Abstract
The core lipopolysaccharide (LPS) of Klebsiella pneumoniae contains two galacturonic acid (GalA) residues, but only one GalA transferase (WabG) has been identified. Data from chemical and structural analysis of LPS isolated from a wabO mutant show the absence of the inner core β-GalA residue linked to l-glycero-d-manno-heptose III (l,d-Hep III). An in vitro assay demonstrates that the purified WabO is able to catalyze the transfer of GalA from UDP-GalA to the acceptor LPS isolated from the wabO mutant, but not to LPS isolated from waaQ mutant (deficient in l,d-Hep III). The absence of this inner core β-GalA residue results in a decrease in virulence in a capsule-dependent experimental mouse pneumonia model. In addition, this mutation leads to a strong reduction in cell-bound capsule. Interestingly, a K66 Klebsiella strain (natural isolate) without a functional wabO gene shows reduced levels of cell-bound capsule in comparison to those of other K66 strains. Thus, the WabO enzyme plays an important role in core LPS biosynthesis and determines the level of cell-bound capsule in Klebsiella pneumoniae.
Klebsiella pneumoniae is an important nosocomial pathogen (4), causing infections that may occur at almost all body sites, with the highest incidence in the urinary and the respiratory tracts. K. pneumoniae typically expresses smooth lipopolysaccharide (LPS) (1), LPS with O-antigen polysaccharide (O-PS), and antigenic capsular polysaccharide (K-PS) on its surface; both antigens, O-PS and K-PS, contribute to the pathogenesis of this species.
The K. pneumoniae core oligosaccharide (OS) LPS structure was determined for several O serotypes, and its inner core is similar to those of other Enterobacteriaceae (10). The K. pneumoniae inner core differs from those of Escherichia coli and Salmonella by the lack of l-glycero-d-manno-heptopyranose I and II (l,d-HepI and -II) phosphoryl modifications and by the presence of a d-glucose (Glc) residue linked by a β1,4 bond to l,d-HepI (2, 22, 25, 26). Two outer core types (1 and 2) were described in K. pneumoniae, both containing the disaccharide αGlcN-(1,4)-αGalA linked by an α1,3 linkage to l,d-HepII (2, 22, 25, 26). The type 1 core contains a 3-deoxy-d-manno-oct-2-ulosonic acid (Kdo) residue linked by an α2,6 bond to the GlcN residue (25, 26), while the type 2 core contains the disaccharide βGlc-(1,6)-αGlc linked by a α1,4 bond to the GlcN residue (22) (Fig. 1).
FIG. 1.
K. pneumoniae genetic organization of the core OS biosynthetic clusters and oligosaccharide core OS structures. (A) Diagram of wa biosynthetic gene clusters of K. pneumoniae core types 1 (strain C3) (21) and 2 (strain 52145) (22). Inner core genes (black arrows), outer core genes (gray arrows), and waaL (O-antigen-lipid A-core ligase) are shown. (B) The structure of K. pneumoniae type 2 core OS (22). Broken lines denote the truncation level for the different core biosynthetic gene mutations (6, 11-13, 21, 22). (C and D) Core OS structures from mutants 52145ΔwaaL wabO and 52145ΔwaaL waaQ. GalA, d-galacturonic acid; Glc, d-glucopyranose; GlcN, d-glucosamine; Hep, l-glycero-d-manno-heptose; Kdo, 3-deoxy-d-manno-octulopyranosonic acid.
The genes involved in the K. pneumoniae core LPS biosynthesis are clustered in a region (wa) of the K. pneumoniae chromosome, and two different clusters responsible for type 1 and type 2 core biosynthesis have been identified (21, 22) (Fig. 1). Furthermore, the functions in both inner and outer core biosynthesis of most of the transferases encoded by the wa genes were elucidated (6, 11-13, 21, 22) (Fig. 1). Among the proposed functions, only one GalA transferase was identified (12). By contrast, two GalA residues are found in the type 2 and some type 1 core OS (2, 22, 25, 26). Thus, either the previously identified GalA transferase (WabG) is bifunctional or a second GalA transferase remains to be identified.
In this work, we report the identification of the second GalA transferase involved in K. pneumoniae core OS biosynthesis and correlated this enzymatic activity with the pathogen virulence and the amount of cell-bound capsule.
MATERIALS AND METHODS
Bacterial strains, plasmids, and growth conditions.
Bacterial strains and plasmids used in this study are shown in Table 1. Bacterial strains were grown in LB broth and LB agar (16). LB media was supplemented with kanamycin (50 μg/ml), ampicillin (100 μg/ml), chloramphenicol (20 μg/ml), and tetracycline (25 μg/ml) when needed.
TABLE 1.
Bacterial strains and plasmids used in this study
| Strain or plasmid | Relevant characteristics | Reference or source |
|---|---|---|
| Strains | ||
| K. pneumoniae | ||
| C3 | Serovar O8:K66 (core type 1) | 18 |
| C3ΔwaaL | Nonpolar waaL mutant | 21 |
| C3ΔwaaQ | Nonpolar waaQ mutant | 21 |
| C3ΔwabO | Nonpolar wabO mutant | 21 |
| C3ΔwaaL waaQ | Double nonpolar waaL waaQ mutant | This study |
| C3ΔwaaL wabO | Double nonpolar waaL wabO mutant | This study |
| 52145 | Serovar O1:K2 (core type 2) | 17 |
| 52145ΔwaaL | Nonpolar waaL mutant | 12 |
| 52145ΔwaaQ | Nonpolar waaQ mutant | 21 |
| 52145ΔwabO | Nonpolar wabO mutant | 21 |
| 52145ΔwaaL waaQ | Double nonpolar waaL waaQ mutant | This study |
| 52145ΔwaaL wabO | Double nonpolar waaL wabO mutant | This study |
| E. coli | ||
| NovaBlue GigaSingles | Novagen | |
| BL21(λDE3) | Novagen | |
| Plasmids | ||
| pKO3ΔwabO | pKO3 containing the engineered wabO deletion | 21 |
| pKO3ΔwaaQ | pKO3 containing the engineered waaQ deletion | 21 |
| pGEM-T-Easy | PCR-generated DNA fragment cloning vector Ampr | Promega |
| pGEM-T-wabOC3 | pGEM-T containing the PCR-amplified wabOC3 gene | 21 |
| pGEM-T-wabO52145 | pGEM-T containing the PCR-amplified wabO52145 gene | This study |
| pET30 Xa/LIC | Vector for overexpressing His-tagged proteins | Novagen |
| pET30-wabO52145 | pET30 derivative overexpressing His6-WabO from strain 52145 | This study |
| pET30-wabOC3 | pET30 derivative overexpressing His6-WabO from strain C3 | This study |
General DNA methods.
Standard DNA manipulations were performed essentially as previously described (23). DNA restriction endonucleases, T4 DNA ligase, E. coli DNA polymerase (Klenow fragment), and alkaline phosphatase were used as recommended by the suppliers.
