Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2007 Jan 12;189(6):2339–2349. doi: 10.1128/JB.01827-06

The Orphan Response Regulator HP1021 of Helicobacter pylori Regulates Transcription of a Gene Cluster Presumably Involved in Acetone Metabolism

Michael Pflock 1, Melanie Bathon 1, Jennifer Schär 1, Stefanie Müller 1, Hans Mollenkopf 2, Thomas F Meyer 3, Dagmar Beier 1,*
PMCID: PMC1899378  PMID: 17220217

Abstract

Helicobacter pylori is a gastric pathogen for which no nonhuman reservoir is known. In accordance with the tight adaptation to its unique habitat, the human stomach, H. pylori is endowed with a very restricted repertoire of regulatory proteins. Nevertheless, the three complete two-component systems of H. pylori were shown to be involved in the regulation of important virulence traits like motility and acid resistance and in the control of metal homeostasis. HP1021 is an orphan response regulator with an atypical receiver domain whose inactivation has a considerable impact on the growth of H. pylori. Here we report the identification of HP1021-regulated genes by whole-genome transcriptional profiling. We show that the transcription of the essential housekeeping genes nifS and nifU, which are required for the assembly of Fe-S clusters, is activated by HP1021. Furthermore, we demonstrate that the expression of a gene cluster comprising open reading frames hp0690 to hp0693 and hp0695 to hp0697 which is probably involved in acetone metabolism is strongly upregulated by HP1021. Evidence is provided for a direct regulation of the hp0695-to-hp0697 operon by the binding of HP1021 to its promoter region.


Helicobacter pylori is a human pathogen which is associated with gastric diseases like chronic active gastritis, peptic ulceration, adenocarcinoma, and mucosa-associated lymphoid tissue lymphoma (6, 28, 36). Consistent with the human stomach being its unique habitat which is believed to provide a relatively stable environment lacking competition from other microorganisms, H. pylori has a remarkably small repertoire of transcriptional regulators. Containing only three histidine kinases and five response regulators involved in transcriptional regulation (35), H. pylori is among the organisms with the lowest number of two-component systems whose genomes have been sequenced so far. However, the two-component systems of H. pylori proved to play an important role in both in vitro growth of the organism and its ability to colonize in a mouse infection model (5, 26, 31). It was shown that the two-component systems HP0703-HP0244, named FlgRS, and HP0166-HP0165, named ArsRS, are involved in the regulation of flagellum-based motility and urease-dependent acid resistance, which are both essential virulence traits of H. pylori (5, 23, 29, 30). The two-component system HP1365-HP1364 (CrdRS) positively regulates the expression of the copper resistance determinant CrdAB-CzcAB in response to increasing concentrations of copper ions (37). Moreover, this two-component system was recently reported to contribute to acid-responsive gene regulation (16).

Besides the aforementioned systems consisting of a histidine kinase and its cognate response regulator, H. pylori encodes two orphan response regulators with unique properties. HP1043, which belongs to the OmpR subfamily of response regulators, is essential for the growth of H. pylori under standard culture conditions. Deletion of the hp1043 gene could only be achieved when a second gene copy had previously been integrated into the H. pylori chromosome (19, 31). Surprisingly, the receiver domain of HP1043 shows a high degree of degeneration since there is a lysine residue at the position corresponding to highly conserved D13 in the consensus sequence and the canonical receiver phosphorylation site (D57 in the consensus sequence) is lacking due to a four-amino-acid (aa) deletion. The target genes controlled by HP1043 are unknown; however, on the basis of in vitro DNA binding experiments it was hypothesized that HP1043 regulates its own expression, as well as the transcription of the tlpB gene encoding a methyl-accepting chemotaxis protein (9). Furthermore, the expression of HP1043 seems to be controlled on the posttranscriptional and/or posttranslational level (9, 22).

The second orphan response regulator, HP1021, is required for normal cell growth of H. pylori, since deletion of the response regulator gene caused a growth defect resulting in a small-colony phenotype (5, 19). HP1021 harbors a helix-turn-helix motif at the C terminus of its output domain, yet it cannot be grouped into any of the known response regulator subclasses. Interestingly, in the receiver domain of HP1021 and its orthologs in the other sequenced ɛ-proteobacteria, i.e., H. acinonychis, H. hepaticus, Campylobacter jejuni, Wolinella succinogenes, and Thiomicrospira denitrificans (4, 12, 27, 33; http://cmr.tigr.org), the highly conserved phosphate-accepting aspartic acid residue (D57) is replaced by serine. Though serine phosphorylation has been observed in response regulator mutants lacking an aspartic acid residue at the canonical phosphorylation site (3, 21), until now there are no reports on serine phosphorylation as a means of modulating the activity of wild-type response regulator proteins. Recently, we could show that phosphorylation of the serine residue is not required for the cell growth-associated function of HP1021 (31). However, it cannot be ruled out that the DNA binding activity of both HP1021 and HP1043 can be modulated by a so-far-unknown mechanism. Transcription of hp1021, which is directed from a promoter upstream of the htrA gene (hp1019) forming a transcriptional unit with open reading frames (ORFs) hp1020 and hp1021, is increased in response to an acidic pH (20, 29); however, this transcriptional induction is not mediated by the ArsRS two-component system (29, 30). htrA and hp1020 encode a serine protease and a protein of unknown function, respectively. Target genes regulated by HP1021 have not been reported.

In this study, we set out to characterize the regulon controlled by HP1021. By global transcriptional profiling, we identified 79 genes which are differentially expressed in an hp1021 null mutant of H. pylori 26695, including essential housekeeping genes and highly regulated genes which presumably are involved in the metabolism of acetone. Furthermore, we demonstrate that these latter genes are regulated by direct binding of HP1021 to their promoter region.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

H. pylori 26695 is a clinical isolate (35). H. pylori 26695/HP1021::km, lacking the response regulator gene hp1021, has been described previously (29). H. pylori strains were grown at 37°C under microaerophilic conditions (Oxoid) on Columbia agar plates containing 5% horse blood, 0.2% cyclodextrin, and Dent's antibiotic supplement. Liquid cultures were grown in brain heart infusion (BHI) broth containing Dent's antibiotic supplement and 10% fetal calf serum. When required, blood agar plates or liquid broth for H. pylori culture were supplemented with kanamycin or chloramphenicol in a final concentration of 20 μg/ml. Escherichia coli DH5α was grown in Luria-Bertani (LB) broth supplemented with antibiotics at the following final concentrations if necessary: ampicillin, 100 μg/ml; kanamycin, 50 μg/ml; chloramphenicol, 30 μg/ml.

Construction of H. pylori strain 26695/Δ1021com.

Complemented strain 26695/Δ1021com is a derivative of 26695/HP1021::km into which ORF hp1021 was reintroduced via allelic-exchange mutagenesis by replacing the kanamycin resistance cassette with the response regulator gene and a downstream chloramphenicol acetyltransferase (cat) gene. The suicide plasmid used for the transformation of H. pylori 26695/HP1021::km was constructed by stepwise ligation of a 1,321-bp EcoRI-BamHI fragment encoding aa 277 to 406 of ORF hp1020 and ORF hp1021 and a 454-bp PstI-SacI fragment comprising the intergenic region between ORFs hp1021 and hp1022, as well the region encoding aa 1 to 79 of ORF hp1022, into cloning vector pSL1180 (Amersham Biosciences). The cloned DNA fragments were PCR amplified from chromosomal DNA of H. pylori 26695 with primer pairs 1021com-1/1021com-2 and 1021com-3/1021com-4, respectively (Table 1). The resulting plasmid was linearized by restriction with BamHI and PstI, and a chloramphenicol resistance cassette from Campylobacter coli (38) was cloned between the H. pylori-specific DNA fragments, yielding suicide plasmid pSL-Δhp1021com, which was introduced into H. pylori 26695/HP0121::km by electrotransformation (13). Chromosomal DNA of the resulting transformants was analyzed for the correct replacement of the kanamycin resistance cassette by the response regulator gene hp1021 and the cat gene by PCR with primers specific for hp1021 and cat, respectively, and with primers flanking the integration site.

TABLE 1.

