which included both the porcine and human rotavirus strains, and were distant from the other genogroups (Fig. 4B).

Sequence analysis of VP1, VP2, and VP3 of KJ44 and KJ75 strains.

The partial nucleotide and deduced amino acid sequences of the VP1, VP2, and VP3 genes of the KJ44 and KJ75 strains were obtained. The partial VP1 genes of the KJ44 and KJ75 strains revealed 100% amino acid identity to each other and shared a higher homology (83% to 94.3% nucleotide and 90.2% to 100% amino acid sequence) with the porcine strains YM and Gottfried and the human strain Fin-G4-84-Major but a lower homology with the bovine strains RF and UKtc (72.6% to 73.0% nucleotide and 78.1% to 78.9% amino acid identity). In the phylogenetic tree, the KJ44 and KJ75 strains were clustered with the porcine strains YM and Gottfried and the human strain Fin-G4-84-Major (Fig. 5A) but were distant from the other strains, including the bovine strains.

FIG. 5.

FIG. 5.

Open in a new tab

Phylogenetic trees of the VP1 protein (A), VP2 protein (B), and VP3 protein (C) of the KJ44 and KJ75 strains indicating their genetic relationship with other selected group A rotavirus strains.

The partial VP2 genes of the KJ44 and KJ75 strains were relatively closely related to the porcine strain HP140 (85.7% and 85.9% nucleotide identity and 94.9% amino acid identity) and the human strain RMC321 (86.7% and 87.0% nucleotide identity and 94.9% amino acid identity). The phylogenetic tree showed that the KJ44 and KJ75 strains belonged to the same lineage as the porcine and human strains but not the bovine strains (Fig. 5B).

However, the partial VP3 sequences of the KJ44 and KJ75 strains showed a high deduced amino acid sequence homology with the bovine strain RF (96.6% and 96.4% nucleotide and 99.4% and 98.6% amino acid identity) and the human strain 69M (92.9% and 92.8% nucleotide and 96.9% and 96.3% amino acid identity). The nucleotide and amino acid similarities among the KJ44 and KJ75 strains ranged from 99.8% of nucleotides and 99.4% of amino acids being fairly similar to each other. Among the strains compared in the phylogenetic tree, KJ44 and KJ75 were more closely related to the bovine strains RF and UKtc and the human strains 69M, DS1, and TB-Chen (Fig. 5C).

Sequence analysis of NSP1, NSP2, NSP3, and NSP5 of KJ44 and KJ75 strains.

A sequence comparison indicated that the NSP1 sequence of the KJ44 and KJ75 strains had the strongest relationship to the porcine rotavirus strain OSU (100% amino acid identity and 99.9% nucleotide identity) and showed close similarity (87.6% amino acid identity and 97.5% nucleotide identity) to the human rotavirus strain ST3. The phylogenetic tree was developed linking the KJ44 and KJ75 strains to the representative published porcine OSU strain as well as to the human strains ST3 and M37 (Fig. 6A).

FIG. 6.

FIG. 6.

Open in a new tab

Phylogenetic trees of the NSP1 protein (A) and NSP2 protein (B) of the KJ44 and KJ75 strains indicating their genetic relationship with other selected group A rotavirus strains.

The NSP2 amino acid sequence similarities of the KJ44 and KJ75 strains to the sequences of other recognized NSP2 genes were 57.1% to 99.6% amino acid identity and 62.5% to 99.6% nucleotide identity. The highest degree of 99.6% amino acid identity (99.6% nucleotide identity) was also found with the porcine rotavirus strain OSU (data not shown). Phylogenetic analysis confirmed that the KJ44 and KJ75 strains belonged to the same lineage as the porcine strain, OSU, and were distantly related to the bovine strain (Fig. 6B).

The nucleotide and the deduced amino acid sequences of the NSP3 gene of the KJ44 and KJ75 strains were compared with those of the other rotaviruses. The KJ44 and KJ75 strains showed the highest percentage of nucleotide and amino acid identity to the porcine strain OSU, sharing 99.7% nucleotide and 98.7% amino acid identity, respectively, and a high level of identity with the deduced proteins linked to the porcine OSU strain and the human strains in the phylogenetic tree (Fig. 7A). The nucleotide and amino acid sequence of the NSP5 of the KJ44 and KJ75 strains shared high nucleotide and amino acid identity with the porcine rotaviruses, ranging from 95.4% to 98.6% and 96.5% to 98.3%, and a high identity with the porcine strain, OSU, in the phylogenetic tree (Fig. 7B).