Mutant construction.
K. pneumoniae 52145 and C3 mutants were constructed by creating in vitro in-frame deletions of each gene (14). Each mutated gene was transferred to the chromosome by homologous recombination using the temperature-sensitive suicide plasmid pKO3 containing the counterselectable marker sacB (14). The plasmids containing the engineered in-frame deletions (pKO3ΔwabO and pKO3ΔwaaQ) (21) were transformed into K. pneumoniae C3ΔwaaL and 52145ΔwaaL by electroporation. Mutants were selected based on growth in LB agar containing 10% sucrose and the loss of the chloramphenicol resistance marker of the vector pKO3. The mutations were confirmed by sequencing the whole constructs in amplified PCR products.
Plasmid constructions for gene overexpression and complementation.
For wabO overexpression, the pET-30 Xa/LIC vector (Novagen) was used. The wabO gene was amplified from plasmid DNA (pGEM-T-wabOC3 and pGEM-T-wabO52145) (21) using the primers OFw (5′- GGTATTGAGGGTCGCATGAGTCAAACGCCTTTATTGAGC-3′) and ORv (5′- AGAGGAGAGTTAGAGCCGCGGGTTTTTGGT CTATCC-3′). ATG and CAT are start and stop codons, respectively, and underlined letters indicate single-stranded ends.
The 1,022-nt PCR products were electrophoresed in agarose, and the DNA bands were recovered and purified. Purified amplicons were treated with T4 DNA polymerase in the presence of 2.5 mM dGTP for 30 min at 22°C to generate single-stranded ends (underlined letters above) complementary to Xa/LIC single-stranded ends in pET-30 Xa/LIC. After the inactivation of the T4 DNA polymerase, each amplicon was mixed with the pET-30 XA/LIC vector, electroporated into NovaBlue GigaSingles competent cells, and plated on LB supplemented with kanamycin (30 μg/ml). Transformants were analyzed for proper construction of pET30-WabOC3 and pET30-WabO52145 by PCR amplification and sequencing. These plasmids express WabOC3 and WabO52145 with an in-frame His6 tag fused to their N termini.
Dot blot hybridization.
DNA samples were denatured by boiling for 5 min, chilled on ice for another 5 min, and spotted onto a Hybond-N1 (Amersham) nylon membrane. A wabO-specific, 2,072-bp DNA probe was prepared by amplification with oligonucleotides ORF10.A (5′-CCCGGACGGTGACTACCTGAT-3′) and ORF10.D (5′-TGGCGATCACCAGCGGGATCT-3′) and strain 52145 chromosomal DNA as the template. Probe labeling, hybridization, and detection were carried out using the enhanced chemiluminescence labeling and detection system (Amersham) according to the manufacturer's instructions.
LPS isolation and electrophoresis.
LPS was extracted from dry cells of K. pneumoniae grown in LB. The phenol-chloroform-light petroleum ether method (7) was used for strains producing rough LPS, while the phenol-water procedure (28) was used for the strains producing the O-antigen domain (smooth LPS). For screening purposes, LPS was obtained after proteinase K digestion of whole cells (9). LPS samples were separated by 10 to 20% gradient sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) or N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine (Tricine)-SDS-PAGE and visualized by silver staining as previously described (19, 24).
Preparation of oligosaccharides.
The LPS (20 mg) was hydrolyzed in 1% acetic acid (100°C; 120 min), and the precipitate was removed by centrifugation (8,000 × g, 30 min) and lyophilized to give lipid A (10 mg; 50% of LPS). The supernatant was evaporated to dryness, dissolved in water, and lyophilized (6 mg; 30% of LPS).
GC-MS analysis.
Partially methylated alditol acetates and methyl glycoside acetates were analyzed on an Agilent Technologies 5973N mass spectrometry (MS) instrument equipped with a 6850A gas chromatograph (GC) and a Zebron ZB-5 capillary column (Phenomenex; 30-mm length by 0.25-mm inside diameter; the flow rate of carrier gas [He]was 1 ml/min). Acetylated methyl glycoside analysis was performed with the following temperature program: 150° for 5 min, increases from 150° to 250° at 3°C/min, and 250° for 10 min. For partially methylated alditol acetates, the temperature program was 90°C for 1 min, increases from 90°C to 140°C at 25°C/min, increases from 140°C to 200°C at 5°C/min, increases from 200°C to 280°C at 10°C/min, and 280°C for 10 min.
Glycosyl and lipid analysis.
LPS (1 mg) was dried over P2O5 overnight and treated with 1 M HCl/CH3OH (1 ml) at 80°C for 20 h to analyze both glycosyl and fatty acid compositions as reported previously (12). Briefly, the crude reaction was extracted twice with hexane, and the two extracts were pooled, dried under a stream of air, and treated with acetic anhydride (100 μl) at 100°C for 15 min. The methanol layer was neutralized with Ag2CO3, dried, and acetylated. Acetylated fatty acids methyl esters were recovered in the hexane phase, whereas the methyl glycoside derivatives were in the methanolic one.
NMR spectroscopy.
1H nuclear magnetic resonance (1H-NMR) spectra were recorded in D2O at 400 MHz with a Bruker DRX 400 Avance spectrometer equipped with a reverse probe in the Fourier Tranform mode at 303 K. 13C and 1H chemical shifts were measured in D2O using acetone at δ values of 2.222 and 31.45 for proton and carbon, respectively, as internal standards. Two-dimensional homo- and heteronuclear experiments (correlated spectroscopy, total correlation spectroscopy, nuclear Overhauser effect spectroscopy, and heteronuclear single-quantum correlation [HSQC]) were performed using standard pulse sequences available in the Bruker software.
Mass spectrometry studies.
Reflectron matrix-assisted laser desorption-time of flight (MALDI-TOF) mass spectra were acquired for positive and negative ions on a Voyager DE-PRO instrument (Applied Biosystems) equipped with a delayed extraction ion source. The ion acceleration voltage was 25 kV, the grid voltage was 17 kV, the mirror voltage ratio was 1.12, and the delay time was 150 ns. Samples were irradiated at a frequency of 5 Hz by 337-nm photons from a pulsed nitrogen laser. Postsource decay was performed using an acceleration voltage of 20 kV. The reflectron voltage was decreased in 10 successive 25% steps. Mass calibration was obtained with a maltooligosaccharide mixture from corn syrup (Sigma). A solution of 2,5-dihydroxybenzoic acid in 20% CH3CN in water at a concentration of 25 mg/ml was used as the MALDI matrix. One microliter of matrix solution was deposited on the target, followed by loading of 1 μl of the sample. The droplets were allowed to dry at room temperature. Spectra were calibrated and processed under computer control by using the Applied Biosystems Data Explorer software.
Methylation analysis.