Oligonucleotides used in this study

Name Sequence (5′ to 3′)a Siteb Strand Positionc
hyuA-PE TGCCACCGGCATCAATACC 745828-745846
fadA-PE CCGCCACTACAACCACTTC 740565-740583
nifS-PE GTCAATCCTAGTTGTAGCG 228368-228386
fadA-5 ATGAATGAAGTGGTTGTAGTGGCG + 740559-740582
fadA-3 AAGCGGGTTTGAGCTTTGCAAGGG 741235-741258
katA-5 GTGGTGCATGCTAAAGGAAGC 926909-926929
katA-3 CAATGGATAATCTTGGAGATACC + 926216-926238
16S-5 GCTAAGAGATCAGCCTATGTCC 1208855-1208876
16S-3 TGGCAATCAGCGTCAGGTAATG + 1208356-1208377
BShyuA-5 ATGATATTTATATGATATTTTTGGG + 745602-745626
BShyuA-3 TTGCGTCTTTCATTTAGACTCC 745792-745813
BSkatA-5 ATCCGTCAATGCATTGAGATAG 927348-927327
BSkatA-3 CTTCGTAATATGACACTAAGCC + 927114-927135
Pcag-5 ataaagggatccCATTTTTAGCAAATTTTTGTTAATTGTGG BamHI + 579674-79702
Pcag-3 ttgaaatctagaGTTAGTGTCAAAGACTGCTAAAAATC XbaI 579853-579878
PhyuA-5 ctaatactgcagCCTTAACATCTTCATTCAAGGC PstI + 745367-745388
PhyuA-3 atactaggatccTAGCTAAACTCTCATCTTCTGG BamHI 745912-745933
PfadA-5 ctaatactgcagTATTGACAGCTATTGCCAAAGC PstI + 740082-740103
PfadA-3 atactaggatccCACATCGCTAGGCTTAAGGC BamHI 740683-740702
PnifS-5 atattcgaattcTCATTACCGCTCTTTATAACC EcoRI 228011-228031
PnifS-3 tttgatctgcagGTCAATCCTAGTTGTAGCG PstI 228368-228386
1021com-1 ttgcacgaattcTTAAAGGCCCATAGCGATGG EcoRI + 1083718-1083737
1021com-2 cttactggatccGGATTTTCTGTTATTTGCGCG BamHI 1085018-1085038
1021com-3 caatgtctgcagGGCGTTTGATCATAAATTGC PstI + 1085058-1085079
1021com-4 caatcagagctcTTGTAATGATCGCACAGCTGG SacI 1085502-1085522
GST1021-5 caagaaggatccTGAAAATCTTAATCATTGAAGACG BamHI + 1084133-1084156
GST1021-3 aaggatgaattcTTATTTGCGCGGTAAGTTATATTTC EcoRI 1085004-1085028
a

Sequences in uppercase letters are derived from the genomic sequence of H. pylori 26695 (35). Sequences introduced for cloning purposes are given in lowercase letters, and restriction recognition sequences are underlined.

b

Restriction recognition site.

c

Nucleotide positions refer to the genome sequence of H. pylori 26695 (35).

RNA isolation.

H. pylori RNA was isolated from bacteria grown in liquid broth to an optical density at 550 nm (OD550) of 0.7 to 0.75 by using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. RNA preparations intended to be used for global transcriptional profiling were further purified with the RNeasy Mini Kit (QIAGEN) according to the manufacturer's RNA cleanup protocol. Residual DNA was removed by on-column digestion during RNA purification with QIAGEN RNase-free DNase (QIAGEN). The RNA concentration was quantified by determination of the absorbance at 260 and 280 nm, and RNA integrity was checked by visualization on a 1.5% agarose gel.

Microarray hybridization and data analysis.

Transcriptome analyses were performed with a custom-made whole-genome microarray containing 1,649 PCR products generated with specific primer pairs derived from the genome sequences of H. pylori 26695 (35) and J99 (2), which were spotted in duplicate. Microarrays were produced as described previously (14). Synthesis of differentially labeled cDNAs (Cy3-dCTP and Cy5-dCTP; Amersham Biosciences) from RNAs extracted from H. pylori 26695 and 26695/HP1021::km, respectively; microarray hybridization; generation of raw data; and data analysis were performed essentially as described by Pflock et al. (30).

Primer extension and RNA slot blot analysis.

Primer extension analysis was performed essentially as described previously (29), with 0.5 pmol of γ-32P-end-labeled oligonucleotides hyuA-PE, fadA-PE, and nifS-PE (Table 1), respectively, and 30 μg of RNA. Plasmids pSL-hyuAprom, pSL-fadAprom, and pSL-nifSprom, which were used as template DNAs in the sequencing reactions performed with primers hyuA-PE, fadA-PE, and nifS-PE, were constructed by ligating PstI-BamHI or EcoRI-PstI fragments of 566 bp, 620 bp, and 376 bp, respectively, which were amplified from chromosomal DNA of H. pylori 26695 with primer pairs PhyuA-5/PhyuA-3, PfadA-5/PfadA-3, and PnifS-5/PnifS-3 into cloning vector pSL1180 (Amersham Biosciences). Primer extension experiments were performed two times with independently prepared RNAs. Quantification of the signals from the primer extension products was performed with a Typhoon 9200 Variable Mode Imager (Amersham Biosciences) and ImageMaster TotalLab Software (Amersham Biosciences). RNA slot blot analysis was performed as follows. RNA (20 to 100 μg) was denatured in 1× morpholinepropanesulfonic acid (MOPS) buffer containing 50% formamide and 6% formaldehyde. The samples were incubated at 65°C for 5 min and cooled on ice before addition of 1 volume of 20× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). The denatured samples were filtered through a positively charged nylon membrane (Hybond N+; Amersham Biosciences) with a Bio-Dot chamber (Bio-Rad). After UV cross-linking, the nylon membrane was prehybridized for 1 h at 42°C in hybridization buffer (ECL gold hybridization buffer; Amersham Biosciences). The PCR products used as hybridization probes were amplified with primer pairs fadA-5/fadA-3, cat-5/cat-3, and 16S-5/16S-3, respectively, and labeled nonradioactively with the ECL Direct Nucleic Acid Labeling system (Amersham Biosciences) according to the manufacturer's instructions.

The labeled probes were added to the hybridization solution, and hybridization was performed for 12 to 16 h at 42°C. The membrane was washed two times in prewarmed (42°C) wash solution I (6 M urea, 0.5× SSC, 0.4% sodium dodecyl sulfate [SDS]) for 20 min at 42°C and two times in wash solution II (2× SSC) at room temperature. For signal detection, the ECL detection system (ECL Direct Nucleic Acid Labeling and Detection system; Amersham Biosciences) and X-ray films (Konica Minolta) were used.

Preparation of whole-cell protein lysates and proteome analysis.

Bacteria from a liquid culture grown to an OD550 of 1.0 were washed twice with phosphate-buffered saline containing 20 μg/ml chloramphenicol. The bacterial pellet was suspended in 1 ml of 10 mM Tris-HCl (pH 7.2)-5 mM MgCl2 containing 40 μg each of the proteinase inhibitors Pefabloc (Serva), pepstatin (Sigma), and leupeptin (Sigma), and the suspension was transferred to a Lysing Matrix B tube (MP Biomedicals). The tube was shaken six times for 30 s with a 1-min interval on ice after each shaking at a speed setting of 6.5 in a bead beater FP120 Fast Prep cell disrupter (Savant Instruments). Twenty-five units of benzonase (Merck) and 25 U of Rnace-it (Stratagene) were added, and the mixture was incubated for 10 min at room temperature. After centrifugation, urea and thiourea were added to the supernatant to final concentrations of 7 M and 2 M, respectively, and the mixture was incubated for 30 min at room temperature. For protein precipitation, trichloroacetic acid was added to a final concentration of 15% (vol/vol) and the mixture was incubated on ice for 2 h. The precipitated proteins were sedimented by centrifugation, the protein pellet was washed three times with ice-cold acetone, and the proteins were dissolved in urea buffer containing CHAPS {7 M urea, 2 M thiourea, 4% (wt/vol) 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate, 70 mM dithiothreitol (DTT)} and stored at −20°C.