FIG. 7.

FIG. 7.

Open in a new tab

Phylogenetic trees of the NSP3 protein (A) and NSP5 protein (B) of the KJ44 and KJ75 strains indicating their genetic relationship with other selected group A rotavirus strains.

DISCUSSION

All 11 genomic segments encoding the VP1 to 4, 6, and 7 and NSP1 to 5 proteins of the bovine rotavirus strains KJ44 and KJ75, isolated from clinically infected calves, were sequenced, and the deduced amino acid sequences were compared with the other known sequences deposited in the GenBank database. Both sequence and phylogenetic analyses showed that these viruses were classified as belonging to the common bovine genotypes P[1] and P[5] and had bovine-related VP3. However, the other gene constellations analyzed were commonly identified in pigs. The fully sequenced VP7 gene of the KJ44 and KJ75 strains demonstrated the closest sequence homology to the porcine and equine G5 rotaviruses and only a slightly lower homology to the unusual human G5 strain (Table 3). Phylogenetic analysis of the VP7 gene of the KJ44 and KJ75 strains revealed that the VP7 gene of the KJ44 and KJ75 strains clustered most closely with the porcine G5 strain OSU (Fig. 1). Therefore, the VP7 sequence and phylogenetic analyses of the KJ44 and KJ75 strains suggest the porcine origin of these strains. Indeed, serotype G5 is one of the major porcine serotypes and has been associated with clinical infections in pigs and horses. Moreover, this serotype has recently emerged as an important cause of diarrhea in humans (23, 38, 40). Surveys conducted in Brazil have detected this serotype in symptomatic children, which suggests that it may be a significant cause of childhood infection (23, 38). To our knowledge, there is only one report that detected a bovine G5, P[1] rotavirus in a fecal sample from a calf with diarrhea in Brazil using nested multiplex RT-PCR (2). However, there is little information regarding the precise molecular nature of the bovine rotavirus carrying the G5 serotype. Therefore, this is the first report to detail the molecular nature of the bovine rotaviruses carrying the G5 serotype. These findings are expected to contribute to the growing body of evidence suggesting that interspecies transmission and reassortment events occur in nature.

Although rotaviruses have a wide range of hosts, individual strains appear to be host restricted, and direct interspecies transmission has never been documented (35). However, the segmented nature of the rotavirus genome provides a unique mechanism for reassortment between strains during mixed infections, suggesting that interspecies transmission and the reassortment of rotaviruses occur in nature (46, 47). Although the KJ44 and KJ75 strains were isolated in the fecal samples of calves with diarrhea, the precise mechanism for how the present reassortment rotaviruses infected and caused the symptomatic infection to calves is unclear. One possible explanation is that the VP4 protein might play a key role in the infection of the present reassortant rotaviruses in calves because VP4 is a cell attachment protein (11, 54). In this study, the P[1] and P[5] identified in each KJ44 and KJ75 strain are common genotypes of bovine rotaviruses. Overall, the bovine type VP4 of the KJ44 and KJ75 strains might provide an essential key for cell attachment and subsequent infection to calves.

VP6 is the major structural component of the rotavirus capsid and plays an important role in the virion structure because it interacts with both the outer capsid proteins, VP4 and VP7, and the core protein, VP2 (17). VP6 bears the SG specificities that allow the group of rotaviruses to be classified into SGI, SGII, both SGI and II, or neither SG based on their reactivity with SG-specific monoclonal antibodies (17). The rotaviruses most commonly found in animal rotaviruses belong to SGI (18, 25), while SGII is a common human rotavirus (6, 7, 16, 21, 29). In addition, it has been shown that substitutions at positions 296 to 299, 305, 306, 308, and 315 in the VP6 gene are capable of changing the reactivity to the SGI- and SGII-specific monoclonal antibodies (31). The deduced amino acid sequences of all the strains serologically determined to be SGI showed an Ala residue at position 305, which is characteristic of SGI (31). The residues 305 of the KJ44 and KJ75 strains were Ala, which is a pattern that is consistent with the SGI specificity. Phylogenetic analysis also showed that VP6 of both KJ44 and KJ75 strains belonged to SGI (Fig. 4A).

Studies of the genetic diversity of the rotavirus gene segment 10, encoding NSP4, have identified five genotypes (termed A to E) in human and animal rotaviruses with different G and P types (10, 12, 26, 45). The NSP4 genotypes appear to cluster according to the rotavirus host species, suggesting a conserved pattern of evolution within the species (10). It was reported that bovine NSP4 belongs to genotype A, whereas porcine NSP4 belongs to genotype B. However, in this study, the bovine strains KJ44 and KJ75 were identified as NSP4 genotype B, which is typical of porcine rotaviruses. This suggests that the genotype B strains, KJ44 and KJ75, are also likely to be the result of reassortment between a genotype B porcine strain and bovine strains.

In conclusion, we have identified bovine rotavirus strains that display an unusual combination of bovine VP3 and VP4 and porcine VP1, VP2, VP6, VP7, and NSP1 to 5 gene alleles. The findings of this study reinforce the hypothesis that there is a dynamic interaction between the rotaviruses of cows and pigs and that reassortment can result in the stable introduction and successful spread of porcine gene alleles into bovine rotaviruses. These findings confirm that the bovine rotavirus strains with the G5 serotype occur in nature as new G genotypes in cattle as a probable result of the natural reassortment between bovine and porcine strains.

Acknowledgments

This study was supported by grant no. RTI05-01-01 from the Regional Technology Innovation Program of the Ministry of Commerce, Industry and Energy (MOCIE), Republic of Korea. We acknowledge a graduate fellowship provided by the Korean Ministry of Education and Human Resources Development through the Brain Korea 21 project.