A core oligosaccharide sample (1 mg) obtained from 1% AcOH hydrolysis was first reduced with NaBH4 and then methylated using the Ciucanu-Kerek procedure (1). Linkage analysis was performed as reported previously (12). Briefly, the methylated sample was carboxymethyl reduced with lithium triethylborohydride (Super-Hydride, Aldrich), mild hydrolyzed to cleave ketosidic linkage, reduced by means of NaBD4, and then totally hydrolyzed, reduced with NaBD4, and finally acetylated as previously described.
Preparation of cell extracts containing WabO.
The His6-WabOC3 and His6-WabO52145 proteins were overexpressed from E. coli BL21(λDE3) containing pET30-WabOC3 and pET30-WabO52145, respectively. Both strains were grown for 18 h at 37°C in LB medium supplemented with kanamycin. The culture was then diluted to 1:100 in fresh medium, and incubation was continued until the culture reached an A600 of 0.6. The expression of the fusion proteins was induced by adding isopropyl-1-thio-β-d-galactopyranoside to the culture (1 mM final concentration) and an additional 3 h of incubation. The cells were harvested, washed once with 50 mM HEPES (pH 7.5), and then frozen until needed. The cell pellet was resuspended in 50 mM HEPES (pH 7.5) and sonicated on ice (for a total of 2 min using 10-s bursts, followed by 10-s cooling periods). Unbroken cells, cell debris, and the membrane fraction were removed by ultracentrifugation at 100,000 × g for 60 min. For comparison, a soluble extract was prepared using the same protocol from E. coli BL21(λDE3) containing the pET30 Xa/LIC vector. Protein expression was monitored by SDS-PAGE, and the protein contents of the pET30 Xa/LIC, pET30-WabOC3, and pET30-WabO52145 lysates were determined using the Bio-Rad Bradford assay as directed by the manufacturer.
Purification of His6-WabO.
Lysates containing the His6-WabOC3 or His6-WabOC52145 proteins were prepared as described above, except that the pellet was washed and resuspended in 20 mM sodium phosphate buffer (pH 7.4) containing 500 mM NaCl (buffer A). The His6-WabOC3 and His6-WabOC52145 were purified on an AKTA Explorer 100 system (Amersham Biosciences) using a 1-ml HiTrap chelating HP column (Amersham Biosciences) previously loaded with nickel sulfate and equilibrated with buffer A as recommended by the manufacturer.
The column was washed with 5 mM imidazole in buffer A for 10 column volumes, and a step gradient of 50 to 500 mM imidazole in buffer A was then applied. His6-WabO was eluted from the column at an imidazole concentration of 300 mM. The buffer was exchanged into 50 mM HEPES (pH 7.5) with 50 mM NaCl using a HiPrep 26/10 desalting column (Amersham Biosciences) according to the manufacturer's instructions. The protein was concentrated using a Centriplus 10-ml YM-30 centrifugal filter device (Amicon Bioseparations), and typical protein preparations contained yields of 0.07 g/ml, as determined by the Bio-Rad Bradford assay.
GalA transferase activity of WabO.
An assay was developed to test the ability of WabO to catalyze the incorporation of GalA from UDP-GalA into LPS. Assay reactions were carried out in a total volume of 0.02 ml containing 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 1 mM dithiothreitol, 1 mM UDP-GalA, and 0.003 mg of 52145ΔwaaL wabO mutant LPS as the acceptor. To start the reaction, either 0.2 mg (protein) of the soluble cell extracts from the BL21(λDE3)(pET30) control, BL21(λDE3)(pET30-WabOC3), or BL21(λDE3)(pET30-WabOC52145) or 0.004 mg of purified His6-WabOC3 or His6-WabO52145, was used. The mixture was incubated at 37°C for 2 h, and the reaction was then stopped by adding 0.08 ml of SDS-PAGE sample buffer and boiling for 10 min. Proteinase K diluted in SDS-PAGE sample buffer was then added to a final concentration of 0.8 mg/ml and incubated for 18 h at 55°C. The reaction products were visualized by SDS-PAGE.
Experimental infection models.
Two different models were used. For the mice septicemia model, albino Swiss female animals (5 to 7 weeks old, Harlan Ibérica, S.L.) were injected intraperitoneally with 0.2 ml of the test samples. Mortality was recorded up to 7 days postinjection. The 50% lethal dose (LD50) was calculated as previously described (20). The murine pneumonia model was performed as previously described (3). Briefly, ICR-CDI mice (Harlan Ibérica, S.L.) were anesthetized and intubated intratracheally with a blunt-end needle. Approximately 107 CFU of exponentially growing K. pneumoniae cells was suspended in 50 μl of phosphate-buffered saline and inoculated with the blunt-end needle. The mice were observed daily, and bacteremia was assessed at days 2, 4, and 6 by culturing blood obtained from the tail vein (approximately 20 μl) on LB plates. Lung and spleen tissues from surviving and dead animals were aseptically removed, homogenized, and plated on LB agar to quantify bacteria.
RESULTS
Identification of a new gene involved in core LPS biosynthesis.
The genes coding for enzymes involved in biosynthesis of core OS type 1 and 2 are found clustered (wa gene clusters) and have been identified and characterized from K. pneumoniae strains C3 and 52145, respectively. On the basis of genetic and/or biochemical evidence, the functions for 12 of the 13 genes of the two wa regions have been proposed (Fig. 1). Despite the presence of two GalA residues in the core OS from strains C3 (type 1 core) and 52145 (type 2 core), only one GalA transferase (WabG) has been proposed (12). The core OS from K. pneumoniae 889ΔwabG (type 1 core) was devoid of GalA residues, and its LPS lacked O antigen; thus, it was inferred that the WabG was involved in the transfer of GalA to the outer core OS (12). The inner core GalA residue should be transferred by the same WabG, assuming a bifunctional GalA transferase activity, or by a distinct GalA transferase.
Since the functions of 12 of the 13 genes in both waC3 and wa52145 clusters are known, we decided to determine whether the remaining gene of unknown function could encode a second GalA transferase. The candidate wabO52145 gene (previously reported as ORF10 or yibD-like) (21) could encode a 329-amino-acid residue protein: its start codon was located 29-bp downstream from wabH, and its stop codon was located 90 bp upstream of waaA (Fig. 1). A wabOC3 homologue was found in a similar position in K. pneumoniae C3 (Fig. 1) (22).
A previously constructed plasmid containing the wabO52145 gene (pGEM-T-wabO52145) (21) was used in an in vitro transcriptional/translation reaction with [35S]methionine. As a control, the vector pGEM-T was used. The radiolabeled proteins were resolved in SDS-PAGE, showing a specific radiolabeled polypeptide with a molecular mass of about 38 kDa (data not shown).
To determine the role of the wabO gene in core LPS biosynthesis, nonpolar wabO mutations were previously isolated (C3ΔwabO and 52145ΔwabO) (21), but initially no differences in LPS chemical composition were detected between the mutants and their isogenic wild-type strains. To facilitate the analysis of this gene function, double waaL wabO mutants were constructed and the gene's LPS was analyzed in 10 to 20% gradient Tricine-SDS-PAGE. LPS preparations from strains 52145ΔwaaL wabO (Fig. 2A, lane 2) and C3ΔwaaL wabO migrated slightly faster than LPS from strains 52145 and 52154ΔwaaL (Fig. 2A, lanes 1 and 0) and C3ΔwaaL, suggesting that a residue may be missing in the mutant LPS. Structural and genetic evidence suggested that the O antigen is linked to outer core Kdo and terminal Glc residue in LPS with type 1 and 2 core OS, respectively. Since single mutants 52145ΔwabO (Fig. 2B, lane 2) and C3ΔwabO still contain O antigen, we hypothesized that the putative residue lost in the wabO mutants resides in one of the minor inner core LPS branches. The transformation of the cloned wabOC3 or wabO52145 (pGEM-T-wabOC3 or pGEM-T-wabOC3) into C3ΔwaaL wabO or 52145ΔwaaL wabO restored the C3ΔwaaL or 52154ΔwaaL LPS migration pattern, respectively (Fig. 2A, lanes 4 and 5). These results demonstrate the presence of a new gene involved in core LPS biosynthesis in K. pneumoniae strains 52145 and C3.
FIG. 2.
Polyacrylamide gels showing the migration of LPS from wabO mutants and their complementation. Shown are 10 to 20% gradient SDS-Tricine-PAGE (A) and SDS-PAGE (B) analyses of LPS samples from K. pneumoniae. (A) K. pneumoniae 52145 (lane 1), 52145ΔwaaL (lane 0), 52145ΔwaaL wabO (lane 2), 52145ΔwaaL waaQ (lane 3), 52145ΔwaaL wabO complemented with wabO52145 (lane 4), and wabOC3 (lane 5). (B) K. pneumoniae 52145 (lane 1), 52145ΔwabO (lane 2), 52145ΔwaaQ (lane 3), 52145ΔwabO complemented with wabO52145 (lane 4), and wabOC3 (lane 5).
Characterization of the K. pneumoniae wabO52145 mutant core OS.
To determine the core OS changes produced by the wabO mutation, LPS was obtained from strain 52145ΔwaaL wabO by the phenol-chloroform-petroleum ether method. Composition analysis of acetylated methyl glycosides by GC-MS revealed the presence of l,d-Hep, GalA, Glc, GlcN, and Kdo. The structure of the OS was determined by MALDI-MS spectra and NMR experiments after mild acetic hydrolysis of LPS. For the positive ions, the MALDI-TOF spectrum of acetic acid hydrolysis product showed two main peaks at m/z 1,661.36 and 1,643.35, which correspond to the pseudomolecular ions (M+Na)+ and (M+Na-18)+, respectively. In particular, the signal at m/z 1,661.36 was in agreement with the calculated average molecular mass 1,638.42 Da of an OS structure with three hexoses, three heptoses, one hexuronic acid, one hexosamine, and one Kdo unit. The signal at m/z 1,643.35 is attributable to the same structure with the anhydro form of the terminal reducing end Kdo (27). From these data, it can be assumed that this OS lacks one GalA residue in comparison to the complete wild-type core OS (22) (Fig. 1). In order to test this hypothesis, a positive ion, postsource decay MALDI-TOF experiment was performed (see Table S1 in the supplemental material) which suggested that the wabO mutation precludes the nonreducing terminal galacturonic acid transfer. In order to definitively confirm this hypothesis, mono- and two-dimensional homonuclear (correlated spectroscopy, total correlation spectroscopy, and nuclear Overhauser effect spectroscopy) and heteronuclear (HSQC) NMR experiments were performed (see Table S2 in the supplemental material). The comparison of 1H-NMR anomeric region of LPS core OS with 52145ΔwaaL and 52145ΔwaaL wabO mutants (Fig. 3) clearly indicated the absence of the signal at 4.38 ppm of the β-GalA residue in the 52145ΔwaaL wabO mutant. In the same way, the lack of the β-GalA anomeric carbon signal in the 1H-13C HSQC experiment was also observed. In addition, methylation analysis showed the presence of terminal Glc, 6-linked Glc, 4-linked GalA, terminal Hep, 3,4-linked Hep, 3,7-linked Hep, and 4-linked GlcN units.
FIG. 3.
Anomeric region 1H-NMR spectra in D2O (HOD) of core OS. Anomeric region of spectra obtained from K. pneumoniae 52145ΔwaaL (a) and 52145ΔwaaL wabO mutants (b). The uppercase letters refer to carbohydrate residues as shown in the structure, and the Arabic numerals refers to protons in the respective residue. The appearance as a doublet of the anomeric proton of I residue is prevented by the low resolution of the NMR experiment and by the overlapping of the A4 proton.
These results indicated for the waaL wabO double mutant the core OS structure shown in Fig. 4.
FIG. 4.
Core OS structure for the waaL wabO double mutant.
Both K. pneumoniae type 1 and 2 core OS structures (Fig. 1) predict that waaQ mutations should be also devoid of the nonreducing terminal β-GalA residue in addition to l,d-Hep III. This was confirmed by MALDI-TOF analysis of the core OS of LPS obtained from 52145ΔwaaL waaQ (data not shown).
GalA tranferase in vitro assay.
The core OS structure determined from strain 52145ΔwaaL wabO lacks the terminal β-GalA residue, suggesting that the wabO gene could encode a specific GalA transferase involved in core OS biosynthesis. In agreement with this hypothesis, the wabO52145-encoded product contains a glycosyltransferase 2 domain and it was similar to glycosyltransferases involved in cell wall biogenesis in accordance with the Conserved Domain Database (15). In addition, according to the Carbohydrate Active Enzymes database (http://afmb.cnrs-mrs.fr/CAZY/fam/GT2.html), the WabO protein sequence is predicted to belong to the clan GT-A of inverting glycosyltransferases. Several proteins described as putative glycosyltransferases but of unknown function were found to be similar to WbO. Among these proteins, the most similar ones were those from Photorhabdus luminescens subsp. laumondii TT01 (59 and 75% of amino acid identity and similarity, respectively) and those of several strains of E. coli, Shigella boydii, Shigella dysenteriae, and Salmonella enterica subsp. enterica serovars Typhi, Paratyphi, Thyphimurium, and Choleraesuis (38 to 40 and 55 to 56% amino acid identity and similarity, respectively).
wabOC3 and wabO52145 were cloned into the pET30 Xa/LIC vector to express WabO proteins with an N-terminal His6 tag (His6-WabOC3 and His6-WabO52145). From E. coli BL21(λDE3)(pET30-wabOC3) and BL21(λDE3)(pET30-wabO52145), proteins of the expected molecular mass were observed by Coomassie blue-stained SDS-PAGE as well as by Western immunoblotting with antibodies specific for the His6 tag (data not shown). His6-WabOC3 and His6-WabO52145 were purified from the soluble fraction to near homogeneity by nickel chelation.
To test the GalA transferase hypothesis, an in vitro assay was developed. The assay takes advantage of the differences in 10 to 20% gradient Tricine-SDS-PAGE migrations between LPS samples from 52145ΔwaaL, 52145ΔwaaL waaQ (lacking the disaccharide β-GalA-l,d-Hep), and 52145ΔwaaL wabO (lacking the terminal β-GalA) (Fig. 1 and 5). The assay uses UDP-GalA as the substrate, LPS from either mutant, 52145ΔwaaL waaQ or 52145ΔwaaL wabO, as the acceptor, and cell extracts containing His6-WabO from either BL21(λDE3)(pET30-wabOC3) or BL21(λDE3)(pET30-wabO52145) or purified His6-WabO. As a control, cell extract from E. coli BL21(λDE3)(pET30) was used. Gradient Tricine-SDS-PAGE analysis of products from reactions using LPS from 52145ΔwaaL wabO and purified His6-WabO52145 migrated to the same extent as did LPS from 52145ΔwaaL (Fig. 5, lane 4). The same results were obtained when using purified His6-WabOC3 or cell extracts from E. coli BL21(λDE3)(pET30-wabO52145) or BL21(λDE3)(pET30-wabOC3) as the enzyme source (data not shown). Products from control reactions containing cell extract from E. coli BL21(λDE3)(pET30) migrated as the acceptor LPS (obtained from 52145ΔwaaL wabO) (Fig. 5, lane 5). By contrast, when using LPS from 52145ΔwaaL waaQ as the acceptor, none of the enzymatic sources assayed was able to modify its migration in gradient Tricine-SDS-PAGE (Fig. 5, lane 6) These results strongly suggest that the WabO protein catalyzes the incorporation into core OS of the nonreducing terminal β-GalA residue from UDP-GalA.
FIG. 5.
In vitro analysis by Tricine-SDS-PAGE of product reactions obtained with purified WabO. The LPS was separated on 10 to 20% gradient Tricine-SDS-PAGE gels and visualized by silver staining. Reactions were performed at 37°C for 2 h. LPS products from control reactions to which no protein was added contained LPS from mutants 52145ΔwaaL (lane 1), 52145ΔwaaL wabO (lane 2), and 52145ΔwaaL waaQ (lane 3). LPS products formed by the purified WabO obtained from E. coli BL21(λDE3)(pET30-wabO52145) from strain 52145 using UDP-GalA as donor and as the acceptor LPS from 52145ΔwaaL wabO (lane 4), and 52145ΔwaaL waaQ (lane 6). Products from control reaction containing cell extract from E. coli BL21(λDE3)(pET30) and 52145ΔwaaL wabO (lane 5).
The wabO mutation reduces K. pneumoniae virulence.
Virulence was tested in two different models: a septicemia model in mice, performed by intraperitoneal injection and recording mortality (LD50), and a murine model of pneumonia performed by intratracheal injection. In the septicemia model, LD50 values for O-PS-containing 52145ΔwabO and 52145waaQ mutants were similar to that of the O-PS-deficient 52145ΔwaaL mutant. These three mutants showed an approximately 3-log increase in LD50 values in comparison to that of the wild-type strain (Table 2). When the wild-type gene wabO52145 or waaQ52145 was introduced into the corresponding mutant strains, the strains recovered wild-type-level LD50 values. Neither 52145ΔwabO nor 52145waaQ transformed with the vector pGEM-T showed changes in LD50 levels (Table 2).
TABLE 2.
LD50 values of mice inoculated intraperitoneally with different K. pneumoniae strains
| Strain | LD50a |
|---|---|
| 51245 (O1:K2, wild type) | 102.1 |
| 52145ΔwabO | 104.8 |
| 52145ΔwabO+pGEMT | 104.9 |
| 52145ΔwabO+pGEMT-WabO | 102.7 |
| 52145ΔwaaQ | 104.9 |
| 52145ΔwaaQ+pGEMT | 105.0 |
| 52145ΔwaaQ+pGEMT-WaaQ | 102.6 |
| 52145ΔwabG | 107.5 |
| 52145ΔwabG+pGEMT | 107.7 |
| 52145ΔwabG+pGEMT-WabG | 102.4 |
| 52145ΔwaaL | 105.1 |
| 52145ΔwaaL+pGEMT | 105.7 |
| 52145ΔwaaL+pGEMT-WaaL | 102.3 |
LD50 values were calculated as previously described (20).
When the virulence of the strains was assayed in the murine pneumonia model [which depends of the K-PS antigen (3)], we obtained the results shown in Table 3. Mutant strains 52145ΔwabO and 52145ΔwaaQ were largely attenuated in this model, while the 52145ΔwaaL mutant and the wild-type strain showed similar values. The introduction of the corresponding wild-type gene(s) in the mutants rendered them as virulent as was the wild-type strain or the 52145ΔwaaL mutant. No changes in virulence were observed when the mutant strains were transformed with the plasmid vector alone.
TABLE 3.
Experimental pneumonia induced by different K. pneumoniae strains
| Strain | Mean inoculum (range) | Mean lung wt (g) | Mean log CFU/g | No. dead/total no. (%) | No. positive by culture/total no. (%) |
|---|---|---|---|---|---|
| 52145 | 1.0 × 107 (±1.4) | 0.29 ± 0.11 | 6.11 | 21/36 (58) | 19/36 (52) |
| 52145ΔwaaL | 1.0 × 107 (±2.1) | 0.35 ± 0.09 | 6.31 | 10/18 (55) | 10/18 (55) |
| 52145ΔwaaL+pGEM-T | 1.7 × 107 (±1.6) | 0.37 ± 0.05 | 6.42 | 10/18 (55) | 10/18 (55) |
| 52145ΔwaaL+pGEM-T-WaaL | 1.3 × 107 (±1.1) | 0.37 ± 0.11 | 6.09 | 10/18 (55) | 9/18 (50) |
| 52145ΔwabO | 1.9 × 107 (±1.3) | 0.25 ± 0.06 | 3.26 | 2/18 (11) | 2/18 (11) |
| 52145ΔwabO+pGEM-T | 1.7 × 107 (±1.1) | 0.24 ± 0.05 | 3.68 | 2/18 (11) | 2/18 (11) |
| 52145ΔwabO+pGEM-T-WabO | 1.6 × 107 (±1.3) | 0.32 ± 0.08 | 6.15 | 10/18 (55) | 10/18 (55) |
| 52145ΔwaaQ | 1.8 × 107 (±0.9) | 0.25 ± 0.07 | 3.11 | 2/18 (11) | 2/18 (11) |
| 52145ΔwaaQ+pGEM-T | 2.0 × 107 (±0.8) | 0.24 ± 0.08 | 3.60 | 2/18 (11) | 1/18 (6) |
| 52145ΔwaaQ+pGEM-T-WaaQ | 1.5 × 107 (±1.1) | 0.29 ± 0.06 | 6.22 | 10/18 (55) | 10/18 (55) |
| 52145ΔwabG | 1.9 × 107 | 0.18 ± 0.05 | <1.0 | 0/9 (0) | 0/9 (0) |
| 52145ΔwabG+pGEM-T | 1.8 × 107 | 0.16 ± 0.07 | <1.0 | 0/9 (0) | 0/9 (0) |
| 52145ΔwabG+pGEM-T-WabG | 2.2 × 107 (±0.5) | 0.27 ± 0.12 | 5.98 | 10/18 (55) | 9/18 (50) |
P was <0.01 for all comparisons (lung weight, log CFU per gram of lung, mortality, and blood or spleen positive cultures) between the strains by the two-tailed t test.
Phenotype of wabO and waaQ mutation in cell-bound capsule.
Comparison of the outer membrane protein profiles by SDS-PAGE between the wild-type strain (51245) and 52145ΔwabO or 52145ΔwaaQ or between 52145ΔwaaL and 52145ΔwaaL wabO 52145ΔwaaL waaQ mutants did not show differences in the outer membrane proteins (OmpK36, K35, OmpA-like, OmpK17 [2]). As an indirect measure of the outer membrane permeability function, the MICs for polymyxin B, rifampin, nalidixic acid, noboviocin, and vancomycin were determined. Again, no reproducible differences in the MICs were detected between wild-type strain (51245) and 52145ΔwabO or 52145ΔwaaQ or between 52145ΔwaaL and 52145ΔwaaL wabO 52145ΔwaaL waaQ mutants.
52145ΔwabO and 52145ΔwaaQ mutants showed about 90% reduction in cell-bound K2 capsule versus that of the wild-type strain in accordance with the mannose/KDO ratio of these two sugars specific for K2 and LPS, respectively. A similar percentage of K2 reduction monitored by the same method was observed between 52145ΔwaaL and 52145ΔwaaLwabO or 52145ΔwaaLwaaQ mutants. Table 4 shows that 52145ΔwabO, 52145ΔwaaQ, or corresponding waaL double mutants were still sensitive to K2 capsule-specific phage φ2, but showed a 5-log reduction in φ2 efficiency of plating in comparison to wild-type 52145 or 52145ΔwaaL mutant cells. In an enzyme linked immunosorbent assay using specific K2 capsular antibodies, the reactivity of 52145ΔwabO, 52145ΔwaaQ, or corresponding waaL double mutant cells was 10-fold lower that of the wild-type 52145 or 52145ΔwaaL mutant cells (Table 4). To determine whether the reduced amount of K2 capsule observed for wabO and waaQ mutations was a consequence of less polysaccharide being synthesized, the K2-PS like material was quantified in the spent culture supernatants. As can be observed in Table 4, the supernatants of 52145ΔwabO, 52145ΔwaaQ, or corresponding waaL double mutants showed a large amount of K2-PS reactivity in comparison with that of the supernatants of 52145 or 52145ΔwaaL mutant.
TABLE 4.
Sensitivity to bacteriophage φ2 and EIAs with anti-K2 capsule serum of K. pneumoniae 52145 and mutants deriveda
| Strain | Sensitivity to bacteriophage (φ2) (EOP) | Reactivity (A405) of anti-K2 capsule serum against:b
|
|
|---|---|---|---|
| Whole cellsc | Supernatantsd | ||
| 52145 | 1 | 1.76 ± 0.18 | 0.25 ± 0.04 |
| 52145ΔwaaO | 10−4.9 | 0.23 ± 0.07 | 1.12 ± 0.15 |
| 52145ΔwaaO (pGEM-T-wabO52145) | 0.98 | 1.64 ± 0.15 | 0.22 ± 0.05 |
| 52145ΔwaaQ | 10−4.9 | 0.25 ± 0.06 | 1.23 ± 0.19 |
| 52145ΔwaaQ (pGEM-T-waaQ52145) | 0.97 | 1.69 ± 0.13 | 0.24 ± 0.06 |
| 52145ΔwaaL | 0.99 | 1.72 ± 0.14 | 0.19 ± 0.03 |
| 52145ΔwaaL wabO | 10−5.1 | 0.24 ± 0.06 | 1.20 ± 0.11 |
| 52145ΔwaaL wabG | 0 | <0.1 | 0.087 ± 0.09 |
| 52145ΔwaaL wabO (pGEM-T-wabO52145) | 0.97 | 1.66 ± 0.14 | 0.23 ± 0.03 |
| 52145ΔwaaL wabO (pGEM-T-wabOC3) | 0.99 | 1.62 ± 0.13 | 0.21 ± 0.04 |
| 52145ΔwaaL waaQ | 10−5.0 | 0.24 ± 0.05 | 1.27 ± 0.10 |
| 52145ΔwaaL waaQ (pGEM-T-waaQ52145) | 0.98 | 1.60 ± 0.12 | 0.25 ± 0.07 |
EIA, enzyme immunoassay; EOP, efficiency of plating.
Data are means ± standard deviations derived from at least three independent experiments.
The amount of whole cells used was approximately 106 CFU.
Supernatants were obtained from overnight cultures centrifuged and filtered to be free of bacterial cells and 10-fold concentrated.
In addition, immunogold transmission electron microscopy studies using specific anti-K2 capsule serum with 52145Δ wabO whole cells showed a drastic reduction in the amount of cell-bound capsule in comparison to that of wild-type 52145 (Fig. 6). A similar result was obtained using double mutant 52145ΔwaaL wabO cells versus 52145ΔwaaL. Furthermore, the capsule polysaccharide of 52145Δ wabO linked to cells also shows a drastic reduction when analyzed by SDS-PAGE (Fig. 7). As expected, the introduction of either wabO52145 or wabOC3 restored wild-type levels of cell surface-associated K2 capsule (Table 4 and Fig. 6 and 7).
FIG. 6.
Immunogold transmission electron microscopy using specific K2 antiserum linked to protein A-10-nm gold particles with whole K. pneumoniae cells. Shown are wild-type 52145 (1), 52145Δ wabO (2), and 52145Δ wabO plus wabO52145 (3). Bar = 0.5 μm.
FIG. 7.
SDS-PAGE analysis of capsule polysaccharide linked to cells. Shown are wild-type 52145 (lane 1), 52145Δ wabO (lane 2), 52145Δ wabO plus wabO52145 (lane 3), and unencapsulated mutant derived from strain 52145 (lane 4) used as a negative control (22).
Distribution of the wabO gene among Klebsiella strains.
The knowledge of the wabO function prompted us to determine the presence of this gene in several K. pneumoniae strains producing either type 1 or 2 core LPS. A wabO-specific DNA probe was prepared (see Materials and Methods). The 2,072-bp DNA probe encompassed the 3′ end of wabH (from codon 196) wabO and the 5′ end of waaA (up to codon 150). The probe was initially used in a dot blot assay to screen genomic DNAs from Klebsiella strains, including all of the different O-antigen serotypes. One hundred Klebsiella strains were assayed [O1 (n = 34), O2 (n = 16), O2ac (n = 6), O3 (n = 18), O4 (n = 4), O5 (n = 13), O8 (n = 6), and O12 (n = 3) (8)]; 79 strains belonged to type core 1, 19 strains belonged to type core 2, and 2 strains were of undetermined LPS core. All of the Klebsiella genomic DNAs reacted with the probe, but one strain showed a weak hybridization. We reconfirmed these results by PCR amplification using the same oligonucleotides used for the probe construction and chromosomal DNA from each strain tested. In most (99) of them, amplicons of about 2,000 bp were obtained, in agreement the presence of wabO between wabH and waaA. The nucleotide sequence of these amplicons confirmed the presence of the wabO gene. In only one strain (O1:K66) was a PCR-generated amplicon of only 950 bp obtained. The nucleotide sequence of this amplicon showed a truncated version of wabO. This strain naturally devoid of the complete wabO, was analyzed to quantify K66 cell-associated capsule by different methods previously indicated (5), showing a highly reduced capsule. The introduction of the complete wabO gene into this strain, O1:K66, rescued the formation of a large capsule.
DISCUSSION
Since two GalA residues are found in K. pneumoniae producing either core OS type 1 or 2 but so far only one GalA transferase (WabG) has been identified the main purpose of this work was to determine whether a second GalA transferase was necessary for core OS biosynthesis. The function of one (WabO) of the thirteen genes of the wa cluster remained unknown thus being a good candidate to code for a second GalA transferase. The analysis of the core OS isolated from a 52145ΔwaaL wabO mutant by mass spectrometry and NMR techniques revealed that it lacked the terminal β-GalA residue relative to the wild-type core OS. The lack of this GalA residue produced a faster migrating LPS than that of 52145ΔwaaL in gradient Tricine-SDS-PAGE. In agreement with the proposed attachment of the O-PS to the outer core OS, a single wabO mutant still contained the O-PS domain.
An assay based on the differences in migration between LPS obtained from 52145ΔwaaL wabO and 52145ΔwaaL and using purified His6-WabO from either strain C3 or strain 52145 strongly suggests that WabO is a GalA transferase that adds the terminal β-GalA residue. In agreement with this function the WabO enzyme is unable to catalyze the transfer of GalA from UDP-GalA to LPS obtained from 52145ΔwaaL waaQ. LPS from 52145ΔwabG lacks both core OS GalA residues (12). By contrast, LPS from 52145ΔwabH contains both GalA residues (our unpublished results). Thus, it appears that the WabO GalA transferase cannot work until the α-GalA residue has been incorporated to the core OS by the action of the WabG enzyme.
The MICs for several hydrophobic antibacterials and the profile of outer membrane protein suggest that wabO mutation does not affect the outer membrane function in neither strain C3 nor strain 52145. By contrast, the wabO mutation reduces the virulence of K. pneumoniae 52145. The effects of the wabO and waaQ mutations are similar in reducing the virulence in an experimental septicemia model (Table 2). Since LPS from both wabO and waaQ mutants contains the O-PS domain, the effect of the lack of the terminal β-GalA residue does not decrease the virulence in this infection model. By contrast, the reduction in virulence is stronger for the wabO mutation than that for the waaL mutation in the pneumonia model (Table 3). In the pneumonia model, virulence depends on the K antigen (3), suggesting that the wabO mutation could affect the K phenotype. In agreement with this suggestion, mutants 52145ΔwabO, lacking the terminal β-GalA, and 52145ΔwaaQ, lacking the disaccharide β-GalA (1→7)-l,d-HepIII, showed important decrease in the amount of cell-associated K2-PS (Table 4). The explanation for this phenotype resides in the recently described interaction between K-PS and core OS negative charges (GalA residues), probably through divalent cations in K. pneumoniae (5).
In agreement with the presence of the terminal β-GalA residue in the OS of different K. pneumoniae strains, the wabO gene was detected by dot blotting samples with a specific DNA probe, subjecting them to PCR amplification, and comparing the nucleotide sequences to those of the amplicons in 99% of the strains of our lab collection. In only one strain (O1:K66) was a functional wabO absent. This strain can be considered a natural wabO mutant since the nucleotide sequence showed the presence of a 3′ truncated wabO homologue. This strain contains an unusually low level of cell-associated K66-PS, confirming a role for core OS terminal β-GalA residue in K-PS association to the cell surface. The introduction of wabO from strain 52145 or C3 raised fivefold the level of K66-PS associated to the cell surface.
K. pneumoniae strains producing core OS type 1 or 2 share 11 common genes, including the newly described here wabO. Most of them code for transferases involved in the addition to the core OS of Kdo (WaaA), l,d-HepI (WaaC), l,d-HepII (WaaF), l,d-HepIII (WaaQ), Glc (WaaE), α-GalA (WabG), and terminal β-GalA (WabO). Two enzymes are required for the incorporation of the core OS GlcN residue: a GlcNAc transferase (WabH) catalyzes the incorporation of GlcNAc into the growing core OS, and a deacetylase enzyme (WabN) converts the OS-GlcNAc residue into OS-GlcN. Type 1 and 2 wa gene clusters differ by two genes involved in the incorporations of the last two outer core OS residues, Kdo (WabI) and l,d-HepI (WabJ) in type 1 core and Glc-Glc disaccharide (WabK and WabM) in type 2 core (Fig. 1). The absence of the terminal β-GalA residue in wabO mutants constructed in the laboratory or isolated from nature leads to a drastic reduction in the level of cell-associated K-PS. This capsule deficiency correlates with a strong reduction in virulence in a pneumonia model.
Supplementary Material
Acknowledgments
This work was supported by Plan Nacional de I + D and FIS grants (Ministerio de Educación, Ciencia y Deporte and Ministerio de Sanidad, Spain) and Generalitat de Catalunya.
The structural determination is from M. M. Corsaro. S.F. and R.C. are predoctoral fellows from the University of Barcelona and N.J. is a predoctoral fellow from Generalitat de Catalunya. We also thank Maite Polo for her technical assistance.
Footnotes
Published ahead of print on 1 December 2006.
Supplemental material for this article may be found at http://jb.asm.org/.
REFERENCES
- 1.Ciucanu, I., and F. Kerek. 1984. A simple and rapid method for the permethylation of carbohydrates. Carbohydr. Res. 131:209-217. [Google Scholar]
- 2.Climent, N., S. Ferrer, X. Rubires, S. Merino, J. M. Tomás, and M. Regué. 1997. Molecular characterization of a 17-kDa outer-membrane protein from Klebsiella pneumoniae. Res. Microbiol. 148:133-143. [DOI] [PubMed] [Google Scholar]
- 3.Cortés, G., N. Borrell, B. Aztorza, C. Gómez, J. Sauleda, and S. Albertí. 2002. Molecular analysis of the contribution of the capsular polysaccharide and the lipopolysaccharide O side chain to the virulence of Klebsiella pneumoniae in a murine model of pneumonia. Infect. Immun. 70:2583-2590. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Emori, T. G., and R. P. Gaynes. 1993. An overview of nosocomial infections, including the role of the microbiology laboratory. Clin. Microbiol. Rev. 6:428-442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Fresno, S., N. Jiménez, L. Izquierdo, S. Merino, M. M. Corsaro, C. De Castro, M. Parrilli, T. Naldi, M. Regué, and J. M. Tomás. 2006. The ioinic interaction of Klebsiella pneumoniae K2 capsule and core lipopolysaccharide. Microbiology 152:1807-1818. [DOI] [PubMed] [Google Scholar]
- 6.Frirdich, E., E. Vinogradov, and C. Whitfield. 2004. Biosynthesis of a novel 3-deoxy-d-manno-oct-2-ulosonic acid-containing outer core oligosaccharide in the lipopolysaccharide of Klebsiella pneumoniae. J. Biol. Chem. 279:27928-27940. [DOI] [PubMed] [Google Scholar]
- 7.Galanos, C., O. Lüderitz, and O. Westphal. 1969. A new method for the extraction of R lipopolysaccharides. Eur. J. Biochem. 9:245-249. [DOI] [PubMed] [Google Scholar]
- 8.Hansen, D. S., F. Mestre, S. Albertí, S. Hernández-Alles, D. Alvarez, A. Domenech-Sánchez, J. Gil, S. Merino, J. M. Tomás, and V. J. Benedí. 1999. Klebsiella pneumoniae lipopolysaccharide O typing: revision of prototype strains and O-group distribution among clinical isolates from different sources and countries. J. Clin. Microbiol. 37:56-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hitchcock, P. J., and T. M. Brown. 1983. Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J. Bacteriol. 154:269-277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Holst, O. 2002. Chemical structure of the core region of lipopolysaccharides—an update. Trends Glycosci. Glycotech. 14:87-103. [Google Scholar]
- 11.Izquierdo, L., N. Abitiu, N. Coderch, B. Hita, S. Merino, R. Gavín, J. M. Tomás, and M. Regué. 2002. The inner-core lipopolysaccharide biosynthetic waaE gene: function and genetic distribution among some Enterobacteriaceae. Microbiology 148:3485-3496. [DOI] [PubMed] [Google Scholar]
- 12.Izquierdo, L., N. Coderch, N. Piqué, E. Bedini, M. Corsaro, S. Merino, S. Fresno, J. M. Tomas, and M. Regué. 2003. The Klebsiella pneumoniae wabG gene: its role in the biosynthesis of the core lipopolysaccharide and virulence. J. Bacteriol. 185:7213-7221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Izquierdo, L., S. Merino, N. Coderch, M. Regué, and J. M. Tomás. 2002. The wavB gene of Vibrio cholerae and the waaE of Klebsiella pneumoniae codify for a beta-1,4-glucosyltransferase involved in the transfer of a glucose residue to the l-glycero-d-manno-heptose I in the lipopolysaccharide inner core. FEMS Microbiol. Lett. 216:211-216. [DOI] [PubMed] [Google Scholar]
- 14.Link, A. J., D. Phillips, and G. M. Church. 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179:6228-6237. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Marchler-Bauer, A., J. B. Anderson, P. F. Cherukuri, C. DeWeese-Scott, L. Y. Geer, M. Gwadz, S. He, D. I. Hurwitz, J. D. Jackson, Z. Ke, C. J. Lanczycki, C. A. Liebert, C. Liu, F. Lu, G. H. Marchler, M. Mullokandov, B. A. Shoemaker, V. Simonyan, J. S. Song, P. A. Thiessen, R. A. Yamashita, J. J. Yin, D. Zhang, and S. H. Bryant. 2005. CDD: a conserved domain database for protein classification. Nucleic Acids Res. 33:D192-D196. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 17.Nassif, X., J. M. Fournier, J. Arondel, and P. J. Sansonetti. 1989. Mucoid phenotype of Klebsiella pneumoniae is a plasmid-encoded virulence factor. Infect. Immun. 57:546-552. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Οrskov, I., and F. Orskov. 1984. Serotyping of Klebsiella. Methods Microbiol. 14:143-164. [Google Scholar]
- 19.Pradel, E., and C. A. Schnaitman. 1991. Effect of rfaH (sfrB) and temperature on expression of rfa genes of Escherichia coli K-12. J. Bacteriol. 173:6428-6431. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Reed, L. J., and C. H. Muench. 1938. A simple method of estimating fifty percent end points. Am. J. Hyg. 27:493-497. [Google Scholar]
- 21.Regué, M., N. Climent, N. Abitiu, N. Coderch, S. Merino, L. Izquierdo, M. Altarriba, and J. M. Tomás. 2001. Genetic characterization of the Klebsiella pneumoniae waa gene cluster, involved in core lipopolysaccharide biosynthesis. J. Bacteriol. 183:3564-3573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Regué, M., L. Izquierdo, S. Fresno, N. Piqué, M. M. Corsaro, T. Naldi, C. de Castro, D. Waidelich, S. Merino, and J. M. Tomás. 2005. A second outer-core region in Klebsiella pneumoniae lipopolysaccharide. J. Bacteriol. 187:4198-4206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 24.Tsai, C. M., and C. E. Frasch. 1982. A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal. Biochem. 119:115-119. [DOI] [PubMed] [Google Scholar]
- 25.Vinogradov, E., M. Cedzynski, A. Ziolkowski, and A. Swierzko. 2001. The structure of the core region of the lipopolysaccharide from Klebsiella pneumoniae O3. 3-deoxy-α-d-manno-octulosonic acid (α-Kdo) residue in the outer part of the core, a common structural element of Klebsiella pneumoniae O1, O2, O3, O4, O5, O8, and O12 lipopolysaccharides. Eur. J. Biochem. 268:1722-1729. [DOI] [PubMed] [Google Scholar]
- 26.Vinogradov, E., and M. B. Perry. 2001. Structural analysis of the core region of the lipopolysaccharides from eight serotypes of Klebsiella pneumoniae. Carbohydr. Res. 335:291-296. [DOI] [PubMed] [Google Scholar]
- 27.Volk, V. A., N. L. Salomonsky, and D. Hunt. 1972. Xanthomonas sinensis cell wall lipopolysaccharide. I. Isolation of 4,7-anhydro- and 4,8-anhydro-3-deoxy-octulosonic acid following acid hydrolysis of Xanthomonas sinensis lipopolysaccharide. J. Biol. Chem. 247:3881-3887. [PubMed] [Google Scholar]
- 28.Westphal, O., and K. Jann. 1965. Bacterial lipopolysaccharide extraction with phenol-water and further application of the procedure. Methods Carbohydr. Chem. 5:83-91. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







