Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Feb 21.
Published in final edited form as: Neurosci Lett. 2006 Dec 15;413(3):196–201. doi: 10.1016/j.neulet.2006.11.046

Effects of carbonic anhydrase VIII deficiency on cerebellar gene expression profiles in the wdl mouse

Jian Yan *, Yan Jiao †, Feng Jiao †, John Stuart *, Leah Rae Donahue §, Wesley G Beamer §, Xinmin Li , Bruce A Roe Δ, Mark S LeDoux ‡, Weikuan Gu †,✉
PMCID: PMC1865515  NIHMSID: NIHMS18866  PMID: 17174474

Abstract

Recently, the waddles (wdl) mouse was identified as a carbonic anhydrase VIII (Car8) mutant. The mutation is associated with marked deficiency of Car8, an inositol triphosphate receptor 1-binding protein expressed at high levels in cerebellar Purkinje cells. To help unravel the molecular aberrations contributing to motor dysfunction in wdl mice, cerebellar gene expression profiles were examined in the mutants and their wild-type littermates. Genes involved in signaling, cell division, zinc-ion binding, synapse integrity and plasticity were down-regulated in wdl mice. Several of the up-regulated genes encode proteins that function in the Golgi apparatus which suggests that Car8 deficiency has important effects on synaptic vesicle formation and transport.

Keywords: Carbonic anhydrase VIII, Dystonia, Ataxia, Cerebellum, Calcium signaling, Inositol triphosphate

Introduction

The waddles (wdl) mouse is an autosomal recessive mutant that exhibits ataxia and dystonia. Like several other murine models of ataxia and dystonia, the wdl mouse exhibits no gross morphological or histological abnormalities of the nervous system [10, 21, 26, 44], The wdl mouse harbors a loss-of-function mutation in the carbonic anhydrase VIII (Car8) gene (Car8). Car8 is an acatalytic member of carbonate dehydratase family. The sole known function of Car8 is to inhibit inositol 1, 4, 5-trisphosphate (IP3) binding to IP3 receptor 1 (Ip3r1) [17], which plays a critical role in the modulation of intracellular calcium (Ca2+) signaling [19]. It is, therefore, quite possible that altered Ca2+ signaling may, at least partially, underlie the motor phenotype observed in the wdl mice. Ca2+ signaling is involved in the regulation of a wide variety of cellular activities including synapse recycling, proliferation, fertilization, learning and memory, long term potentiation, long term depression, apoptosis, contraction, metabolism, and modulation of other signaling systems. To investigate the molecular abnormalities associated with the unique motor syndrome of wdl mice, we performed genome-wide cerebellar gene expression profiling using Affymetrix oligonucleotide microarrays. We found that many genes involved in synaptogenesis, synaptic vesicle formation and transport, cellular proliferation and differentiation, and signal transduction were dysregulated in wdl mice.

Materials and methods

Mice were housed in animal care facilities at the University of Tennessee Health Science Center under conditions of 14 hr light/10 hr darkness at an ambient temperature of 20 ± 2°C with relative humidity of 30–60%. Experimental animal procedures and mouse husbandry were performed in accordance with the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals and approved by the UTHSC Institutional Animal Care and Use Committee. For the Affymetrix microarray experiments, individual cerebella from 2-week female homozygous wdl mice (N = 3) and age-matched, wide-type (+/+) littermates (N = 3) were employed for each array. For relative quantitative real-time RT-PCR (QRT-PCR) validation of a small subset of differentially-expressed transcripts, another panel of individual cerebella (N = 9) from either wild-type or homozygous wdl mice were pooled to yield 3 replicates for each group. Total RNA was extracted using Trizol reagent (Life Technologies). RNA quality was checked with an Eppendorf BioPhotometer. Microarray hybridization and data generation were performed according to Affymetrix guidelines using GeneChip® Mouse Genome 430 2.0 arrays, related reagents, and GCOS 1.4 software (www.affymetrix.com). Comparative analysis was carried out between each individual wild-type and mutant sample, which generated 9 comparisons. Genes showing a ≥1.5 fold change on ≥7/9 comparisons were chosen for further statistical analysis using SAM (Significance Analysis of Microarrays, http://www-stat.stanford.edu/~tibs/SAM/) with a false discovery rate and q value of < 0.01%. Data clustering were performed with Cluster and TreeView (Eisen Laboratory, http://rana.lbl.gov/EisenSoftware.htm). QRT-PCR was performed with SYBR Green (Applied Biosystems, ABI) and the ABI PRISM 7900 HT Sequence Detection System according to ABI protocol. To be brief, 100ηg of total RNA was reverse transcribed into cDNA. Two-step PCR cycling was carried out as follows: 10 min at 95°C × 1 cycle followed by 15 s at 95°C and 1 min at 60°C × 40 cycles. The housekeeping gene 18S rRNA was used as an endogenous control. The comparative CT method was used to determine relative expression levels. QRT-PCR primer pairs and assay results are presented in Table 1. Gene ontology functional analysis of differentially expressed genes was performed using GenMAPP software (www.genmapp.org). Lastly, literature-based biological profiling of altered gene expression patterns was carried out with Ingenuity Pathways Analysis (www.ingenuity.com).

Table 1.

Real-time PCR confirmation of some microarray data

Gene Primer Sequence Microarray-based ratio1 Real-time PCR-based ratio1
Car8 Forward: CTGTTCATTTTAAAGAAACACAGTGTGT −19.4 −16.6
Reverse: GCAACAAGCAGTATGTGCAAAAG
Cbln3 Forward: TCCCACCAACATCAGAAACTCTT −5.1 −2.1
Reverse: GTTGTTCTAGGTAGGTCCGTTCATG
Gabra2 Forward: CTATGCCCCGAATCTTTCCA 2.6 1.9
Reverse: TCTGGCGTCGTTGCACTTT
Gabra6 Forward: GCAATACTGTTGCTATTTCCCACTAAA −2.6 −2.9
Reverse: GTCATAGTATAGTCCACCAAGTGACCTT
18S ABI Part No.4308329 Internal control

Note: 1. represents a relative ratio of signal intensity of mutant vs wild-type mice

Results

In this study, 192 transcripts were found to be significantly dysregulated in wdl mice (upregulated 90, downregulated 102). Among this set, 79 (41%) were expressed sequence tags (ESTs) of unknown function (Supplementary Table 1). Hierarchical clustering analysis, a standard method of identifying coexpressed or coregulated genes, detected 6 major clusters of transcripts (Supplementary Table 2). Strikingly, many of the dysregulated transcripts with the largest fold differences were parceled into two major clusters: upregulated genes in Cluster 3 (Glp1r, H2-D1, Paip1 and Scn2b) and downregulated genes in Cluster 6 (Car8, IMAGE cDNA clone 6309338 and C030014A21Rik). Consistent with previous Northern blotting results [21], the expression level of Car8 transcript as determined with QRT-PCR was markedly depressed in wdl mice. Many transcripts in Cluster 6 are involved in synapse vesicle recycling, transcriptional regulation, and signal transduction regulation. In Cluster 3, upregulated genes are related to synapse vesicle transport, protein biosynthesis, immune response, and cell adhesion and migration. Of note, three genes known to be involved in cerebellar function and implicated in the pathophysiology of ataxia (Cbln3, Chn2, and Etv1) were found in Cluster 4 [2, 24, 32]. Microarray analysis and QRT-PCR yielded similar results for the four genes assessed with both techniques: Car8, the cerebellar-enriched Cbln3, and the inhibitory receptors Gabra2 and Gabra6 (Supplementary Table 2).

Gene ontology functional analysis showed a remarkable increase in the expression of genes involved in cellular structure and function of the Golgi apparatus and decreased expression of genes of associated with intracellular signaling, cell division, and metal ion (mainly calcium and zinc) binding in wdl mice (Table 2). Literature-based pathway analysis with Ingenuity Pathway Analysis provided additional insight into those biological processes altered by the absence of Car8. The most significantly affected categories were cellular maintenance, growth and proliferation, organismal survival, signaling, development, and morphology (Table 3).

Table 2.

Biological profiling of Car8 mutant mice identified using MAPPFinder1

Change GOID GO Name GO Type Number Changed Number Measured Number in GO Percent Changed Z Score PermuteP Affected genes
Increase 5794 Golgi apparatus C 6 6 382 100 2.4 0.03 Arcn1, C530046L02Rik, Clasp2, Pik4cb, St6galnac5, Tctex1
5198 structural molecule activity F 5 5 774 100 2.2 0.05 C530046L02Rik, Rpl14, Rpl15, Ntng1, Tubb5
7242 intracellular signaling cascade P 7 8 793 87.5 2.4 0.04 Car8, Chn2, Pclo, Pip5k3, Snx6, Srpk2, Tulp4
Decrease 51301 cell division P 4 4 136 100 2.2 0.04 Ccne2, Pafah1b1, Sept3, Sept4
46872 metal ion binding F 14 21 2864 66.7 2.1 0.05 6330416L07Rik, 9830124H08Rik, BC021442,Car8, Chn2, Nptx1, Pclo, Pip5k3, Rora, Rph3a, Srpk2, Syt11, Ttc3, Zfp52

Note: 1. Detailed explanation of columes GOID,GO name, GO type, Number changes, Number measured, Number in GO, Percent changed, Z score and PermutP can be found in GenMAPP website (http://www.genmapp.com). GO represents gene ontology; C stands for component; F stands for function; P stands for process.

Table 3.

Ingenuity-generated networks

Network Genes1 Score2 Focus genes3 Top functions
1 DNCH1, DNCH2, DNCI2, DNCL1, DNCL2B, DNCLI1, DNCLIC2, EIF4A1, FLJ30092, FMR1, GNB1, GNG4, HOXA9, MBNL1, MEIS1, NDE1, NDEL1, NFYB, PABPC1, PAFAH1B1, PAIP1, PBX2, PKNOX1, RABEP1, RAD50, RAPGEF6, REC8L1, RPH3A, SMC1L1, SNX6, TCTEL1, TGFBR2, TTC3, VPS52, YWHAG 22 15 Cellular Function and Maintenance, Cancer, Hematological Disease
2 ADM, ANXA1, ANXA2, CD200, CD200R1, CEBPB, CHN2, CLEC11A, CTSC, CYB5, DOK1, DOK2, EFNB2, EGFR, FADS2, FASN, GLO1, GPX3, H2-D1, HPCAL1, IL13, IL8RB, INSR, KIDINS220, KLF7, MT1A, PRKD1, RPL14, RPL15, RPS6KA2, SC5DL, SRC, SREBF1, SREBF2, TNF 18 13 Organismal Survival, Cancer, Cellular Growth and Proliferation
3 ATP1A1, ATP1A2, ATP1B1, CAP1, CCNE2, CDC42, EGFR, FXYD7, GABRA2, GABRA6, GABRB1, GABRB2, GABRB3, GABRG2, GABRG3, IL4, INS1, INSR, ITPR1, JAK2, KIF3B, PIK4CB, PIP5K3, PRKCB1, RAB4A, RNPS1, RUFY1, SCN3A, SLC1A3, SLC8A1, STS-1, STX1A, SYT11, TGFB1, TGFBR2 18 13 Cell Signaling, Cellular Development, Cell Morphology
4 APC, APP, ARCN1, BUB1, CLASP2, CSNK1D, CSNK1E, DCTN2, DUSP1, EGFR, FKBP1B,GAS, HSPA8, KLF4, MAPK1, MAPRE1, MYOD1, NPTX1, PACRG, PARK2, PBP, POLB, RPS6KA2, RPS6KA3, RYR1, SCHIP1, SEPT4, SNCA, SORL1, STIP1, TCF7L2, TCP1, TFF3, TP53, VPS33A 16 12 Cellular Compromise, DNA Replication, Recombination, and Repair, Cell Cycle
5 ACAA1, ACTA1, ACTG1, CAMK4, CEBPB, CRABP1, CREB1, EGFR, ERBB2, ERG, ETV1, FASN, FOS, GCG, GH1, GLP1R, HK3, INPP5F, INSR, LEP, NIPSNAP1, PCLO, PFN1, PFN2, PIB5PA, PRKAR2B, PTGDS, RPS6KA3, RPS6KA4, SLC19A1, SRPK2, TMSB4X, TUBA3, TUBB, TUBB4 16 12 and Function, Lipid Metabolism, Gene Expression Connective Tissue Development

Notes: 1, the collection of related genes in the network; 2, the “score” is derived from P values and indicates the likelihood that the “Focus genes” in a particular network are not grouped together by chance alone; and 3, the number of “Focus genes” identified in this study.

Discussion

Although Car8 is known to be a negative regulator of intracellular Ca2+ signaling [17], its exact role in the IP3 signaling and cytoplasmic calcium homeostasis is unclear. Calcium plays an important role in the regulation of numerous neuronal processes including the formation and adaptive modification of neural circuits [27], neurotransmitter release, and gene transcription [5]. Calcium-binding proteins play critical roles in mediating many of the various activities of calcium ions [4]. In wdl mice, there were no significant changes in the expression of several major common calcium-binding protein genes including Calb1, Calb2, and Pvalb. However, wdl mice did show cerebellar upregulation of the Ca2+-binding protein encoding genes Hpcal1 and Slc8a1(Table 3), which are predominantly expressed in Purkinje cells [30, 33]. It is interesting to note that two other Ca2+- binding protein genes, Nptx1 and Pclo, whose protein products are enriched in presynaptic plasma membranes [9], were downregulated in the mutant mice (Table 2). Based on predominant expression of Car8 in Purkinje cells and the Car8 interaction with IP3R1, Car8 deficiency is predicted to exert most of its effects via increased concentration of free cytosolic in cerebellar Purkinje cells. However, due to the effects of Ca2+ on multifarious neuronal processes, it is difficult to determine if Car8 may have additional cellular roles independent of its effects on Ca2+.

Hippocalcin like 1 (Hpcal, Table 3), a member of the family of intracellular neuronal calcium sensors involved in the calcium-dependent regulation of signal transduction cascades, may be involved in the control of clathrin-coated vesicle trafficking [20] whereas solute carrier family 8 (sodium/calcium exchanger) member 1(Slc8a1, Table 3) is a primary regulator of intracellular Ca2+ concentration by pumping Ca2+ out of cells [22]. Neuronal pentraxin 1 (Nptx1) has been implicated in the modulation of hypoxic-ischemic injury through an interaction with glutamate receptors [18]. The neuronal pentraxins are characterized by calcium-dependent ligand binding. Piccolo or presynaptic cytomatrix protein (Pclo) is a novel shared component of glutaminergic and GABAergic synapses that functions as a presynaptic calcium sensor and may regulate neurotransmitter release [13]. Given the variety of cell types that contribute to olivocerebellar and cerebellar cortical local area networks, it is difficult to dissect direct versus compensatory effects of Car8 deficiency in Purkinje cells. For instance, neuronal pentraxin 1 is expressed in both granule and Purkinje cells [37].

An important finding in this study was the significant effects of Car8 deficiency on genes involved in the structure and function of the Golgi apparatus (GA), particularly vesicle assembly and transport. In neurons, GA is the place for the packing and transport of synaptic vesicles containing neurotransmitters. Fragmentation of the neuronal GA has been implicated in several neurodegenerative disorders including spinocerebelar ataxia type 2 [14]. Interestingly, we found increased expression of GA genes including Arcn1, Clasp2, Pik4cb, St6galnac5, and Tctex1 in wdl mice (Table 2). Archain vesicle transport protein 1 (Arcn1) is one of major components of synapse vesicle coat assembly [31]. CLIP-associated protein 2 (Clasp2) participates in the local regulation of distal microtubule dynamics [1], which is related to vesicle trafficking. Phosphatidyl-inositol 4-kinase (Pik4cb) interacts with frequenin (also know as neuronal calcium sensor 1) in the exocytosis of secretory vesicles [29]. Finally, t-complex testis-expressed 1 protein (Tctex1), a light-chain subunit of the dynein motor complex, interacts directly and selectively with N- and P/Q-type Ca2+ channels [23]. Taken together, these gene expression changes suggest that increased activity of the GA and downstream vesicle transport may contribute to the pathophysiology of ataxia and/or dystonia by virtue of increased receptor delivery to the neuronal cell surface. Since the GA has been confirmed as an important distinct IP3-sensitive Ca2+ store [35], our findings also suggest that Car8 deficiency may exert direct rather than compensatory effects on GA activity.

Most autosomal recessive ataxias are multisystem disorders due to loss-of-function mutations. DNA repair and maintenance are critical to the molecular pathophysiology of seom types of ataxic disorders such as ataxia telangiectasia, AT-like disease, ataxia with oculomotor apraxia 1 and 2, and spinocerebellar ataxia with axonal neuropathy [40]. In our study, three genes (Cbln3, Chn2, and Etv1) that are either exclusively or predominantly expressed in the cerebellum were significantly downregulated in wdl mice (Supplementary Table 2). The peptide encoded by Cbln3 may play an important role in the synaptic integrity and plasticity of Purkinje cells via interaction with cerebellin (Cbln1) [16, 32]. Chn2 encodes a GTPase-activating protein (GAP) for p21 ras-related Rac [24]. For review, Rac, a primary member of Rho GTPase family, may be a key regulator of synaptogenesis and dendritogenesis by coordinating assembly of the actin and microtubule cytoskeleton [15, 43]. Lastly, Etv1 encodes a proprioceptive marker which may control the expression of other proprioceptive neuron-specific genes through collaboration with Runx3 for their expression [25]. Interestingly, Etv1 mutant mice exhibit a severe limb ataxia due to faulty assemblage of sensorimotor circuitry within the spinal cord [2]. These results suggest that Car8 deficiency could result in impaired neuronal connectivity through reduced synapse formation and dendritogenesis. By extrapolation, similar development defects may underlie some recessive ataxias in humans.

Although zinc plays an important role in cell surface signaling and acts as an enzymatic cofactor, little is known about cellular mechanisms mediating zinc homeostasis. The concentration of zinc has been shown to be altered in a number of disorders of the central nervous system including Friedreich’s ataxia [12]. Furthermore, mutations of several zinc ion-binding protein genes have been implicated in several ataxic disorders, such as Aptx in autosomal recessive ataxia [11], Egr3 in sensory ataxia [42], and Zic1 in knockout mice with severe ataxia [3]. In our study, transcripts for several zinc ion-binding proteins (Pip5k3, Chn2, Zfp52, Ttc3, Rph3a, 9830124H08Rik, and BC021442) were downregulated in wdl mice (Table 2). Among these, Rph3a is implicated in synaptic transmission [38], while the granule cell-specific and ataxia-related Chn2 has been confirmed to be involved in regulation of cell proliferation [48] and diacylglycerol signaling [8].

Purkinje cells have already finished cell division at birth whereas granule cells proliferate vigorously during the first three postnatal weeks [47] (http://www.cdtdb.brain.riken.jp/CDT/Top.jsp). Therefore, the down-regulation of several genes involved in cell division, including Sept3, Sept4, Pafah1b1, and Ccne2 (Table 2), may reflect decreased granule cell proliferation and/or neuritogenesis in the mutants. Septin 3 (Sept3) is a brain-specific member of the septin family of GTPase enzymes that assemble as intracellular filamentous scaffolds and are involved in cytokinesis or exocytosis. Most members of the septin family appear to interact with each other in order to assemble as filaments, such as the interaction of Septin 4 (Sept4) and Septin 8 (Sept8) in vesicle trafficking [6]. Since Car8 expression in cerebellar cortex is limited to Purkinje cells, any down-regulation of Sept3 and Sept4 transcripts that is occurring within granule cells must be some type of feedback response to abnormal Purkinje cell signaling.

Previous work has shown that the expression patterns of the α2 (Gabra2) and α6 (Gabra6) subunits of gamma-aminobutyric acid type A (GABAA) receptors are temporally associated with the early (α2) and late (α6) postnatal development of cerebellar granule cells [28, 39, 45]. Both granule and Purkinje cells express the α2 subunit whereas only granule cells express the α6 subunit [36]. Thus, the down-regulation of Gabra6 transcript in wdl mice must be an indirect effect of Purkinje cell Car8 deficiency. It is interesting to note that the α6 subunit is also down-regulated stargazer mice, a motoric mutant that exhibits dystonia and ataxia [41]. In the context of cerebellar development it should be noted that the α6 subunit may mediate cell surface anchoring [34]. The α6 subunit of GABAA receptors expressed by granule cell may regulate several aspects of normal cerebellar function [6, 7, 46].

In summary, our gene expression profiling analysis suggests that calcium homeostasis, synaptogenesis and dendritogenesis, vesicle formation and transport, and, possibly, granule cell proliferation and/or neuritogenesis, are dysregulated in wdl mice. Furthermore, cell-surface signaling pathways in wdl mice may be distorted through changes in intracellular Ca2+, alterations in the expression of zinc-binding proteins, and increased activity of the GA. These findings suggest that ultrastructural abnormalities of specific neuronal elements may be present in wdl cerebellar cortex. In addition, the substantial number of dysregulated genes in wdl mice indicates that Car8 plays an important physiological role in cerebellar cortex. Overall, the scope of our results is not surprising given that significant changes in gene expression profiles have been described in a phenotypically-normal mouse model of Friedrich’s ataxia (10).

Supplementary Material

01

Acknowledgments

Support for this work was derived from the UTHSC Center of Genomics and Bioinformatics (WG) and Center in Connective Tissue Research (WG), Veterans Administration (WG); National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health (R01AR51190 to WG; RR01183 to LRD); and National Institute of Neurological Diseases and Stroke, National Institutes of Health (R01NS048458 and R03NS050185 to MSL).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Akhmanova A, Hoogenraad CC, Drabek K, Stepanova T, Dortland B, Verkerk T, Vermeulen W, Burgering BM, De Zeeuw CI, Grosveld F, Galjart N. Clasps are CLIP-115 and -170 associating proteins involved in the regional regulation of microtubule dynamics in motile fibroblasts. Cell. 2001;104:923–35. doi: 10.1016/s0092-8674(01)00288-4. [DOI] [PubMed] [Google Scholar]
  • 2.Arber S, Ladle DR, Lin JH, Frank E, Jessell TM. ETS gene Er81 controls the formation of functional connections between group Ia sensory afferents and motor neurons. Cell. 2000;101:485–98. doi: 10.1016/s0092-8674(00)80859-4. [DOI] [PubMed] [Google Scholar]
  • 3.Aruga J, Minowa O, Yaginuma H, Kuno J, Nagai T, Noda T, Mikoshiba K. Mouse Zic1 is involved in cerebellar development. J Neurosci. 1998;18:284–93. doi: 10.1523/JNEUROSCI.18-01-00284.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bastianelli E. Distribution of calcium-binding proteins in the cerebellum. Cerebellum. 2003;2:242–62. doi: 10.1080/14734220310022289. [DOI] [PubMed] [Google Scholar]
  • 5.Berridge MJ. Neuronal calcium signaling. Neuron. 1998;21:13–26. doi: 10.1016/s0896-6273(00)80510-3. [DOI] [PubMed] [Google Scholar]
  • 6.Blaser S, Horn J, Wurmell P, Bauer H, Strumpell S, Nurden P, Pagenstecher A, Busse A, Wunderle D, Hainmann I, Zieger B. The novel human platelet septin SEPT8 is an interaction partner of SEPT4. Thromb Haemost. 2004;91:959–66. doi: 10.1160/TH03-09-0578. [DOI] [PubMed] [Google Scholar]
  • 7.Brickley SG, Revilla V, Cull-Candy SG, Wisden W, Farrant M. Adaptive regulation of neuronal excitability by a voltage-independent potassium conductance. Nature. 2001;409:88–92. doi: 10.1038/35051086. [DOI] [PubMed] [Google Scholar]
  • 8.Caloca MJ, Garcia-Bermejo ML, Blumberg PM, Lewin NE, Kremmer E, Mischak H, Wang S, Nacro K, Bienfait B, Marquez VE, Kazanietz MG. beta2-chimaerin is a novel target for diacylglycerol: binding properties and changes in subcellular localization mediated by ligand binding to its C1 domain. Proc Natl Acad Sci U S A. 1999;96:11854–9. doi: 10.1073/pnas.96.21.11854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cases-Langhoff C, Voss B, Garner AM, Appeltauer U, Takei K, Kindler S, Veh RW, De Camilli P, Gundelfinger ED, Garner CC. Piccolo, a novel 420 kDa protein associated with the presynaptic cytomatrix. Eur J Cell Biol. 1996;69:214–23. [PubMed] [Google Scholar]
  • 10.Coppola G, Choi SH, Santos MM, Miranda CJ, Tentler D, Wexler EM, Pandolfo M, Geschwind DH. Gene expression profiling in frataxin deficient mice: microarray evidence for significant expression changes without detectable neurodegeneration. Neurobiol Dis. 2006;22:302–11. doi: 10.1016/j.nbd.2005.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Date H, Onodera O, Tanaka H, Iwabuchi K, Uekawa K, Igarashi S, Koike R, Hiroi T, Yuasa T, Awaya Y, Sakai T, Takahashi T, Nagatomo H, Sekijima Y, Kawachi I, Takiyama Y, Nishizawa M, Fukuhara N, Saito K, Sugano S, Tsuji S. Early-onset ataxia with ocular motor apraxia and hypoalbuminemia is caused by mutations in a new HIT superfamily gene. Nat Genet. 2001;29:184–8. doi: 10.1038/ng1001-184. [DOI] [PubMed] [Google Scholar]
  • 12.Ebadi M, Iversen PL, Hao R, Cerutis DR, Rojas P, Happe HK, Murrin LC, Pfeiffer RF. Expression and regulation of brain metallothionein. Neurochem Int. 1995;27:1–22. doi: 10.1016/0197-0186(94)00164-p. [DOI] [PubMed] [Google Scholar]
  • 13.Gerber SH, Garcia J, Rizo J, Sudhof TC. An unusual C(2)-domain in the active-zone protein piccolo: implications for Ca(2+) regulation of neurotransmitter release. Embo J. 2001;20:1605–19. doi: 10.1093/emboj/20.7.1605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gonatas NK, Stieber A, Gonatas JO. Fragmentation of the Golgi apparatus in neurodegenerative diseases and cell death. J Neurol Sci. 2006;246:21–30. doi: 10.1016/j.jns.2006.01.019. [DOI] [PubMed] [Google Scholar]
  • 15.Hall A, Nobes CD. Rho GTPases: molecular switches that control the organization and dynamics of the actin cytoskeleton. Philos Trans R Soc Lond B Biol Sci. 2000;355:965–70. doi: 10.1098/rstb.2000.0632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hirai H, Pang Z, Bao D, Miyazaki T, Li L, Miura E, Parris J, Rong Y, Watanabe M, Yuzaki M, Morgan JI. Cbln1 is essential for synaptic integrity and plasticity in the cerebellum. Nat Neurosci. 2005;8:1534–41. doi: 10.1038/nn1576. [DOI] [PubMed] [Google Scholar]
  • 17.Hirota J, Ando H, Hamada K, Mikoshiba K. Carbonic anhydrase-related protein is a novel binding protein for inositol 1,4,5-trisphosphate receptor type 1. Biochem J. 2003;372:435–41. doi: 10.1042/BJ20030110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hossain MA, Russell JC, O’Brien R, Laterra J. Neuronal pentraxin 1: a novel mediator of hypoxic-ischemic injury in neonatal brain. J Neurosci. 2004;24:4187–96. doi: 10.1523/JNEUROSCI.0347-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hur EM, Park YS, Huh YH, Yoo SH, Woo KC, Choi BH, Kim KT. Junctional membrane inositol 1,4,5-trisphosphate receptor complex coordinates sensitization of the silent EGF-induced Ca2+ signaling. J Cell Biol. 2005;169:657–67. doi: 10.1083/jcb.200411034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ivings L, Pennington SR, Jenkins R, Weiss JL, Burgoyne RD. Identification of Ca2+-dependent binding partners for the neuronal calcium sensor protein neurocalcin delta: interaction with actin, clathrin and tubulin. Biochem J. 2002;363:599–608. doi: 10.1042/0264-6021:3630599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jiao Y, Yan J, Zhao Y, Donahue LR, Beamer WG, Li X, Roe BA, Ledoux MS, Gu W. Carbonic anhydrase-related protein VIII deficiency is associated with a distinctive lifelong gait disorder in waddles mice. Genetics. 2005;171:1239–46. doi: 10.1534/genetics.105.044487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Komuro I, Wenninger KE, Philipson KD, Izumo S. Molecular cloning and characterization of the human cardiac Na+/Ca2+ exchanger cDNA. Proc Natl Acad Sci U S A. 1992;89:4769–73. doi: 10.1073/pnas.89.10.4769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lai M, Wang F, Rohan JG, Maeno-Hikichi Y, Chen Y, Zhou Y, Gao G, Sather WA, Zhang JF. A tctex1-Ca2+ channel complex for selective surface expression of Ca2+ channels in neurons. Nat Neurosci. 2005;8:435–42. doi: 10.1038/nn1418. [DOI] [PubMed] [Google Scholar]
  • 24.Leung T, How BE, Manser E, Lim L. Cerebellar beta 2-chimaerin, a GTPase-activating protein for p21 ras-related rac is specifically expressed in granule cells and has a unique N-terminal SH2 domain. J Biol Chem. 1994;269:12888–92. [PubMed] [Google Scholar]
  • 25.Levanon D, Bettoun D, Harris-Cerruti C, Woolf E, Negreanu V, Eilam R, Bernstein Y, Goldenberg D, Xiao C, Fliegauf M, Kremer E, Otto F, Brenner O, Lev-Tov A, Groner Y. The Runx3 transcription factor regulates development and survival of TrkC dorsal root ganglia neurons. Embo J. 2002;21:3454–63. doi: 10.1093/emboj/cdf370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lorden JF, McKeon TW, Baker HJ, Cox N, Walkley SU. Characterization of the rat mutant dystonic (dt): a new animal model of dystonia musculorum deformans. J Neurosci. 1984;4:1925–32. doi: 10.1523/JNEUROSCI.04-08-01925.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mattson MP. Calcium as sculptor and destroyer of neural circuitry. Exp Gerontol. 1992;27:29–49. doi: 10.1016/0531-5565(92)90027-w. [DOI] [PubMed] [Google Scholar]
  • 28.Mellor JR, Merlo D, Jones A, Wisden W, Randall AD. Mouse cerebellar granule cell differentiation: electrical activity regulates the GABAA receptor alpha 6 subunit gene. J Neurosci. 1998;18:2822–33. doi: 10.1523/JNEUROSCI.18-08-02822.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Mora S, Durham PL, Smith JR, Russo AF, Jeromin A, Pessin JE. NCS-1 inhibits insulin-stimulated GLUT4 translocation in 3T3L1 adipocytes through a phosphatidylinositol 4-kinase-dependent pathway. J Biol Chem. 2002;277:27494–500. doi: 10.1074/jbc.M203669200. [DOI] [PubMed] [Google Scholar]
  • 30.Oikawa K, Kimura S, Aoki N, Atsuta Y, Takiyama Y, Nagato T, Yanai M, Kobayashi H, Sato K, Sasajima T, Tateno M. Neuronal calcium sensor protein visinin-like protein-3 interacts with microsomal cytochrome b5 in a Ca2+-dependent manner. J Biol Chem. 2004;279:15142–52. doi: 10.1074/jbc.M312766200. [DOI] [PubMed] [Google Scholar]
  • 31.Orcl L, Palmer DJ, Amherdt M, Rothman JE. Coated vesicle assembly in the Golgi requires only coatomer and ARF proteins from the cytosol. Nature. 1993;364:732–4. doi: 10.1038/364732a0. [DOI] [PubMed] [Google Scholar]
  • 32.Pang Z, Zuo J, Morgan JI. Cbln3, a novel member of the precerebellin family that binds specifically to Cbln1. J Neurosci. 2000;20:6333–9. doi: 10.1523/JNEUROSCI.20-17-06333.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Papa M, Canitano A, Boscia F, Castaldo P, Sellitti S, Porzig H, Taglialatela M, Annunziato L. Differential expression of the Na+-Ca2+ exchanger transcripts and proteins in rat brain regions. J Comp Neurol. 2003;461:31–48. doi: 10.1002/cne.10665. [DOI] [PubMed] [Google Scholar]
  • 34.Peran M, Hooper H, Rayner SL, Stephenson FA, Salas R. GABAA receptor alpha1 and alpha6 subunits mediate cell surface anchoring in cultured cells. Neurosci Lett. 2004;364:67–70. doi: 10.1016/j.neulet.2004.03.081. [DOI] [PubMed] [Google Scholar]
  • 35.Pinton P, Pozzan T, Rizzuto R. The Golgi apparatus is an inositol 1,4,5-trisphosphate-sensitive Ca2+ store, with functional properties distinct from those of the endoplasmic reticulum. Embo J. 1998;17:5298–308. doi: 10.1093/emboj/17.18.5298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Santi MR, Vicini S, Eldadah B, Neale JH. Analysis by polymerase chain reaction of alpha 1 and alpha 6 GABAA receptor subunit mRNAs in individual cerebellar neurons after whole-cell recordings. J Neurochem. 1994;63:2357–60. doi: 10.1046/j.1471-4159.1994.63062357.x. [DOI] [PubMed] [Google Scholar]
  • 37.Schlimgen AK, Helms JA, Vogel H, Perin MS. Neuronal pentraxin, a secreted protein with homology to acute phase proteins of the immune system. Neuron. 1995;14:519–26. doi: 10.1016/0896-6273(95)90308-9. [DOI] [PubMed] [Google Scholar]
  • 38.Smith R, Petersen A, Bates GP, Brundin P, Li JY. Depletion of rabphilin 3A in a transgenic mouse model (R6/1) of Huntington’s disease, a possible culprit in synaptic dysfunction. Neurobiol Dis. 2005;20:673–84. doi: 10.1016/j.nbd.2005.05.008. [DOI] [PubMed] [Google Scholar]
  • 39.Takayama C, Inoue Y. Transient expression of GABAA receptor alpha2 and alpha3 subunits in differentiating cerebellar neurons. Brain Res Dev Brain Res. 2004;148:169–77. doi: 10.1016/j.devbrainres.2003.11.007. [DOI] [PubMed] [Google Scholar]
  • 40.Taroni F, DiDonato S. Pathways to motor incoordination: the inherited ataxias. Nat Rev Neurosci. 2004;5:641–55. doi: 10.1038/nrn1474. [DOI] [PubMed] [Google Scholar]
  • 41.Thompson CL, Tehrani MH, Barnes EM, Jr, Stephenson FA. Decreased expression of GABAA receptor alpha6 and beta3 subunits in stargazer mutant mice: a possible role for brain-derived neurotrophic factor in the regulation of cerebellar GABAA receptor expression? Brain Res Mol Brain Res. 1998;60:282–90. doi: 10.1016/s0169-328x(98)00205-8. [DOI] [PubMed] [Google Scholar]
  • 42.Tourtellotte WG, Milbrandt J. Sensory ataxia and muscle spindle agenesis in mice lacking the transcription factor Egr3. Nat Genet. 1998;20:87–91. doi: 10.1038/1757. [DOI] [PubMed] [Google Scholar]
  • 43.Van Aelst L, Cline HT. Rho GTPases and activity-dependent dendrite development. Curr Opin Neurobiol. 2004;14:297–304. doi: 10.1016/j.conb.2004.05.012. [DOI] [PubMed] [Google Scholar]
  • 44.Wahnschaffe U, Fredow G, Heintz P, Loscher W. Neuropathological studies in a mutant hamster model of paroxysmal dystonia. Mov Disord. 1990;5:286–93. doi: 10.1002/mds.870050405. [DOI] [PubMed] [Google Scholar]
  • 45.Wang W, Stock RE, Gronostajski RM, Wong YW, Schachner M, Kilpatrick DL. A role for nuclear factor I in the intrinsic control of cerebellar granule neuron gene expression. J Biol Chem. 2004;279:53491–7. doi: 10.1074/jbc.M410370200. [DOI] [PubMed] [Google Scholar]
  • 46.Watanabe D, Inokawa H, Hashimoto K, Suzuki N, Kano M, Shigemoto R, Hirano T, Toyama K, Kaneko S, Yokoi M, Moriyoshi K, Suzuki M, Kobayashi K, Nagatsu T, Kreitman RJ, Pastan I, Nakanishi S. Ablation of cerebellar Golgi cells disrupts synaptic integration involving GABA inhibition and NMDA receptor activation in motor coordination. Cell. 1998;95:17–27. doi: 10.1016/s0092-8674(00)81779-1. [DOI] [PubMed] [Google Scholar]
  • 47.Yamanaka H, Yanagawa Y, Obata K. Development of stellate and basket cells and their apoptosis in mouse cerebellar cortex. Neurosci Res. 2004;50:13–22. doi: 10.1016/j.neures.2004.06.008. [DOI] [PubMed] [Google Scholar]
  • 48.Yang C, Liu Y, Leskow FC, Weaver VM, Kazanietz MG. Rac-GAP-dependent inhibition of breast cancer cell proliferation by {beta}2-chimerin. J Biol Chem. 2005;280:24363–70. doi: 10.1074/jbc.M411629200. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

RESOURCES