Protein extracts were loaded onto Immobiline DryStrips (Amersham Biosciences) covering a pH gradient ranging from 6 to 9 which had been reswollen in rehydration buffer (7 M urea, 2 M thiourea, 4% [wt/vol] CHAPS, some crystals of bromophenol blue) for at least 12 h. For isoelectric focusing, a total of approximately 120,000 Vh was applied with several stepwise increases in voltage to 8,000 V (IPGphor Isoelectric Focusing Unit; Amersham Biosciences). The second dimension was standard SDS-polyacrylamide gel electrophoresis with 12% polyacrylamide gels (ISODalt; Amersham Biosciences). Prior to SDS-polyacrylamide gel electrophoresis, the strips were subsequently treated for 15 min with equilibration buffer (50 mM Tris [pH 8.8], 6 M urea, 30% [vol/vol] glycerol, 2% [vol/vol] SDS, some crystals of bromophenol blue) containing freshly added 64 mM DTT and for 15 min with equilibration buffer supplemented with freshly added 135 mM iodoacetic acid. The gels were fixed and stained either with silver nitrate or with colloidal Coomassie blue G250 according to standard procedures.

Protein spots of interest were precisely excised from Coomassie blue-stained two-dimensional (2D) gels on which about 800 μg of protein was separated. The gel pieces were cut into small cubes, rinsed several times with 100 μl of water for 15 to 30 min each, and washed three times with 100 μl of 50% (vol/vol) acetonitrile for 10 to 20 min. To shrink the gel and to extract residual water, pure acetonitrile was added dropwise for 10 min. After removal of the acetonitrile, 30 to 50 μl of digestion buffer (50 mM N-methylmorpholine, pH 8.1) and 0.5 μg of trypsin were added. Trypsin digestion of the protein was performed at 37°C for 6 to 12 h. The supernatant containing the generated peptides was recovered, and the gel pieces were extracted twice with 0.1% trifluoroacetic acid for 20 to 30 min. The volume of the combined extracts was reduced to 5 μl in a SpeedVac concentrator. Liquid chromatography-mass spectrometry and collision-induced fragmentation spectra were recorded on a Finnigan LCQ ion trap mass spectrometer equipped with an electrospray ionization source. The grouping of fragment ion (collision-induced fragmentation) spectra that originated from the same precursor ion and cross-correlation analysis of the data were performed by using the Sequest program (10). The Sequest algorithm compares the measured fragment ion spectra of all selected peptides to the predicted spectra of tryptic peptides that are contained in protein databases (NCBI, OWL, and NRDB) and that exhibit the same molecular weight. Identification of multiple peptides derived from the same protein and evaluation of their cross-correlation scores result in unambiguous identification of the protein.

Expression and purification of recombinant glutathione S-transferase (GST)-HP1021.

Plasmid pGEX-1021 was constructed by ligating an 895-bp BamHI-EcoRI fragment encoding HP1021 which was PCR amplified from chromosomal DNA of H. pylori 26695 with primer pair GST1021-5/GST1021-3 into BamHI-EcoRI-digested pGEX-3X vector DNA (Amersham Biosciences), creating an in-frame fusion to the gene encoding GST. The GST fusion protein derived from pGEX-1021 was produced in E. coli DH5α. Bacteria were grown in 1 liter of LB broth at 37°C to an OD600 of 0.5. Protein expression then was induced by the addition of 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG), followed by further incubation for 3 h at 30°C. Purification of GST-HP1021 by affinity chromatography on glutathione-Sepharose 4B (Amersham Biosciences) was performed essentially as described previously (5).

Electrophoretic mobility shift assay (EMSA).

DNA fragments of 210 and 234 bp encompassing the upstream regions of hyuA (hp0695) and katA (hp0875), respectively, were PCR amplified with primer pairs BShyuA-5/BShyuA-3 and BSkatA-5/BSkatA-3 and chromosomal DNA of H. pylori 26695 as the template. The PCR fragments were 5′ end labeled with [γ-32P]ATP with T4 polynucleotide kinase (MBI Fermentas) and purified with MicroSpin S-200 HR columns (Amersham Biosciences). The recombinant GST-HP1021 protein was diluted in dilution buffer (2 mM MgCl2, 50 mM KCl, 10 mM DTT, 0.1% Igepal CA 630). Increasing amounts of the protein were added to approximately 15,000 cpm of the labeled DNA probe in a final volume of 20 μl of binding buffer (10 mM Tris-HCl [pH 8.0], 10 mM KCl, 5 mM EDTA, 1 mM DTT, 1% glycerol), and the samples were incubated for 30 min at room temperature and then loaded onto a nondenaturing 4% polyacrylamide gel. Gels were run for 2.5 h at 150 V. Gels were vacuum dried, and bands were visualized by phosphorimaging (Typhoon 9200 Variable Mode Imager). A DNA fragment comprising the promoter of the cagA gene which was amplified with primer pair Pcag-5/Pcag-3 from chromosomal DNA of H. pylori 26695 was used as a nonspecific competitor in the EMSA experiments.

Nucleotide sequence accession number.

The microarray raw data obtained in this study were deposited in the NCBI Gene Expression Omnibus database (GEO; http://www.ncbi.nlm.nih.gov/geo) under accession number GSE 5971.

RESULTS

Whole-genome transcriptional profiling of an hp1021 null mutant of H. pylori 26695.

In order to characterize the regulon controlled by the response regulator HP1021, a transcriptome analysis was performed with a whole-genome microarray containing 1,649 PCR products generated with specific primer pairs derived from the genome sequences of H. pylori 26695 (35) and J99 (2) and comprising 98% of the coding sequences present in both genomes (14). RNA was prepared from two independent cultures of H. pylori 26695 and the isogenic hp1021 null mutant 26695/HP1021::km, respectively, grown to an OD550 of 0.75. Cy5- and Cy3-labeled cDNA was synthesized from these RNAs, and the differentially labeled cDNA pairs derived from the H. pylori wild-type and hp1021 null mutant strains were hybridized to four independent microarray slides, creating eight sets of hybridization data. A total of 79 genes were found to be differentially expressed in the hp1021 null mutant when a signal ratio cutoff of <0.5 and >2.0 was applied (Table 2). Transcription of 51 genes was reduced in the mutant including 17 genes encoding ribosomal proteins and the tsf gene encoding translation elongation factor EF-Ts, which is cotranscribed with rps2. The remaining genes which are positively controlled by HP1021 comprise mainly metabolic genes including nifS and nifU, which are involved in the synthesis of iron-sulfur clusters; genes encoding transport proteins; and genes encoding proteins of unknown function. The transcription of 28 genes, half of which encode proteins of unknown function, was derepressed in the mutant, suggesting negative regulation by the HP1021 protein. The regulatory effects detected in the microarray analysis were modest in the majority of cases, with only 10 genes showing an at least fourfold change in the amount of transcript in the HP1021 null mutant. Six of these highly regulated genes are part of two transcriptional units, i.e., hp0690 to hp0693 and hp0695 to hp0697, and are annotated as ORFs encoding succinyl coenzyme A (CoA):acetoacetate-CoA-transferase subunits A and B (hp0691 and hp0692), a predicted short-chain fatty acid transporter (hp0693), hydantoin utilization protein A (hp0695, hyuA), N-methylhydantoinase (hp0696), and a hypothetical protein (hp0697). Hydantoinases are microbial enzymes which catalyze the hydrolysis of the cyclic amide bonds of substituted pyrimidines and hydantoins to form the corresponding N-carbamyl amino acid (18), and therefore HP0695 and HP0696 were expected to be involved in amino acid biosynthesis (35). Transcription of the first gene in the hp0690-to-hp0693 operon encoding acetyl-CoA-acetyltransferase (hp0690, fadA) was downregulated about twofold in the hp1021 null mutant. FadA was suggested to be involved in fatty acid biosynthesis in H. pylori (17). The other highly regulated genes encode an outer membrane protein (hp0025), a predicted S-adenosylmethionine-dependent methyltransferase (hp0747), catalase (hp0875, katA), and the iron(III) dicitrate receptor protein FecA (hp1400), which is the only highly regulated gene under negative control of HP1021.

TABLE 2.