REFERENCES

  • 1.Adah, M. I., A. Wade, and K. Taniguchi. 2001. Molecular epidemiology of rotaviruses in Nigeria: detection of unusual strains with G2P[6] and G8P[1] specificities. J. Clin. Microbiol. 39:3969-3975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Alfieri, A. F., A. A. Alfieri, M. A. B. Barreiros, J. P. G. Leite, and L. J. Richtzenhain. 2004. G and P genotypes of group A rotavirus strains circulating in calves in Brazil, 1996-1999. Vet. Microbiol. 99:167-173. [DOI] [PubMed] [Google Scholar]
  • 3.Banyai, K., J. R. Gentsch, D. D. Griffin, J. L. Holmes, R. I. Glass, and G. Szucs. 2003. Genetic variability among serotype G6 human rotaviruses: identification of a novel lineage isolated in Hungary. J. Med. Virol. 71:124-134. [DOI] [PubMed] [Google Scholar]
  • 4.Beards, G., L. Xu, A. Ballard, U. Desselberger, and M. A. McRae. 1992. A serotype 10 human rotavirus. J. Clin. Microbiol. 30:1432-1435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bern, C., I. Martines, J. de Zoysa, and R. I. Class. 1992. The magnitude of the global problem of diarrhoeal disease: a ten-year update. Bull. W. H. O. 70:705-714. [PMC free article] [PubMed] [Google Scholar]
  • 6.Blackhall, J., R. Bellinzoni, N. Mattion, M. K. Estes, J. L. LaTorre, and G. Magnusson. 1992. A bovine rotavirus serotype 1: serological characterization of the virus and nucleotide sequence determination of the structural glycoprotein VP7 gene. Virology 189:833-837. [DOI] [PubMed] [Google Scholar]
  • 7.Chang, K. O., A. V. Parwani, and L. J. Saif. 1996. The characterization of VP7 (G type) and VP4 (P type) genes of bovine group A rotaviruses from field samples using RT-PCR and RFLP analysis. Arch. Virol. 141:1727-1739. [DOI] [PubMed] [Google Scholar]
  • 8.Ciarlet, M., and M. K. Estes. 2002. Rotaviruses: basic biology, epidemiology and methodologies, p. 2753-2773. In G. Bitton (ed.), Encyclopedia of environmental microbiology. John Wiley and Sons, New York, N.Y.
  • 9.Ciarlet, M., and F. Liprandi. 1994. Serological and genomic characterization of two porcine rotaviruses with serotype G1 specificity. J. Clin. Microbiol. 32:269-272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ciarlet, M., F. Liprandi, M. E. Conner, and M. K. Estes. 2000. Species specificity and interspecies relatedness of NSP4 genetic groups by comparative NSP4 sequence analyses of animal rotaviruses. Arch. Virol. 145:371-383. [DOI] [PubMed] [Google Scholar]
  • 11.Crawford, S. E., M. Labbe, J. Cohen, M. H. Burroughs, Y. Zhou, and M. K. Estes. 1994. Characterization of virus-like particles produced by the expression of rotavirus capsid protein in insect cells. J. Virol. 68:5945-5952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Cunliffe, N. A., J. S. Gondwe, R. L. Broadhead, M. E. Molyneux, P. A. Woods, J. S. Bresee, R. I. Glass, J. R. Gentsch, and C. A. Hart. 1999. Rotavirus G and P types in children with acute diarrhea in Blantyre, Malawi, from 1997 to 1998: predominance of novel P[6]G8 strains. J. Med. Virol. 57:308-312. [PubMed] [Google Scholar]
  • 13.Cunliffe, N. A., P. A. Woods, J. P. Leite, B. K. Das, M. Ramachandran, M. K. Bhan, C. A. Hart, R. I. Glass, and J. R. Gentsch. 1997. Sequence analysis of NSP4 gene of human rotavirus allows classification into two main genetic groups. J. Med. Virol. 53:41-50. [PubMed] [Google Scholar]
  • 14.Das, M., S. J. Dunn, G. N. Woode, H. B. Greenberg, and D. Rao. 1993. Both surface proteins (VP4 and VP7) of an asymptomatic neonatal rotavirus strain (I321) have high levels of sequence identity with the homologous proteins of a serotype 10 bovine rotavirus. Virology 194:374-379. [DOI] [PubMed] [Google Scholar]
  • 15.El-Attar, L., W. Dhaliwal, C. R. Howard, and J. C. Bridger. 2001. Rotavirus cross-species pathogenecity: molecular characterization of a bovine rotavirus pathogenic for pigs. Virology 291:172-182. [DOI] [PubMed] [Google Scholar]
  • 16.Elleman, T. C., P. A. Hoyne, M. L. Dyall-Smith, I. H. Holmes, and A. A. Azad. 1983. Nucleotide sequence of the gene encoding the serotype-specific glycoprotein of UK bovine rotavirus. Nucleic Acids Res. 11:4689-4701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Estes, M. K. 2001. Rotaviruses and their replication, p. 1747-1785. In P. M. Howley (ed.), Fields virology, 4th ed., vol. 2. Lippincott William & Wilikins, Philadelphia, Pa. [Google Scholar]
  • 18.Fukai, K., T. Saito, K. Inoue, and M. Sato. 2004. Molecular characterization of novel P[14], G8 bovine group A rotavirus, Sun9, isolated in Japan. Virus Res. 105:101-106. [DOI] [PubMed] [Google Scholar]
  • 19.Gentsch, J. R., R. I. Glass, P. Woods, V. Gouvea, M. Gorziglia, J. Flores, B. K. Das, and M. K. Bhan. 1992. Identification of group rotavirus gene 4 types by polymerase chain reaction. J. Clin. Microbiol. 30:1365-1373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gerna, G., A. Sarasini, M. Parea, S. Arista, P. Miranda, H. Brüssow, Y. Hoshino, and J. Flores. 1992. Isolation and characterization of two distinct human rotavirus strains with G6 specificity. J. Clin. Microbiol. 30:9-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gerna, G., A. D. Steele, Y. Hoshino, M. Sereno, D. Garcia, A. Sarasini, and J. Flores. 1994. A comparison of the VP7 gene sequences of human and bovine rotaviruses. J. Gen. Virol. 75:1781-1784. [DOI] [PubMed] [Google Scholar]
  • 22.Glass, R. I., J. S. Bressee, U. Parashar, M. Miller, and J. R. Gentsch. 1997. Rotavirus vaccines at the threshold. Nat. Med. 3:1324-1325. [DOI] [PubMed] [Google Scholar]
  • 23.Gouvea, V., L. de Castro, M. C. Timenetsky, H. Greenberg, and N. Santos. 1994. Rotavirus serotype G5 associated with diarrhea in Brazilian children. J. Clin. Microbiol. 32:1408-1409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Griffin, D. D., T. Nakagomi, Y. Hoshino, O. Nakagomi, C. D. Kirkwood, U. D. Parashar, R. I. Glass, and J. R. Gentsch. 2002. Characterization of nontypeable rotavirus strains from the United States: identification of a new rotavirus reassortant (P2A[6], G12) and rare P3[9] strains related to bovine rotaviruses. Virology 294:256-269. [DOI] [PubMed] [Google Scholar]
  • 25.Herring, A. J., N. F. Inglis, C. K. Ojeh, D. R. Snodgrass, and J. D. Menzies. 1982. Rapid diagnosis of rotavirus infection by direct detection of viral nucleic acid in silver-stained polyacrylamide gels. J. Clin. Microbiol. 16:473-477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Horie, Y., O. Masamune, and O. Nakagomi. 1997. Three major alleles of rotavirus NSP4 proteins identified by sequence analysis. J. Gen. Virol. 78:2341-2346. [DOI] [PubMed] [Google Scholar]
  • 27.Hoshino, Y., R. W. Jones, and A. Z. Kapikian. 2002. Characterization of neutralization specificities of outer capsid spike protein VP4 of selected murine, lapine, and human rotavirus strains. Virology 299:64-71. [DOI] [PubMed] [Google Scholar]
  • 28.Hoshino, Y., and A. Z. Kapikian. 2000. Rotavirus serotype: classification and importance in epidemiology, immunity, and vaccine development. J. Health Popul. Nutr. 18:5-14. [PubMed] [Google Scholar]
  • 29.Hussein, H. A., A. V. Parwani, B. I. Rosen, A. Lucchelli, and L. J. Saif. 1993. Detection of rotavirus serotypes G1, G2, G3 and G11 in feces of diarrheic calves by using polymerase chain reaction derived cDNA probes. J. Clin. Microbiol. 31:2491-2496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Iturriza Gomara, M., G. Kang, A. Mammen, A. K. Jana, M. Abraham, U. Desselberger, D. Brown, and J. Gray. 2004. Characterization of G10P[11] rotaviruses causing acute gastroenteritis in neonates and infants in Vellore, India. J. Clin. Microbiol. 42:2541-2547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Iturriza Gomara, M., C. Wong, S. Blome, U. Desselberger, and J. J. Gray. 2002. Molecular characterization of VP6 genes of human rotavirus isolates: correlation of genogroups with subgroups and evidence for independent segregation. J. Virol. 76:6596-6601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Jain, V., B. K. Das, M. K. Bhan, R. I. Glass, and J. R. Gentsch. 2001. Great diversity of group A rotavirus strains and high prevalence of mixed rotavirus infections in India. J. Clin. Microbiol. 39:3524-3529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kang, S. Y., S. J. Jeon, K. O. Chang, Y. H. Park, and W. Y. Kim. 1997. Cloning and nucleotide sequence analysis of VP7 genes of bovine rotaviruses insolated Korea. Korean J. Vet. Res. 37:367-374. [Google Scholar]
  • 34.Kapikian, A. Z., Y. Hoshino, and R. M. Chanock. 2001. Rotaviruses, p. 1787-1833. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed., vol. 2. Lippincott William & Wilikins, Philadelphia, Pa. [Google Scholar]
  • 35.Kirkwood, C. D., and E. A. Palombo. 1997. Genetic characterization of the rotavirus nonstructural protein, NSP4. Virology 236:258-265. [DOI] [PubMed] [Google Scholar]
  • 36.Kumar, S., K. Tamura, and N. Masatoshi. 2004. MEGA3: integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief. Bioinform. 5:150-163. [DOI] [PubMed] [Google Scholar]
  • 37.Lee, C. N., Y. L. Wang, C. L. Zao, and H. N. Chen. 2000. NSP4 gene analysis of rotaviruses recovered from infected children with and without diarrhea. J. Clin. Microbiol. 38:4471-4477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Leite, J. P. G., A. A. Alfieri, P. A. Woods, R. I. Glass, and J. R. Gentsch. 1996. Rotavirus G and P types circulating in Brazil: characterization by RTPCR, probe hybridization, and sequence analysis. Arch. Virol. 141:2365-2374. [DOI] [PubMed] [Google Scholar]
  • 39.Liprandi, F., M. Gerder, Z. Bastidas, J. A. Lopez, F. H. Pujol, J. E. Ludert, D. B. Joelsson, and M. Ciarlet. 2003. A novel type of VP4 carried by a porcine rotavirus strain. Virology 315:373-380. [DOI] [PubMed] [Google Scholar]
  • 40.Martella, V., M. Ciarlet, K. Banyai, E. Lorusso, A. Cavalli, M. Corrente, G. Elia, S. Aeista, M. Camero, C. Desario, M. Desario, A. Lavazza, and C. Buonavoglia. 2006. Identification of a novel VP4 genotype carried by a serotype G5 porcine rotavirus strain. Virology 346:301-311. [DOI] [PubMed] [Google Scholar]
  • 41.Martella, V., M. Ciarlet, R. Baselga, S. Arista, G. Elia, E. Lorusso, K. Banyai, V. Terio, A. Madio, F. M. Ruggeri, E. Falcone, M. Camero, N. Decaro, and C. Buonavoglia. 2005. Sequence analysis of the VP7 and VP4 genes identifies a novel VP7 gene allele of porcine rotaviruses, sharing a common evolutionary origin with human G2 rotaviruses. Virology 337:111-123. [DOI] [PubMed] [Google Scholar]
  • 42.Martella, V., M. Ciarlet, A. Camarda, A. Pratelli, M. Tempesta, G. Greco, A. Cavalli, G. Elia, N. Decaro, V. Terio, G. Bozzo, M. Camero, and C. Buonavoglia. 2003. Molecular characterization of the VP4, VP6, VP7, and NSP4 genes of lapin rotaviruses identified in Italy: emergence of a novel VP4 genotype. Virology 314:358-370. [DOI] [PubMed] [Google Scholar]
  • 43.Martella, V., A. Pratelli, G. Greco, M. Tempesta, M. Ferrari, M. N. Losio, and C. Buonavoglia. 2001. Genomic characterization of porcine rotaviruses in Italy. Clin. Diagn. Lab. Immunol. 8:129-132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43a.Maunula, L., and C. H. von Bonsdorff. 2002. Frequent reassortments may explain the genetic heterogeneity of rotaviruses: analysis of Finnish rotavirus strains. J. Virol. 76:11973-11800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.McNeal, M. M., K. Sestak, A. H. Choi, M. Basu, M. J. Cole, P. P. Aye, R. P. Bohm, and R. L. Ward. 2005. Development of a rotavirus-shedding model in rhesus macaques, using a homologous wild-type rotavirus of a new P genotype. J. Virol. 79:944-954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Mori, Y., M. A. Borgan, N. Ito, M. Sugiyama, and N. Minamoto. 2002. Diarrhea-inducing activity of avian rotavirus NSP4 glycoproteins, which differ greatly from mammalian rotavirus NSP4 glycoproteins in deduced amino acid sequence in suckling mice. J. Virol. 76:5829-5834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Nakagomi, O., and T. Nakagomi. 1991. Genetic diversity and similarity among ammalian rotaviruses in relation to interspecies transmission of rotavirus. Arch. Virol. 120:43-55. [DOI] [PubMed] [Google Scholar]
  • 47.Nakagomi, O., and T. Nakagomi. 2002. Genomic relationships among rotaviruses recovered from various animal species as revealed by RNA-RNA hybridization assays. Res. Vet. Sci. 73:207-214. [DOI] [PubMed] [Google Scholar]
  • 48.Nakata, S., Z. Gatheru, S. Ukae, N. Adachi, N. Kobayashi, S. Honma, J. Muli, P. Ogaja, J. Nyangao, E. Kiplagat, P. M. Tukei, and S. Chiba. 1999. Epidemiological study of the G serotype distribution of group A rotaviruses in Kenya from 1991 to 1994. J. Med. Virol. 58:296-303. [DOI] [PubMed] [Google Scholar]
  • 49.Palombo, E., R. Clark, and R. F. Bishop. 2000. Characterization of a “European- like” serotype G8 human rotavirus isolated in Australia. J. Med. Virol. 60:56-62. [PubMed] [Google Scholar]
  • 50.Pongsuwanna, Y., K. Taniguchi, M. Chiwakul, T. Urasawa, F. Wahasugi, C. Jayavasu, and S. Urasawa. 1996. Serological and genomic characterization of porcine rotaviruses in Thailand: detection of a G10 porcine rotavirus. J. Clin. Microbiol. 34:1050-1057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Rácz, M. L., S. S. Kroeff, V. Munford, T. A. R. Caruzo, E. L. Durigon, Y. Hayashi, V. Gouvea, and E. A. Palombo. 2000. Molecular characterization of porcine rotaviruses from the southern region of Brazil: characterization of an atypical genotype G[9] strain. J. Clin. Microbiol. 38:2443-2446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Rahman, M., J. Matthijnssens, S. Nahar, G. Podder, D. A. Sack, T. Azim, and M. Van Ranst. 2005. Characterization of a novel P[25], G11 human group a rotavirus. J. Clin. Microbiol. 43:3208-3212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Rao, C. D., K. Gowda, and B. S. Reddy. 2000. Sequence analysis of VP4 and VP7 genes of nontypeable strains identifies a new pair of outer capsid proteins representing novel P and G genotypes in bovine rotaviruses. Virology 276:104-113. [DOI] [PubMed] [Google Scholar]
  • 54.Ruggeri, F. M., and H. B. Greenberg. 1991. Antibodies to the trypsin cleavage peptide VP8 neutralize rotavirus by inhibiting binding of virions to target cells in culture. J. Virol. 65:2211-2219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Santos, N., R. C. C. Lima, C. M. Nozawa, R. E. Linhares, and V. Gouvea. 1999. Detection of porcine rotavirus type G9 and of a mixture of types G1 and G5 associated with Wa-like VP4 specificity: evidence for natural human-porcine reassortment. J. Clin. Microbiol. 37:2734-2736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Steele, A. D., L. Nimzing, I. Peenze, M. C. de Beer, A. Geyer, I. Angyo, and N. E. Gomwalk. 2002. Circulation of the novel G9 and G8 rotavirus strains in Nigeria in 1998/1999. J. Med. Virol. 67:608-612. [DOI] [PubMed] [Google Scholar]
  • 57.Reference deleted.
  • 58.Taniguchi, K., T. Urasawa, Y. Pongsuwanna, M. Choontanom, C. Jayavasu, and S. Urasawa. 1991. Molecular and antigenic analyses of serotypes 8 and 10 of bovine rotaviruses in Thailand. J. Gen. Virol. 72:2929-2937. [DOI] [PubMed] [Google Scholar]
  • 59.Timenetsky, M. D. C., N. Santos, and V. Gouvea. 1994. Survey of rotavirus G and P types associated with human gastroenteritis in Sao Paulo, Brazil, from 1986 to 1992. J. Clin. Microbiol. 32:2622-2624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Unicomb, L. E., G. Podder, J. R. Gentsch, P. A. Woods, K. Z. Hasan, A. S. G. Faruque, M. J. Albert, and R. I. Glass. 1999. Evidence of high-frequency genomic reassortment of group A rotavirus strains in Bangladesh: emergence of type G9 in 1995. J. Clin. Microbiol. 37:1885-1891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Varghese, V., S. Gas, N. B. Singh, K. Kojima, K. S. Bhattacharya, T. Krishnan, N. Kobayashi, and T. N. Naik. 2004. Molecular characterization of a human rotavirus reveals porcine characterization in most of the genes including VP6 and NSP4. Arch. Virol. 149:155-172. [DOI] [PubMed] [Google Scholar]
  • 62.Winiarczyk, S., P. S. Paul, S. Mummidi, R. Panek, and Z. Gradzki. 2002. Survey of porcine rotavirus G and P genotype in Poland and in the United States using RT-PCR. J. Vet. Med. 49:373-378. [DOI] [PubMed] [Google Scholar]
  • 63.Woode, G. N., and J. C. Bridger. 1975. Viral enteritis of calves. Vet. Rec. 96:85-88. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES