Prevalence of the −295 T-to-C promoter polymorphism of the interleukin (IL)-16 gene in periodontitis

Abstract

Interleukin (IL)-16 is involved in the regulation of the expression of several proinflammatory cytokines, i.e. tumour necrosis factor (TNF)α and interleukin (IL)-1β. The present study aimed to determine the prevalence of the −295 promoter polymorphism of the interleukin (IL)-16 gene in periodontal disease. A total of 123 patients with periodontal disease and 122 healthy controls were genotyped for the −295 IL-16 promoter polymorphism. Genotyping has been performed by PCR and restriction fragment length polymorphism (RFLP) analysis. The frequencies of alleles and genotypes as well of haplotypes within both study groups were compared using the Pearson χ² test at a level of significance of 5% (P < 0·05). The distribution of genotypes for the −295 IL-16 gene polymorphism showed no significant difference between periodontitis patients and healthy control subjects (P = 0·886). Also stratification analysis according to the disease severity revealed no significant difference regarding the genotype distribution among both study groups. Herein the IL-16 −295 gene polymorphism was not associated with chronic periodontitis.

Introduction

Interleukin (IL)-16 was originally designated as lymphocyte chemoattractant factor (LCF) [1]. The gene encoding for IL-16 was localized to chromosome 15q26.3 and subsequently genetic variants were identified by molecular cloning [2,3]. It is a proinflammatory cytokine that is expressed as a precursor protein consisting of 631 amino acids. The precursor molecule is cleaved by caspase 3 to the active cytokine that comprises the C-terminal 121 amino acids [4–6]. Upon stimulation by antigens interleukin-16 is produced and secreted by CD8+ cells, i.e. peripheral lymphocytes, eosinophils, mast cells, and epithelial cells [7–9].

Interleukin-16 activates T-cells, monocytes, macrophages, and dendritic cells mainly by binding to the CD4 molecule. Apart from the CD4 receptor mediated activation interleukin-16 was shown to stimulate these cells on a second yet not fully established way [10]. In addition to the activation of CD4+ T-cells interleukin-16 stimulates the production of different proinflammatory cytokines such as tumour necrosis factor (TNF)α, interleukin-1β, interleukin-6, and interleukin-15 by monocytes [10]. The expression of interleukin-16 has been found to be significantly elevated in several chronic inflammatory diseases, e.g. allergen-induced bronchial asthma, rheumatoid arthritis, and inflammatory bowel disease [11–13]. In contrast, the concentration of interleukin-16 was significantly lower at periodontitis affected sites as compared to healthy control samples [14]. Hence, lower expression of interleukin-16 was suggested to be associated with periodontal tissue breakdown.

Overall, functionally relevant polymorphisms have been identified in a magnitude of human cytokine genes, and the results of clinical studies have shown that these polymorphisms are associated with the manifestation of several chronic inflammatory diseases, e.g. Crohn's disease [15]. Recent models strongly suggest a genetic background also for the pathophysiology of chronic periodontitis [16]. Genetic factors were estimated to account for even 50% of the susceptibility for periodontitis [17]. The proinflammatory cascade along with the monocyte/macrophage system were assumed to play a key role in the development of the periodontitis associated inflammatory process [16]. Hence, to elucidate the genetic background polymorphisms that affect the production of proinflammatory cytokines appear to be excellent candidates.

Recently, a single nucleotide polymorphism within the promoter region of the human interleukin-16 gene has been described [18]. This polymorphism involves a T-to-C substitution at position −295 of the human interleukin-16 gene. The functional consequence of this polymorphism remains to be elucidated since it is unknown whether the T to C transition results in impaired or enhanced expression of interleukin-16.

It was the aim of the current study to assess the prevalence of the −295 T-to-C promoter polymorphism in chronic periodontitis.

Materials and methods

Patient population

This study conformed to the ethical guidelines of the Helsinki Declaration and was approved by the ethics committee of the Medical Faculty of the Ludwig-Maximilians University, Munich (No. 290/01). All participants provided written informed consent prior to their enrolment into the study. Severe medical disorders including diabetes mellitus, immunological disorders, increased risk for bacterial endocarditis and pregnancy lead to exclusion from the study.

Periodontitis group

The periodontitis group comprised a total of 123 patients from the Department of Periodontology, Ludwig-Maximilians University (Munich, Germany). The median age in the periodontitis group was 52·9 (± 12·3) years and the age ranged from 25 to 74 years. The male to female ratio was 54% to 46%. All individuals in the periodontitis group were adult Caucasians. The diagnosis of periodontitis was made on basis of a standardized protocol including the determination of:

• the probing pocket depth measured at 6 locations on each tooth (mesio-buccal, mid-buccal, disto-buccal, mesio-lingual, mid-lingual, disto-lingual) using a Michigan type ‘O’ probe;

• furcation defects using a Naber type probe;

• bleeding on probing classified as present or absent;

• bone loss as assessed by orthopantomographs.

The probing pocket depth was defined as the distance from the free gingival margin to the base of the periodontal pocket keeping the probe in line with the long axis of the tooth. Furcation defects were determined by horizontal probing from the furcation entrance to the base of the defect. The furcation involvement was classified according to the protocol of Nyman et al. [19].

All subjects included into the periodontitis group meet the following clinical and radiographic criteria:

• a total of at least 15 teeth in situ;

• ≥ 8 teeth with a probing pocket depth of ≥5 mm at least at one location and/or a furcation involvement ≥class II;

• bone loss of ≥3 mm around the affected teeth manifested as the distance between the alveolar crest and the cemento-enamel junction.

Individuals within the periodontitis group were classified as having mild, moderate, or severe chronic periodontitis according to the criteria as presented in Table 1. Subjects providing clinical, radiographic, and/or microbiologic symptoms of aggressive periodontitis according to the classification of Tonetti et al. [20] were excluded from the study.

Table 1. Criteria used for the stratification of periodontitis patients according to the severity of disease (mild, moderate, severe).

	Classification of periodontal disease
	Mild	Moderate	Severe
Maximum pocket depth	6 mm	8 mm	> 8 mm
Attachment loss > 30%	≤5 teeth	≤8 teeth	≥5 teeth
Attachment loss > 50%	–	≤5 teeth	≥8 teeth
No. of patients	36	52	35

Control group

The healthy control group comprised 122 unrelated Caucasian individuals providing no evidence for periodontitis. The absence of periodontal disease was determined according to the following criteria:

• a minimum of 22 teeth in situ;

• ≤1 site with probing pocket depth ≥3 mm;

• lack of any kind of furcation involvement at any tooth.

None of the healthy control subjects had a history of periodontitis or tooth loss due to nontraumatic tooth mobility. Within the control group the median age was 40·0 (± 13·3) years and the age ranged from 18 to 73 years.

Blood samples and DNA isolation

Peripheral venous blood samples of 9 ml were drawn from each individual by standard venepuncture. Each blood sample was collected in sterile tubes containing K₃EDTA solution. DNA was isolated using partly the QIAamp^, DNA Blood Midi Kit (Qiagen, Hilden, Germany), partly the salting out procedure [21].

Genotyping of the −295T-to-C polymorphisms within the interleukin-16 gene

The total volume of the PCR was 20 µl containing 100 ng of genomic DNA, 1 × PCR-buffer (Qiagen, Hilden, Germany), 0·5 mM of a dNTP-Mix (Sigma, Steinheim, Germany), 0·5 units of HotStarTaq™ DNA polymerase (Qiagen) and 5 pmol of each primer (TIB MOLBIOL, Berlin, Germany). The final concentration of MgCl₂ was 3 mM. The PCR comprised an initial denaturation step (95 °C for 15 min), 35 cycles (94 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s) and a final extension step (72 °C for 10 min). The primer sequences were CTCCACACTCAAAGCCTTTTGTTCC TATGA (sense) and CCATGTCAAAACGGTAGCCTCAAGC (antisense). The underlined base in the sense primer is different from the original sequence and serves for introduction of a recognition site for the restriction enzyme Ahd I. The total volume of the restriction assay was 25 µl containing 1 × NEBuffer 4, 10 Units of the enzyme Ahd I (New England Biolabs, Beverly, MD, USA) and 20 µl of the PCR product. The assay was incubated overnight at 37 °C and analysed by electrophoresis on a 2·5% agarose gel. In the case of an individual homozygous for the T allele, which is not digested by Ahd I, only the full-length PCR product of 280 bp was present. In the case of an individual homozygous for the C allele two fragments of 246 bp and 34 bp were generated. A heterozygous individual displayed all three fragments of 280 bp, 246 bp and 34 bp length. Additionally, the results of restriction analysis had been confirmed by sequencing three individuals displaying the three different genotypes. These three samples served as controls for each restriction assay. For sequencing a 495 bp PCR product including the −295 T→C polymorphism was generated using the primers CTGCCTTGTTTGTACGCTGCCCTATAC and ACTTGGTC TGTGGGCCGATACCAG. The PCR conditions were as described above except for an extension time of 60 s.

Statistical analysis

To compare the distribution of genotypes and the frequency of alleles for the −295 C-to-T polymorphism of the interleukin-16 gene among periodontitis patients and healthy controls the Pearson-Chi-square test was employed. The independent association between periodontitis and the IL-16 −295 C allele was assessed after adjustment for other confounding factors with multiple regression analysis and calculation of the adjusted odds ratios with 95% confidence intervals. The statistical significance of Hardy–Weinberg equilibrium was also tested by Pearson-χ² test. All statistical procedures were performed at a level of significance of 5% (P < 0·05).

Results

The allele frequencies and genotype distributions for the−295 T-to-C IL-16 gene polymorphism among both study groups are presented in Table 2. The genotype frequencies were in agreement with the Hardy–Weinberg equilibrium (P > 0·1 for all analyses). The −295 IL-16 C-allele was found in 44 (17·9%) of the periodontitis patients as compared to 48 (19·7%) of the healthy control individuals (P = 0·613). Homozygosity for the −295 IL-16 C-allele was found in 5 (4·1%) of the subjects with periodontitis and in 6 (4·9%) of the control subjects (P = 0·886). The genotype distribution and allele frequencies were also not different after stratification of subjects according to the gender (Table 3).

Table 2. Allele frequencies and distribution of genotypes for the −295 T-to-C polymorphism of the interleukin-16 gene among periodontitis patients and healthy controls.

	Frequency of alleles and genotype distribution
	Alleles				Genotype
	IL16 −295C	IL16 −295T	P-value	OR (CI)	CC	CT	TT	P-value
Periodontitis
Total	44 (17·9%)	202 (82·1%)	0·613	1·12 (0·66–1·66)	5 (4·1%)	34 (27·6%)	84 (68·3%)	0·886
Mild	17 (23·6%)	55 (76·4%)	0·468	0·79 (0·48–1·69)	3 (8·3%)	11 (30·6%)	22 (61·1%)	0·717
Moderate	19 (18·3%)	85 (81·7%)	0·761	1·10 (0·57–1·88)	2 (3·8%)	15 (28·8%)	35 (67·4%)	0·945
Severe	8 (11·4%)	62 (88·6%)	0·112	1·90 (0·59–2·94)	0 (0·0%)	8 (22·9%)	27 (77·1%)	0·261
Controls	48 (19·7%)	196 (80·3%)	–	–	6 (4·9%)	36 (29·5%)	80 (65·6%)	–

P-values as analysed with the Pearson-χ² test (P < 0·05).

Table 3. Allele frequencies and distribution of genotypes for the −295 T-to-C polymorphism of the interleukin-16 gene among periodontitis patients stratified according to the gender of subjects.

	Frequency of alleles
	Periodontitis (%)	Control (%)	P-value*†	Odds ratio	Confidence interval
Total
IL16 −295 C	44 (17·9)	48 (19·7)
IL16 −295 T	202 (82·1)	196 (80·3)
Total	246 (100)	244 (100)	0·613	1·12	0·66–1·66
Female
IL16 −295 C	18 (14·8)	31 (20·7)
IL16 −295 T	104 (85·2)	119 (79·3)
Total	122 (100)	150 (100)	0·207	1·51	0·63–2·26
Male
IL16 −295 C	26 (21·0)	17 (18·1)
IL16 −295 T	98 (79·0)	77 (81·9)
Total	124 (100)	94 (100)	0·596	0·83	0·47–1·82

^*P-values as analysed with the Pearson-χ² test (P < 0·05).

^†periodontitis versus control

Discussion

According to recent pathogenetic models genetic factors causing imbalances in pro- and anti-inflammatory cytokine production along with an ineffective immune response against bacterial invasion were suggested to increase the susceptibility for periodontitis [22]. Among others interleukin-16 was shown to be involved in the regulation of the expression of several proinflammatory cytokines by cells of the monocyte/macrophage system [16]. Particularly monocytes were suggested to play a key role in the mediation of the periodontitis associated tissue destruction [23].

Although it remains unknown whether the −295 T-to-C promoter polymorphism in the human interleukin-16 gene leads to an increasing or reduced expression of interleukin-16 it was recently shown to be associated with several chronic inflammatory conditions, i.e. Crohn's disease or allergic contact dermatitis [15,24]. Moreover, the carriage of the IL16−295 C allele has been proposed to be associated with pro-inflammatory effects. According to this model the transition from thymidine to cytosine at position −295 of the interleukin-16 gene leads to an impaired control of the interleukin-16 expression by interleukin-10 [24]. Notably, both interleukin-10 and interleukin-16 have previously been shown to be lower expressed in periodontitis as compared to healthy control samples [14,25].

Overall, the prevalence of the −295 C-allele for Caucasian healthy control subjects was reported to lie between 14.5% and 22.1%[15,24]. Herein the frequency of the C-allele was roughly 19.7% within the control group indicating that our findings are in accordance with the literature data. The findings of the present study, however, revealed no significant difference of the prevalence of the −295 T-to-C mutation of the human interleukin-16 gene between the periodontitis group and the healthy control group. Both, the distribution of genotypes and the frequency of the alleles were almost equal among the two study groups. Moreover, also after stratification of periodontitis patients according to their respective disease severity the −295 T-to-C promoter polymorphism showed no association with the susceptibility for periodontitis.

Several reasons might be responsible for the lack of association between periodontitis and the −295 T-to-C promoter polymorphism herein. First, the various entities of periodontal disease are still only very poorly defined based on clinical and radiographic criteria [20]. Particularly, it is generally accepted that there are still only insufficient diagnostic criteria available to reliably differentiate between chronic and aggressive periodontitis [26]. Hence, the periodontitis group as used herein might comprise subjects with different disease entities although the selection of patients was based upon generally accepted diagnostic criteria defining chronic periodontitis. Moreover, since some of the patients that have been currently classified as having chronic periodontitis might develop signs of aggressive periodontitis in the future. However, comparing the both study groups an almost equal frequency of alleles and genotypes for the −295 T-to-C polymorphism was found for periodontitis patients and healthy control subjects. Hence, it can be assumed that further investigations using different selection criteria might also not reveal any kind of association between the −295 T-to-C polymorphism and chronic periodontitis.

Second, despite the hypothesis that periodontitis has a genetic background it appears likely that epigenetic factors might be of pathogenetic importance as well resulting in a multifactorial complex disease entity [27]. Moreover, the inheritance of periodontitis might involve multiple genes. For the delineation of the genetic background the analysis of single genetic polymorphisms might, thus, be an insufficient tool. As previously done in other complex genetic disorders, e.g. Crohn's disease, linkage analysis probably comprises an attractive approach for future studies.

In conclusion, the present data revealed no association between the −295 T-to-C promoter polymorphism of the human interleukin-16 gene and the susceptibility to chronic periodontitis.