HP1021-activated and -repressed genes

Category and ORF HP no.b ORF JHP no.b Δhp1021/wild-type ratio Function, genec Genome organizationd Regulation by acid or ArsR∼P (reference[s])e
HP1021-activated genesa
    Amino acid biosynthesis
        HP0695 JHP0633 0.06 Hydantoin utilization protein A, hyuA op hp0695-hp0697 + (39), − (20)
        HP0696 JHP0632 0.08 Predicted N-methylhydantoinase op hp0695-hp0697
    Biosynthesis of cofactors, prosthetic groups, and carriers
        HP0220 JHP0206 0.39 Synthesis of [Fe-S] cluster, nifS op hp0220-hp0221
        HP0221 JHP0207 0.37 NifU scaffold protein involved in [Fe-S] cluster assembly op hp0220-hp0221
    Cell envelope
        HP0025 JHP0021 0.19 Outer membrane protein, omp2 (hopD) m + (39)
        HP1564 JHP1472 0.36 Outer membrane lipoprotein m + (30)
    Cellular processes
        HP0875 JHP0809 0.25 Catalase, katA m + (30, 39)
        HP0303 JHP0288 0.43 Predicted GTP-binding protein of the GTP1/Obg family involved in stress response op hp0298-hp0304
        HP0630 JHP0573 0.48 Predicted modulator of drug activity m
    Energy metabolism
        HP0691 JHP0637 0.18 Succinyl-CoA:acetoacetate-CoA-transferase subunit A, scoA (yxjD) op hp0690-hp0693
        HP0692 JHP0636 0.18 Succinyl-CoA:acetoacetate-CoA-transferase subunit B, scoB (yxjE) op hp0690-hp0693 + (39)
        HP1104 JHP1030 0.49 Predicted mannitol dehydrogenase m + (30, 39)
        HP1398 JHP1428 0.41 Alanine dehydrogenase, ald m − (30)
    Fatty acid and phospholipid metabolism
        HP0090 JHP0083 0.36 Predicted malonyl coenzyme A-acyl carrier protein transacylase, fabD op hp0090-hp0089
        HP0690 JHP0638 0.47 Predicted acetyl coenzyme A acetyltransferase, fadA op hp0690-hp0693 + (39)
    Central intermediary metabolism
        HP0089 JHP0082 0.46 Predicted 5′-methylthioadenosine nucleosidase/ S-adenosylhomocysteine nucleosidase, pfs op hp0090-hp0089
        HP1186 JHP1112 0.42 Carbonic anhydrase m + (39), − (20)
    Protein fate
        HP1299 JHP1219 0.39 Predicted methionine amino peptidase op hp1320-hp1292?
        HP1300 JHP1220 0.41 Predicted preprotein translocase subunit op hp1320-hp1292?
    Transcription, transcription factors, and translation
        HP1514 JHP1407 0.45 Transcription termination factor, nusA m
        HP1301 JHP1221 0.44 Ribosomal protein, rpl15 op hp1320-hp1292?
        HP1302 JHP1222 0.47 Ribosomal protein, rps5 op hp1320-hp1292?
        HP1303 JHP1223 0.48 Ribosomal protein, rpl18 op hp1320-hp1292? − (39)
        HP1304 JHP1224 0.34 Ribosomal protein, rpl6 op hp1320-hp1292?
        HP1305 JHP1225 0.37 Ribosomal protein, rps8 op hp1320-hp1292? − (39)
        HP1306 JHP1226 0.45 Ribosomal protein, rps14 op hp1320-hp1292?
        HP1307 JHP1227 0.40 Ribosomal protein, rpl5 op hp1320-hp1292? − (39)
        HP1308 JHP1228 0.39 Ribosomal protein, rpl24 op hp1320-hp1292?
        HP1309 JHP1229 0.44 Ribosomal protein, rpl14 op hp1320-hp1292? − (39)
        HP1310 JHP1230 0.44 Ribosomal protein, rps17 op hp1320-hp1292?
        HP1313 JHP1233 0.34 Ribosomal protein, rps3 op hp1320-hp1292?
        HP1314 JHP1234 0.37 Ribosomal protein, rpl22 op hp1320-hp1292?

To confirm the data from the microarray analysis, transcription of fadA (hp0690), hyuA (hp0695), and nifS (hp0220) was investigated by primer extension experiments performed with RNA extracted from H. pylori wild-type strain 26695 and its isogenic hp1021 null mutant. As shown in Fig. 1, the transcriptional start site of fadA was mapped to position −106 with respect to the translational start codon. Transcription of hyuA started at position −39. The upstream sequences of fadA and hyuA revealed −10 promoter hexamers with the sequences AAAAAT and TATACT, respectively, exhibiting two mismatches and one mismatch compared to the E. coli −10 consensus promoter element. The nifS-specific transcript was found to comprise a long untranslated leader sequence, since the transcription initiation site was mapped between positions −245 and −252 with respect to the translational start site. In the hp1021 null mutant, transcription of fadA and nifS was clearly reduced and no hyuA-specific transcript could be detected, corroborating the role of HP1021 as a positive regulator of the hp0690-to-hp0693, hp0695-to-hp0697, and nifS-nifU operons (Fig. 1). Furthermore, transcription of the katA gene was monitored by RNA slot blot analysis and, in agreement with the microarray data, was found to be strongly decreased in the hp1021 null mutant, confirming positive regulation by HP1021.

FIG. 1.

FIG. 1.

Analysis of transcription of fadA (A), hyuA (B), nifS (C), and katA (D) by primer extension and RNA slot blot hybridization. (A, B, and C) Primer extension experiments with radiolabeled oligonucleotides fadA-PE (A), hyuA-PE (B), and nifS-PE (C), respectively, were performed on equal amounts of RNAs extracted from H. pylori 26695 (lane 1) and 26695/HP1021::km (lane 2), which were grown to the late logarithmic phase in BHI broth. The respective cDNAs are indicated by an arrow on the right. The sequences of the −10 elements of the PfadA and PhyuA promoters are given on the left. The sequencing ladders (lanes T, G, C, and A) were obtained by annealing primers fadA-PE, hyuA-PE, and nifS-PE to plasmids pSL-fadAprom, pSL-hyuAprom, and pSL-nifSprom, respectively. (D) RNA slot blot hybridization carried out with equal amounts of RNAs extracted from H. pylori 26695 (lane 1) and 26695/HP1021::km (lane 2). Hybridization was performed with katA- and 16S rRNA-specific probes as indicated on the right. WT, wild type.

Analysis of the protein expression pattern of the hp1021 null mutant of H. pylori 26695.

To further confirm the microarray data, comparative 2D gel electrophoresis was performed with whole-cell protein lysates prepared from H. pylori 26695 and its HP1021-deficient derivative 26695/HP1021::km grown in liquid culture to the late logarithmic growth phase with an immobilized pH gradient ranging from 6 to 9 for isoelectric focusing. In silver-stained gels, 12 protein spots were reproducibly found to be missing or appeared less prominent when samples from the hp1021 null mutant were analyzed (Fig. 2). Five of the differentially expressed proteins could be identified by mass spectrometry following the excision of the respective spot from colloidal Coomassie-blue stained gels (legend to Fig. 2). As expected, the response regulator HP1021 was not produced in the deletion mutant 26695/HP1021::km (spot 10, Fig. 2). The two most intense spots were identified as hydantoin utilization protein A (HyuA; spot 1, Fig. 2) and acetyl-CoA-acetyltransferase (FadA; spot 8, Fig. 2). Furthermore, catalase (KatA; spot 4, Fig. 2) was identified as an HP1021-regulated protein. The fifth protein spot represented 7-α-hydroxysteroid dehydrogenase (HP1014; spot 11, Fig. 2). While differential expression of FadA, HyuA, and KatA on the protein level is in agreement with the results from transcriptional profiling of H. pylori 26695 and its isogenic hp1021 null mutant (Table 2; Fig. 1), no significant differences in the amount of transcript of ORF hp1014 were noted in the microarray analysis, suggesting that posttranscriptional regulation is involved in the control of its expression.

FIG. 2.

FIG. 2.

Two-dimensional map of whole-cell protein lysates of H. pylori 26695 (A) and 26695/HP1021::km (B). Fifty micrograms of protein was separated by 2D gel electrophoresis with an immobilized pH gradient ranging from 6 to 9 for isoelectric focusing. After separation in the second dimension with 12% SDS polyacrylamide gels, the protein spots were visualized by silver staining. The positions of molecular weight (MW) marker proteins and their molecular masses (in kilodaltons) are indicated on the right. Proteins which are differentially expressed in H. pylori 26695 and 26695/HP1021::km are indicated by arrows. Proteins corresponding to the following spot numbers were identified by liquid chromatography-mass spectrometry: spot 1, hydantoin utilization protein A (HP0695, HyuA), 78.5 kDa; spot 4, catalase (HP0875, KatA), 58.6 kDa; spot 8, acetyl-CoA-acetyltransferase (HP0690, FadA), 41.1 kDa; spot 10, response regulator HP1021, 35.2 kDa; spot 11, 7-α-hydroxysteroid dehydrogenase (HP1014), 28.5 kDa. WT, wild type.

Reintegration of ORF hp1021 into the HP1021-deficient mutant restores the wild-type transcription profile.

To ensure that the differences in the transcription profile of the hp1021 null mutant of H. pylori 26695 are due to the deletion of the response regulator gene and not to secondary-site mutations, ORF hp1021 was reintegrated into the null mutant strain. For this purpose, the kanamycin resistance cassette replacing ORF hp1021 in parental strain 26695/HP1021::km was replaced with the response regulator gene flanked by a downstream chloramphenicol resistance gene by allelic-exchange mutagenesis, restoring the htrA-hp1020-hp1021 operon. Expression of HP1021 in complemented strain 26695/Δ1021com was checked by Western blot analysis with a polyclonal rabbit antiserum raised against recombinant response regulator protein HP1021 (22) and was found to be similar to that in wild-type strain 26695 (Fig. 3A). When transcription of hyuA, fadA, nifS, and katA was analyzed by primer extension or RNA slot blot analysis in the 26695 wild-type strain, the hp1021 null mutant strain, and its complemented derivative 26695/Δ1021com, similar amounts of transcript were detected in the wild-type and complemented strains (Fig. 3 and data not shown), demonstrating that the reduced expression of these genes in the hp1021 null mutant in fact is caused by the inactivation of the response regulator.

FIG. 3.

FIG. 3.

Analysis of the expression of response regulator HP1021 (A) and of selected target genes (B and C) in complemented strain H. pylori 26695/Δ1021com. (A) Immunoblot analysis of equal amounts of whole-cell protein prepared from H. pylori 26695 (lane 1), 26695/HP1021::km (lane 2), and 26695/Δ1021com (lane 3) grown to the late logarithmic phase in BHI broth with a polyclonal rabbit antiserum directed against response regulator HP1021. The position of the HP1021 protein is indicated on the right. (B) Primer extension analysis with radiolabeled oligonucleotide hyuA-PE was performed with equal amounts of RNAs extracted from H. pylori 26695 (lane 2), 26695/HP1021::km (lane 3), and 26695/Δ1021com (lane 1), which were grown to the late logarithmic phase in BHI broth. The hyuA-specific cDNA is indicated by an arrow on the right. (C) RNA slot blot hybridization was performed with equal amounts of RNAs extracted from H. pylori 26695 (lane 2), 26695/ HP1021::km (lane 3), and 26695/Δ1021com (lane 1) and fadA- and katA-specific probes. Hybridization with a 16S RNA-specific probe was carried out as a control. WT, wild type.

HP1021 binds directly to the promoters of the hyuA and katA genes.

To investigate whether response regulator HP1021 directly controls the transcription of the highly regulated hyuA and katA genes, gel retardation experiments were performed. When increasing amounts of purified recombinant HP1021 C terminally fused to GST were added to a 210-bp DNA probe comprising the promoter region of the hyuA gene, four retarded complexes were observed in the presence of protein amounts ranging up to 200 ng and corresponding to a protein concentration of 160 nM. At higher protein concentrations, the two complexes exhibiting the highest electrophoretic mobility disappeared (Fig. 4A). The specificity of the binding of GST-HP1021 to the hyuA promoter probe was assayed by adding increasing amounts of unlabeled DNA to the binding reaction mixture containing 75 ng of response regulator protein, corresponding to a protein concentration of 60 nM. Complexes 1 to 4 progressively disappeared upon addition of a specific DNA probe, while addition of a 300-fold excess of unspecific DNA caused only a slight decrease in the intensity of the retarded complexes (Fig. 4B), suggesting specific protein-DNA interactions. As a nonspecific competitor, a 217-bp DNA fragment derived from the upstream region of the cagA gene was used. Two retarded complexes were detected upon addition of GST-HP1021 to the 234-bp DNA probe encompassing the upstream region of the katA gene. These complexes were competed by the addition of a specific DNA probe but were largely retained when nonspecific competitor DNA was included in the binding reaction mixture (data not shown). From these results, we conclude that transcription of both hyuA and katA is positively controlled by the direct binding of response regulator HP1021 to the respective promoter regions.

FIG. 4.

FIG. 4.

Binding of GST-HP1021 to the promoter region of the hyuA gene. (A) EMSA of GST-HP1021 on a radioactively labeled 210-bp DNA probe comprising the upstream region of hyuA. Lane 1 contains the labeled DNA probe, while in lanes 2 to 8 increasing amounts of GST-HP1021 were added to the probe. The amounts (in nanograms) of protein used are indicated above the lanes and correspond to protein concentrations of 40, 60, 80, 160, 480, 640, and 800 nM. (B) Specific and nonspecific competition for the binding of GST-HP1021 to the hyuA promoter probe. Lanes 1 and 11 contain the labeled DNA probe. In lanes 2 to 5, 25, 37.5, 50, and 75 ng of GST-HP1021 were added, resulting in protein concentrations of 20, 30, 40, and 60 nM. Specific competition was performed by adding 10-fold, 30-fold, 50-fold, 100-fold, and 150-fold excesses of the unlabeled 210-bp hyuA promoter fragment to binding reaction mixtures containing 15,000 cpm (22 fmol) of the labeled probe and 75 ng of GST-HP1021 (lanes 6 to 10). In lane 13, a 300-fold excess of a 217-bp DNA fragment derived from the promoter of the cagA gene was added as a nonspecific competitor to a binding reaction mixture containing 15,000 cpm (22 fmol) of the labeled probe and 75 ng of GST-HP1021 (lane 12). Thin arrows to the right or left of the panels indicate the labeled DNA promoter probes. Thick arrows indicate protein-DNA complexes.

DISCUSSION

HP1021 is an orphan response regulator with a DNA-binding output domain which carries an atypical serine residue at the canonical receiver phosphorylation site. It is unclear whether the activity of the orphan response regulator HP1021 is modulated in response to external or internal stimuli. We have shown previously that the atypical serine residue at the canonical receiver phosphorylation site is not a prerequisite for the cell growth-associated functions of HP1021 (31). In order to identify genes which are controlled by HP1021, we performed comparative whole-genome transcriptional profiling of the H. pylori 26695 wild-type strain and the isogenic hp1021 null mutant grown under standard culture conditions. The amount of transcript of 79 genes differed more than twofold between the wild-type strain and the hp1021 null mutant with 51 and 28 genes, respectively, being more efficiently transcribed in either the wild-type strain or the hp1021 null mutant (Table 2), indicating that response regulator HP1021 is active as a transcriptional regulator in H. pylori strains grown under standard culture conditions. Among the 51 genes whose transcription is reduced in the hp1021 null mutant, 17 genes encoding ribosomal proteins and ORF hp1555 (tfs) encoding translation elongation factor EF-ts were found. Differential expression of these genes possibly is not due to their direct regulation by response regulator HP1021 but might be the consequence of a general growth retardation which is observed upon response regulator inactivation (5, 19). Downregulation of the ribosomal gene cluster hp1320-hp1292 and of tfs was also observed when H. pylori switches from the logarithmic to the stationary growth phase (34). However, only 5 (hp0229, hp0630, hp0140, hp0686, and hp1400) of the other 60 genes which were reported to undergo significant changes in their expression patterns upon entry into stationary phase (34) were also detected in the present study. Of these, fecA1 (hp0686) and fecA3 (hp1400) showed the opposite regulation upon entry into stationary phase and in the hp1021 null mutant. Interestingly, transcription of the nifS and nifU genes, whose products are involved in the formation of Fe-S clusters required for the proper function of several H. pylori enzymes, is positively regulated by HP1021. Inactivation of HP1021 reduced the amount of nifS-specific transcript about twofold (Table 2; Fig. 1). NifS donates sulfur via an l-cysteine desulfurase activity, while NifU provides a scaffold onto which the nascent Fe-S cluster is assembled (40). The cluster maturation proteins are considered “housekeeping” factors, and consequently, nifS and nifU, which encode the only such proteins of H. pylori, were shown to be absolutely required for its viability (25). Therefore, downregulation of these genes in the hp1021 null mutant might contribute to the observed growth defect. Recently, Alamuri et al. (1) reported that the nifS-nifU operon is upregulated in the presence of excess oxygen or iron and that this regulation is dependent on the Fur repressor. However, it should be noted that in the study of Alamuri et al. with H. pylori strain HP43504, a different transcription initiation site close to the translational start codon of the nifS gene was mapped (1).

Forty of the genes differentially expressed in the hp1021 null mutant (ribosomal genes excluded) were also reported to be regulated in response to an acidic pH (7, 20, 30, 39), including five ORFs encoding outer membrane proteins (hp0025, hp0229, hp0722, hp0725, and hp1564), as well as hp0875 (katA) encoding catalase. According to microarray analysis, the ArsRS two-component system is involved in the regulation of 19 of these genes (30). Expression of HP1021 itself is induced in response to an acidic pH (20; M. Bathon, M. Pflock, and D. Beier, unpublished data), and therefore elevated amounts of response regulator protein might cause an increased regulatory effect on its target genes under these conditions. However, there is no clear-cut correlation regarding the acid-responsive induction or repression of genes which are positively or negatively controlled by HP1021 (Table 2).

Only 10 genes showed more-than-fourfold regulation in the hp1021 null mutant. According to the genome annotation of H. pylori 26695, six of these strongly regulated genes belong to operons hp0690 to hp0693 and hp0695 to hp0697 and encode succinyl-CoA-transferase subunits A and B (hp0691 and hp0692), a predicted short-chain fatty acid transporter (hp0693), hydantoin utilization protein A (hp0695, hyuA), N-methylhydantoinase (hp0696), and a hypothetical protein (hp0697). Semiquantitative primer extension analysis confirmed the reduced transcription of hyuA and also of hp0690 (fadA) encoding acetyl-CoA acetyltransferase in the hp1021 null mutant (Fig. 1), which was decreased 16-fold and 2-fold, respectively, in the microarray experiments. By RNA slot blot hybridization, we detected clearly reduced amounts of katA-specific mRNA in the 26695 mutant lacking HP1021, which is in accordance with the fourfold decrease in katA transcription observed by whole-genome transcriptional profiling. These results were corroborated by 2D gel electrophoresis of whole-cell protein lysates of H. pylori 26695 wild-type and mutant strains grown under standard culture conditions where decreased expression of HyuA, FadA, and catalase was detected in the hp1021 null mutant (Fig. 2).

Complementation experiments with a derivative of the hp1021 null mutant of H. pylori 26695 into which the response regulator allele was reintegrated demonstrated that the reduced transcription of the hp0690-to-hp0693 and hp0695-to-hp0697 operons and of katA in the null mutant is due to the deletion of the response regulator gene hp1021 and not to secondary-site mutations which might have occurred during allelic-exchange mutagenesis, since transcription of fadA, hyuA, and katA was fully restored in the complemented strain (Fig. 3). Moreover, microarray analysis of the complemented strain showed that, with the exception of four genes, all of the genes being differentially expressed in the hp1021 null mutant were transcribed in 26695/Δ1021com to a similar rate as in the 26695 wild-type strain (data not shown).

In vitro DNA binding experiments indicated that transcription of hyuA and katA is regulated directly by the binding of the response regulator HP1021 to the upstream regions of these genes (Fig. 4 and data not shown). Up to four protein-DNA complexes were detected in EMSA experiments with the hyuA promoter probe. Incubation of HP1021 with a katA promoter probe yielded two DNA-protein complexes which, however, were less distinct. These results suggest that HP1021 forms multimeric complexes when binding to the promoter DNA. Comparison of the promoter regions of hyuA, fadA, nifS, and katA mapped by primer extension analysis (Fig. 1) (24) revealed no pronounced similarity. Additional studies are required to unravel the DNA binding properties of response regulator HP1021.

Blast analysis showed that ORFs hp0695 (hyuA) and hp0696, which are annotated as hydantoin utilization protein A and a predicted N-methylhydantoinase, also share significant identity with the β and α subunits of acetone carboxylase, respectively. Furthermore, ORF hp0967, annotated as a hypothetical protein, shows similarity to acetone carboxylase subunit γ. Since in both Xanthobacter autotrophicus and Rhodobacter capsulatus, from which acetone carboxylases have been purified and characterized, the genes encoding the subunits of the enzyme are organized in an operon in the order β, α, and γ (32), and the same order of putative genes is present in the hp0695-to-hp0697 operon, it is very likely that this operon encodes the subunits of an acetone carboxylase of H. pylori, as previously suggested by Sluis et al. (32). Acetone carboxylase converts acetone to acetoacetate (11), which might be further metabolized to acetyl-CoA by enzymatic reactions catalyzed by the gene product of the hp0690-to-hp0693 operon, i.e., the A and B subunits of succinyl-CoA:acetoacetate-CoA-transferase (hp0691 and hp0692, respectively), which converts acetoacetate to acetoacetyl-CoA and acetyl-CoA acetyltransferase or thiolase (fadA, hp0690), cleaving acetoacetyl-CoA to acetyl-CoA. Succinyl-CoA:acetoacetate-CoA-transferase activity has already been detected in lysates of H. pylori (8). Interestingly, orthologs of the genes hp0690 to hp0693 and hp0695 to hp0697 are only present in the genomes of gastric Helicobacter species (2, 12, 35) but are missing in H. hepaticus and the closely related organisms C. jejuni and W. succinogenes (4, 27, 33). The presence of acetone, which is a toxic compound, is not a completely unphysiologic condition for H. pylori, since in fasting individuals and patients suffering from diabetes acetone can accumulate to millimolar concentrations in the blood (15) and probably also in the gastric juice. Therefore, it is conceivable that the gene products of the hp0690-to-hp0693 and hp0695-to-hp0697 operons might enable H. pylori to detoxify acetone and/or to use this compound as an additional carbon source under nutrient-limiting conditions. Studies addressing the influence of acetone on the growth of H. pylori 26695 and its isogenic hp1021 null mutant are currently ongoing in our laboratory.

In contrast to the homologous enzyme of H. pylori, the acetone carboxylases of X. autotrophicus and R. capsulatus are highly expressed only upon exposure of the bacteria to acetone. Transcription of the acetone carboxylase genes of X. autotrophicus is dependent on σ54 and a σ54-dependent transcriptional activator protein, while the homologous regulator protein in R. capsulatus is likely to interact with the σ70-dependent RNA polymerase. In both X. autotrophicus and R. capsulatus, the gene encoding the transcriptional regulators is located upstream of the respective acetone carboxylase operon and it is expected that acetone binds as a cofactor to the N-terminal regions of these regulators (32). Since close orthologs of the orphan response regulator HP1021 are present in all sequenced ɛ-proteobacteria while the genes hp0690 to hp0693 and hp0695 to hp0697 are only found in stomach-colonizing Helicobacter species, we hypothesize that in the course of their evolution these genes were integrated into a preexisting HP1021 regulon of a common ancestor.

Table 2a.

        HP1315 JHP1235 0.39 Ribosomal protein, rps19 op hp1320-hp1292?
        HP1316 JHP1236 0.35 Ribosomal protein, rpl2 op hp1320-hp1292? − (39)
        HP1318 JHP1238 0.47 Ribosomal protein, rpl4 op hp1320-hp1292? − (39)
        HP1319 JHP1239 0.48 Ribosomal protein, rpl3 op hp1320-hp1292? − (39)
        HP1554 JHP1445 0.28 Ribosomal protein, rps2 op hp1454-hp1455
        HP1555 JHP1444 0.36 Translation elongation factor EF-Ts op hp1454-hp1455
    Transport and binding proteins
        HP0140 JHP0128 0.30 Predicted l-lactate permease, lctP op 0140-hp0141? − (7)
        HP0299 JHP0284 0.35 Predicted dipeptide permease protein, dppB op hp0298-hp0304 + (39), − (7)
        HP0300 JHP0285 0.37 Predicted dipeptide transport system permease protein, dppC op hp0298-hp0304 + (39)
        HP0302 JHP0287 0.35 Predicted dipeptide transport system permease protein, dppF op hp0298-hp0304 + (39)
        HP0693 JHP0635 0.24 Predicted short-chain fatty acid transporter op hp0690-hp0693 + (39)
        HP1181 JHP1107 0.47 Predicted multidrug efflux transporter op hp1181-hp1182 − (39)
    Unknown
        HP0747 JHP0684 0.21 Predicted S-adenosylmethionine-dependent methyltransferase op hp0745-hp0750?
    Hypothetical
        HP0697 JHP0631 0.07 Conserved hypothetical protein op hp0695-hp0697 + (39)
        HP0902 JHP0839 0.42 Conserved hypothetical protein op hp0902-hp0901
        HP0423 0.43 Hypothetical protein op hp0427-hp0423? + (7, 30)
        HP0699 JHP0639 0.48 Hypothetical protein op hp0698-hp0703
        HP0874 JHP0808 0.29 Hypothetical protein m? + (39)
        HP1412 JHP1307 0.40 Hypothetical protein op hp1408-hp1412? + (30, 39)
HP1021-repressed genesa
    Ammonia production
        HP0070 JHP0065 2.94 Urease accessory protein, ureE op hp0071-hp0067 + (30, 39)
        HP1238 JHP1559 2.80 Aliphatic amidase, amiF m + (7, 20, 30)
    Biosynthesis of cofactors, prosthetic groups, and carriers
        HP0306 JHP0291 2.24 Glutamate-1-semialdehyde 2,1-aminomutase, hemL op hp0305-hp0308 + (20, 30, 39)
    Cell envelope
        HP0229 JHP0214 2.49 Outer membrane protein, omp6 (hopA) m − (7, 20, 30, 39)
        HP0722 JHP0659 2.69 Outer membrane protein, omp16 (hopO) m − (7, 20, 30)
        HP0725 JHP0662 3.77 Outer membrane protein, omp17 (hopP) m − (7, 20, 30)
        HP1083 JHP0342 2.40 Predicted outer membrane protein, hofB m − (30)
    Energy metabolism
        HP0954 JHP0888 2.65 NAD(P)H-dependent nitroreductase op hp0966-hp0954? + (30)
        HP1399 JHP1427 2.52 Arginase, rocF m + (39), − (30)
    Fatty acid and phospholipid metabolism
        HP0950 JHP0844 2.87 Predicted acetyl-coenzyme A carboxylase carboxyl transferase subunit beta, accD op hp0950-hp0948 + (39)
    Transport and binding proteins
        HP0686 JHP0626 2.32 Iron(III) dicitrate transport protein, fecA1 m − (30)
        HP1400 JHP1426 4.33 Iron(III) dicitrate transport protein, fecA3 m − (7)
        HP1174 JHP1101 3.42 Glucose/galactose transporter m − (30)
    Pathogenesis
        HP0967 2.13 Predicted virulence-associate protein D m
    Hypothetical
        HP1242 JHP1163 2.59 Conserved hypothetical protein m
        HP0966 JHP0900/JHP0901 2.42 Conserved hypothetical protein op hp0966-hp0954?
        HP1334 3.86 Conserved hypothetical protein m − (39)
        HP0937 JHP0872 2.22 Conserved hypothetical protein m? + (39)
        HP0938 JHP0873 3.14 Conserved hypothetical protein m?
        HP0948 JHP0882 2.07 Conserved hypothetical protein op hp0950-hp0948 + (39)
        HP0946 JHP0880 2.12 Conserved hypothetical integral membrane protein m
        HP0097 JHP0089 2.10 Hypothetical protein m − (20, 39)
        HP0242 JHP0227 2.97 Hypothetical protein op hp0243-hp0236? + (30, 39)
        HP0945 3.73 Hypothetical protein m
        HP0947 JHP0881 2.83 Hypothetical protein m − (30)
        HP0953 JHP0887 2.08 Hypothetical protein m? + (39)
        HP0990 JHP0938 2.12 Hypothetical protein m + (39)
        HP0992 2.41 Hypothetical protein m
a

Genes listed are those whose transcription, according to microarray analysis, differed more than twofold (ratio of >2.0 and <0.5) in the HP0121-deficient mutant H. pylori 26695/HP1021::km compared to the 26695 wild-type strain.

b

ORF numbers and prediction of transcriptional units are according to the genome sequences of H. pylori 26695 and J99 (2, 35).

c

The functional annotation is that used by the PyloriGene database (http://www.pasteur.fr/english.html).

d

m indicates monocistronically transcribed genes, and op indicates putative transcriptional units. A question mark indicates that the proposed operon structure cannot be unambiguously deduced from the genome sequence.

e

Where a reference(s) is given, pH-responsive transcription or ArsR∼P-dependent regulation was reported by Merrell et al. (20), Wen et al. (39), Bury-Moné et al. (7), or Pflock et al. (30). A plus sign denotes positive regulation by a low pH or ArsR∼P, and a minus sign denotes negative regulation by a low pH or ArsR∼P.

Acknowledgments

Armin Bosserhoff is acknowledged for performing mass spectrometry. We thank María-Antonieta Jiménez-Pearson and Frederike Fritsch for constructing plasmids pGEX-1021 and pSL-nifSprom, Biju Joseph for help with microarray data analysis, and Roy Gross for critically reading the manuscript.

This work was supported by the BMBF Competence Network PathoGenoMik.

Footnotes

Published ahead of print on 12 January 2007.

This paper is dedicated to Werner Goebel on the occasion of his retirement.

REFERENCES

  • 1.Alamuri, P., N. Mehta, A. Burk, and R. J. Maier. 2006. Regulation of the Helicobacter pylori Fe-S cluster synthesis protein NifS by iron, oxidative stress conditions, and Fur. J. Bacteriol. 188:5325-5330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Alm, R. A., L.-S. L. Ling, D. T. Moir, B. L. King, E. D. Brown, P. C. Doig, D. R. Smith, B. Noonan, B. C. Guild, B. L. deJonge, G. Carmel, P. J. Tummino, A. Caruso, M. Uria-Nickelsen, D. M. Mills, C. Ives, R. Gibson, D. Merberg, S. D. Mills, Q. Jiang, D. E. Taylor, G. F. Vovis, and T. J. Trust. 1999. Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397:176-180. [DOI] [PubMed] [Google Scholar]
  • 3.Appleby, J. L., and R. B. Bourret. 1999. Activation of CheY mutant D57N by phosphorylation at an alternative site, Ser-56. Mol. Microbiol. 34:915-925. [DOI] [PubMed] [Google Scholar]
  • 4.Baar, C., M. Eppinger, G. Raddatz, J. Simon, C. Lanz, O. Klimmek, R. Nandakumar, R. Gross, A. Rosinus, H. Keller, P. Jagtap, B. Linke, F. Meyer, H. Lederer, and S. C. Schuster. 2003. Complete genome sequence and analysis of Wolinella succinogenes. Proc. Natl. Acad. Sci. USA 100:11690-11695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Beier, D., and R. Frank. 2000. Molecular characterization of two-component systems of Helicobacter pylori. J. Bacteriol. 182:2068-2076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Blaser, M. J. 1992. Helicobacter pylori: its role in disease. Clin. Infect. Dis. 15:386-391. [DOI] [PubMed] [Google Scholar]
  • 7.Bury-Moné, S., J.-M. Thiberge, M. Contreras, A. Maitournam, A. Labigne, and H. De Reuse. 2004. Responsiveness to acidity via metal ion regulators mediates virulence in the gastric pathogen Helicobacter pylori. Mol. Microbiol. 53:623-638. [DOI] [PubMed] [Google Scholar]
  • 8.Corthésy-Theulaz, I. E., G. E. Bergonzelli, H. Henry, D. Bachmann, D. F. Schorderet, A. L. Blum, and N. Ornston. 1997. Cloning and characterization of Helicobacter pylori succinyl-CoA:acetoacetate CoA-transferase, a novel prokaryotic member of the CoA-transferase family. J. Biol. Chem. 272:25659-25667. [DOI] [PubMed] [Google Scholar]
  • 9.Delany, I., G. Spohn, R. Rappuoli, and V. Scarlato. 2002. Growth phase-dependent regulation of target gene promoters for binding of the essential orphan response regulator HP1043 of Helicobacter pylori. J. Bacteriol. 184:4800-4810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Eng, J. K., A. L. McCormak, and J. R. Yates, Jr. 1994. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J. Am. Soc. Mass Spectrom. 5:976-989. [DOI] [PubMed] [Google Scholar]
  • 11.Ensign, S. A., F. J. Small, J. R. Allen, and M. K. Sluis. 1998. New roles for CO2 in the microbial metabolism of aliphatic epoxides and ketones. Arch. Microbiol. 169:179-187. [DOI] [PubMed] [Google Scholar]
  • 12.Eppinger, E., C. Baar, B. Linz, G. Raddatz, C. Lanz, H. Keller, G. Morelli, H. Gressmann, M. Achtmann, and S. C. Schuster. 2006. Who ate whom? Adaptive Helicobacter genomic changes that accompanied a host jump from early humans to large felines. PLoS Genet. 2:e120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ferrero, R. L., V. Cussac, P. Courcoux, and A. Labigne. 1992. Construction of isogenic urease-negative mutants of Helicobacter pylori by allelic exchange. J. Bacteriol. 174:4212-4217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gressmann, H., B. Linz, R. Ghai, K.-P. Pleissner, R. Schlapbach, Y. Yamaoka, C. Kraft, S. Suerbaum, T. F. Meyer, and M. Achtmann. 2005. Gain and loss of multiple genes during the evolution of Helicobacter pylori. PLoS Genet. 1(4):e43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kalapos, M. P. 2003. On the mammalian acetone metabolism: from chemistry to clinical implications. Biochim. Biophys. Acta 1621:122-139. [DOI] [PubMed] [Google Scholar]
  • 16.Loh, J. T., and T. L. Cover. 2006. Requirement of histidine kinases HP0165 and HP1364 for acid resistance in Helicobacter pylori. Infect. Immun. 74:3052-3059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Marais, A., G. L. Mendz, S. L. Hazell, and F. Mégraud. 1999. Metabolism and genetics of Helicobacter pylori: the genome era. Microbiol. Mol. Biol. Rev. 63:642-674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.May, O., A. Habenicht, R. Mattes, C. Syldatk, and M. Siemann. 1998. Molecular evolution of hydantoinases. Biol. Chem. 379:743-747. [PubMed] [Google Scholar]
  • 19.McDaniel, T. K., K. C. DeWalt, N. R. Salama, and S. Falkow. 2001. New approaches for validation of lethal phenotypes and genetic reversion in Helicobacter pylori. Helicobacter 6:15-23. [DOI] [PubMed] [Google Scholar]
  • 20.Merrell, D. S., M. L. Goodrich, G. Otto, L. S. Tompkins, and S. Falkow. 2003. pH-regulated gene expression of the gastric pathogen Helicobacter pylori. Infect. Immun. 71:3529-3539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Moore, J. B., S.-P. Shiau, and L. J. Reitzer. 1993. Alterations of highly conserved residues in the regulatory domain of nitrogen regulator I (NtrC) of Escherichia coli. J. Bacteriol. 175:2692-2701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Müller, S., M. Pflock, J. Schär, S. Kennard, and D. Beier. 2007. Regulation of expression of atypical orphan response regulators of Helicobacter pylori. Microbiol. Res. 162:1-14. [DOI] [PubMed] [Google Scholar]
  • 23.Niehus, E., H. Gressmann, F. Ye, R. Schlapbach, M. Dehio, C. Dehio, A. Stack, T. F. Meyer, S. Suerbaum, and C. Josenhans. 2004. Genome-wide analysis of transcriptional hierarchy and feedback regulation in the flagellar system of Helicobacter pylori. Mol. Microbiol. 52:947-961. [DOI] [PubMed] [Google Scholar]
  • 24.Odenbreit, S., B. Wieland, and R. Haas. 1996. Cloning and genetic characterization of Helicobacter pylori catalase and construction of a catalase-deficient mutant strain. J. Bacteriol. 178:6960-6967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Olson, J. W., J. N. Agar, M. K. Johnson, and R. J. Maier. 2000. Characterization of the NifU and NifS Fe-S cluster formation proteins essential for viability in Helicobacter pylori. Biochemistry 39:16213-16219. [DOI] [PubMed] [Google Scholar]
  • 26.Panthel, K., P. Dietz, R. Haas, and D. Beier. 2003. Two-component systems of Helicobacter pylori contribute to virulence in a mouse infection model. Infect. Immun. 71:5381-5385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Parkhill, J., B. W. Wren, K. Mungall, J. M. Ketley, C. Churcher, D. Basham, T. Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. V. Karlyshev, S. Moule, M. J. Pallen, C. W. Penn, M. A. Quail, M.-A. Rajandream, K. M. Rutherford, A. H. M. van Vliet, S. Whitehead, and B. G. Barrell. 2000. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403:665-668. [DOI] [PubMed] [Google Scholar]
  • 28.Peterson, W. L. 1991. Helicobacter pylori and peptic ulcer disease. N. Engl. J. Med. 324:1043-1048. [DOI] [PubMed] [Google Scholar]
  • 29.Pflock, M., P. Dietz, J. Schär, and D. Beier. 2004. Genetic evidence for histidine kinase HP165 being an acid sensor of Helicobacter pylori. FEMS Microbiol. Lett. 234:51-61. [DOI] [PubMed] [Google Scholar]
  • 30.Pflock, M., N. Finsterer, B. Joseph, H. Mollenkopf, T. F. Meyer, and D. Beier. 2006. Characterization of the ArsRS regulon of Helicobacter pylori, involved in acid adaptation. J. Bacteriol. 188:3449-3462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Schär, J., A. Sickmann, and D. Beier. 2005. Phosphorylation-independent activity of atypical response regulators of Helicobacter pylori. J. Bacteriol. 187:3100-3109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Sluis, M. K., R. A. Larsen, J. G. Krum, R. Anderson, W. W. Metcalf, and S. A. Ensign. 2002. Biochemical, molecular, and genetic analyses of the acetone carboxylases from Xanthobacter autotrophicus strain Py2 and Rhodobacter capsulatus strain B10. J. Bacteriol. 184:2969-2977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Suerbaum, S., C. Josenhans, T. Sterzenbach, B. Drescher, P. Brandt, M. Bell, M. Dröge, B. Fartmann, H.-P. Fischer, Z. Ge, A. Hörster, R. Holland, K. Klein, J. König, L. Macko, G. L. Mendz, G. Nyakatura, D. B. Schauer, Z. Shen, J. Weber, M. Frosch, and J. G. Fox. 2003. The complete genome sequence of the carcinogenic bacterium Helicobacter hepaticus. Proc. Natl. Acad. Sci. USA 100:7901-7906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Thompson, L. J., D. S. Merrell, B. A. Neilan, H. Mitchell, A. Lee, and S. Falkow. 2003. Gene expression profiling of Helicobacter pylori reveals a growth-phase-dependent switch in virulence gene expression. Infect. Immun. 71:2643-2655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tomb, J.-F., O. White, A. R. Kerlavage, R. Clayton, G. G. Sutton, R. D. Fleischmann, K. A. Ketchum, H. P. Klenk, S. Gill, B.A. Dougherty, K. Nelson, J. Quackenbush, L. Zhou, E. F. Kirkness, S. Peterson, B. Loftus, D. Richardson, R. Dodson, H. G. Khalak, A. Glodek, K. McKenney, L. M. Fitzegerald, N. Lee, M. D. Adams, E. K. Hickey, D. E. Berg, J. D. Gocayne, T. R. Utterback, J. D. Peterson, J. M. Kelley, M. D. Cotton, J. M. Weidman, C. Fujii, C. Bowman, L. Watthey, E. Wallin, W. S. Hayes, M. Borodovsky, P. D. Karp, H. O. Smith, C. M. Fraser, and J. C. Venter. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539-547. [DOI] [PubMed] [Google Scholar]
  • 36.Uemura, N. S., S. Okamoto, S. Yamamoto, N. Matsumura, S. Yamaguchi, M. Yamakido, K. Taniyama, N. Sasaki, and R. J. Schlemper. 2001. Helicobacter pylori infection and the development of gastric cancer. N. Engl. J. Med. 345:784-789. [DOI] [PubMed] [Google Scholar]
  • 37.Waidner, B., K. Melchers, F. N. Stähler, M. Kist, and S. Bereswill. 2005. The Helicobacter pylori CrdRS two-component regulation system (HP1364/HP1365) is required for copper-mediated induction of the copper resistance determinant CrdA. J. Bacteriol. 187:4683-4688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang, Y., and D. E. Taylor. 1990. Chloramphenicol resistance in Campylobacter coli: nucleotide sequence, expression, and cloning vector construction. Gene 94:23-28. [DOI] [PubMed] [Google Scholar]
  • 39.Wen, Y., E. A. Marcus, U. Matrubutham, M. A. Gleeson, D. R. Scott, and G. Sachs. 2003. Acid-adaptive genes of Helicobacter pylori. Infect. Immun. 71:5921-5939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yuvaniyama, P., J. N. Agar, V. L. Cash, M. K. Johnson, and D. R. Dean. 2000. NifS-directed assembly of a transient [2Fe-2S] cluster within the NifU protein. Proc. Natl. Acad. Sci. USA 97:599-604. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES