Putative Terminase Subunits of Herpes Simplex Virus 1 Form a Complex in the Cytoplasm and Interact with Portal Protein in the Nucleus

Abstract

Herpes simplex virus (HSV) terminase is an essential component of the molecular motor that translocates DNA through the portal vertex in the capsid during DNA packaging. The HSV terminase is believed to consist of the U_L15, U_L28, and U_L33 gene products (pU_L15, pU_L28, and pU_L33, respectively), whereas the HSV type 1 portal vertex is encoded by U_L6. Immunoprecipitation reactions revealed that pU_L15, pU_L28, and pU_L33 interact in cytoplasmic and nuclear lysates. Deletion of a canonical nuclear localization signal (NLS) from pU_L15 generated a dominant-negative protein that, when expressed in an engineered cell line, decreased the replication of wild-type virus up to 80-fold. When engineered into the genome of recombinant HSV, this mutation did not interfere with the coimmunoprecipitation of pU_L15, pU_L28, and pU_L33 from cytoplasmic lysates of infected cells but prevented viral replication, most nuclear import of both pU_L15 and pU_L28, and coimmunoprecipitation of pU_L15, pU_L28, and pU_L33 from nuclear lysates. When the pU_L15/pU_L28 interaction was reduced in infected cells by the truncation of the C terminus of pU_L28, pU_L28 remained in the cytoplasm. Whether putative terminase components localized in the nucleus or cytoplasm, pU_L6 localized in infected cell nuclei, as viewed by indirect immunofluorescence. The finding that the portal and terminase do eventually interact was supported by the observation that pU_L6 coimmunoprecipitated strongly with pU_L15 and weakly with pU_L28 from extracts of infected cells in 1.0 M NaCl. These data are consistent with the hypothesis that the pU_L15/pU_L28/pU_L33 complex forms in the cytoplasm and that an NLS in pU_L15 is used to import the complex into the nucleus where at least pU_L15 and pU_L28 interact with the portal to mediate DNA packaging.

Herpesvirus procapsids and concatameric viral DNA accumulate in the nuclei of infected cells. The procapsids consist of a roughly spherical proteinaceous shell surrounding an inner protein shell or scaffold (16, 24, 36). To initiate DNA packaging, an enzyme called the terminase is believed to scan the viral DNA in search of genomic ends, cleave the concatemer into single genomes, engage the procapsid at a portal vertex designed for the passage of the DNA, and drive the genome into capsids through the hydrolysis of ATP.

Current evidence supports the hypotheses that the herpes simplex virus (HSV) terminase comprises the products of U_L15, U_L28, and U_L33 (pU_L15, pU_L28, and pU_L33, respectively), whereas the portal vertex consists of a dodecamer of the U_L6 protein (pU_L6). These hypotheses are supported by the observations that (i) pU_L6, pU_L15, pU_L28, and pU_L33 are each essential for DNA packaging (2, 5, 25, 26, 34, 44); (ii) epitopes of these proteins are present on the external surface of viral capsids, and at least pU_L15 and pU_L28 are associated with procapsids (23, 31, 41); (iii) pU_L15 interacts with the pU_L28 moiety of a pU_L28/pU_L33 complex in infected cells (9, 18, 19, 43); (iv) pU_L15 contains an ATPase-like motif that is essential for viral replication (13, 45); (v) pU_L28 binds DNA sequences known to be required for the formation of normal DNA termini (1, 17); and (iv) pU_L6 forms a dodecameric ring in vitro with a size and conformation that match the dimensions of capsid vertices and portal vertices of some bacteriophages (23, 37).

The main focus of the current study concerns a key question that distinguishes two models of DNA packaging: specifically, whether the terminase engages the portal vertex in the cytoplasm or in the nucleus. If the terminase were to engage the portal in the cytoplasm, it follows that portal assembly into the procapsid would also incorporate the bound terminase. This would imply that the entire procapsid, with incorporated terminase, would then scan viral DNA in search of genomic ends. On the other hand, if the terminase were imported into the nucleus separately from the portal, it would be free to scan the DNA independently of the procapsid and, once bound to target DNA sequences, could engage the portal vertex for eventual DNA cleavage and translocation into the capsid. The latter mechanism is similar to that used by many bacteriophage terminases (4, 6, 11).

Where the HSV terminase forms in the cell and where the portal and terminase interact have been addressed previously using transient expression assays. For example, transiently expressed pseudorabies virus pU_L28 localizes in the cytoplasm unless coexpressed with HSV type 1 (HSV-1) pU_L15, suggesting that pU_L15 is responsible for the import of the terminase complex (20). On the other hand, pU_L6 was also shown to import pU_L28 into the nucleus when the proteins were coexpressed, and mutations that precluded the nuclear importation of pU_L6 caused coexpressed pU_L15 to remain in the cytoplasm, despite the fact that pU_L15 localizes in infected cell nuclei by 12 h after infection (5, 40, 45). The transient expression assays argue that a terminase/portal complex forms in the cytoplasm and is then incorporated into the nucleus, where it would then presumably form a nidus for procapsid formation. In studies using infected cells, however, pU_L6 was not found to coimmunoprecipitate with pU_L28, pU_L15, or pU_L33 (9, 43). Because the lysis conditions were mild in these studies, it was suggested that the terminase formed in the cytoplasm but that the portal and terminase interacted elsewhere. These interpretations were complicated by (i) the possibility that antibodies can interfere with interactions between proteins and (ii) uncertainty as to whether the lysates in which the interactions occurred were truly derived from the cytoplasm.

The current study clarifies previously described immunoprecipitation results to indicate that the putative terminase complex of pU_L15, pU_L28, and pU_L33 can be efficiently coimmunoprecipitated from lysates derived from either the cytoplasm or the nuclei of infected cells. Although pU_L6 could be coimmunoprecipitated with pU_L15 and pU_L28, these interactions were not detected unless cells were extracted using 1 M NaCl. We also show that pU_L15 contains a simian virus 40 T-antigen-like nuclear localization signal (NLS) required for the normal nuclear import of pU_L15 and pU_L28 in infected cells. This NLS was entirely dispensable for the nuclear import of the U_L6-encoded portal protein, further suggesting that the two complexes, the portal and the terminase, are imported into the nucleus independently of one another.

MATERIALS AND METHODS

Cells and virus.

Hep2 cell lines, Vero cell lines, and CV1 cell lines were obtained from the American Type Culture Collection (ATCC) and were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% newborn calf serum, 100 U/ml penicillin, and 100 μg/ml streptomycin. Flp-In-CV1 cell lines were purchased from Invitrogen and maintained in DMEM supplemented with 10% fetal bovine serum, 100 U of penicillin per ml, 100 μg/ml streptomycin, and 100 μg/ml zeocin. CV15 and CV15M cell lines described herein were cultured in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin, and 200 μg/ml hygromycin. The U_L15 deletion mutant was derived from HSV F strain [HSV-1(F)] (3, 15). The U_L6 null mutant was derived from HSV-1 strain 17 (25). The U_L28 null mutant, U_L28 insertion mutant 74li, and U_L28 truncation mutant 741s were derived from strain HSV-1(Kos) (18, 34). Recombinant viruses vJB12, vJB13, vJB15, vJB16, and vJB19 are described below and in Tables 1 and 2.

TABLE 1.

PCR primers used for constructing recombinant viruses

Primer purpose	Sequencea	Recombinant virus
To delete NLS of UL15 forward	TCCTTCCGGGCCTCCAGC	vJB12, vJB16
	CTCACGGAGACCACGGGC
	GTGGACGTGGCCACCCAC
	TAGGGATAACAGGGTAATCGATTT
To delete NLS of UL15 reverse	CGTGCCGTACGTCCGGCC
	GTGGGTGGCCACGTCCAC
	GCCCGTGGTCTCCGTGAG
	GCCAGTGTTACAACCAATTAACC
To fuse FLAG tag to UL15 C terminus forward	GGACCTCCGCACACATTCGCTCCT	vJB13
	ATCACACGCGTCTCG
	GATTACAAGGATGACGACGATAAG
	TAGGGATAACAGGGTAATCGATTT
To fuse FLAG tag to UL15 C terminus reverse	GTGCGTAGCATACCTGGGTGTGTTTATTGGGCGCTCA
	CTTATCGTCGTCATCCTTGTAATC
	CGAGACGCGTGTGAT
	GCCAGTGTTACAACCAATTAACC
To repair NLS to vJB12 forward	TCCTTCCGGGCCTCCAGC	vJB15, vJB19
	CTCACGGAGACCACGGGC
	CCACCGAAGAAACGGGCCAAG
	TAGGGATAACAGGGTAATCGATTT
To repair NLS to vJB12 reverse	CGTGCCGTACGTCCGGCCGTGGGTGGCCACGTCCAC
	CTTGGCCCGTTTCTTCGGTGG
	GCCCGTGGTCTCCGTGAG
	GCCAGTGTTACTACCAATTAACC

^aUnderlined sequences are identical to the PCR template pEPkan-S; sequences in normal type, double-underlined type, underlined boldface type, double-underlined boldface type, and italic type are different U_L15 sequences. Sequences in boldface type encode either FLAG (construct vJB13) or the U_L15 NLS (constructs vJB15 and vJB19). Sequences in the same type are complementary within primer pairs and were designed according to methods described previously by Tischer et al. (35).

TABLE 2.

Virus replication assay

Virus	Genotype of of UL15	Cell line infected/cell line used to determine yielda	Titerb
HSV-1(F)	WT	Vero/Vero	(2.0 ± 0.55) × 107
HSV-1(F)	WT	CV15/Vero	(2.0 ± 0.4) × 107
HSV-1(F)	WT	CV15M/Vero	(2.5 ± 0.6) × 105
15 null	Δ exon IIc	CV15/CV15	(1.0 ± 0.5) × 107
15 null	Δ exon II	CV15M/CV15	<102
vJB12	ΔNLS	CV15/CV15	(6.1 ± 1.5) × 105
vJB12	ΔNLS	Vero/CV15	<102
vJB13	FLAG tag at C terminus	Vero/Vero	(2.0 ± 0.2) × 107
vJB15	NLS repaired (derived from vJB12)	Vero/Vero	(2.0 ± 1.5) × 107
vJB16	FLAG tag at C terminus, ΔNLS (derived from vJB13)	Vero/CV15	<102
vJB19	FLAG tag at C terminus, NLS repaired (derived from vJB16)	Vero/Vero	(2.2 ± 1.5) × 107

^aThe first listed cell line was infected at 0.01 PFU/cell, and at 24 hpi, the yield of infectious virus produced from pooled extracellular and intracellular fractions was determined on the second listed cell line. CV15 is an engineered complementing cell line expressing wild-type (WT) pU_L15, whereas CV15M was engineered to express pU_L15 lacking the NLS by deletion of codons 182 to 189.

^bVirus titers were determined as described in Materials and Methods. The data represent means ± standard deviations for three independent experiments.

^cDelta (Δ) indicates a deletion of those sequences.

Antibodies.

Separate polyclonal rabbit antisera recognizing the first 35 amino acids of pU_L15 (anti-pU_L15N), the C terminus of pU_L15 (anti-pU_L15C), and the entire pU_L28, pU_L33, and pU_L6 proteins were described previously (5, 9, 28, 29, 33). Anti-FLAG mouse monoclonal antibodies were purchased from Sigma. Anti-lamin A/C mouse monoclonal antibodies were obtained from Santa Cruz Biotechnology. Rabbit polyclonal antibody directed against superoxide dismutase 4 (a cytoplasmic marker protein of 23 kDa) was purchased from Abcam. Anti-ICP35 mouse monoclonal antibody (MCA406) was purchased from Serotec. Goat anti-rabbit immunoglobulin G (IgG) conjugated to Alexa 488 (green) and goat anti-mouse IgG conjugated to Alexa 568 (red) were obtained from Molecular Probes.

Plasmids.

Plasmids pBAD-I-SceI, containing the gene encoding the yeast I-SceI endonuclease, and pEPkan-S, containing aphAI (encoding kanamycin [Kan] resistance) adjacent to an I-SceI restriction site, were gifts from N. Osterrieder, Cornell University. Plasmid pCAGGS-nlsCre, expressing Cre recombinase, was a gift from Michael Kotlikoff, Cornell University. pJB112, containing U_L28 downstream of the human cytomegalovirus (CMV) early promoter/enhancer in pCDNA3, was described previously (43).

To construct pJB437, a PCR amplicon from HSV-1(F) DNA containing the entire U_L6 coding sequence was cloned into pCDNA3 at the BamHI and EcoRI sites such that the gene was under the transcriptional control of the CMV promoter/enhancer. U_L15 genes fused to DNA encoding the FLAG epitope and deletion mutants of the fused gene are indicated in Fig. 2 and were amplified by PCR using pRB4120 (containing a cDNA of the U_L15 gene) as a template, followed by cloning into pCDNA3 at the HindIII and EcoRV sites. The deletions were confirmed by DNA sequencing.

FIG. 2.

Schematic colinear diagram of U_L15 expression plasmids used in the experiment shown in Fig. 3. (A) DNA encoding the indicated codons of U_L15 was fused to a FLAG epitopic tag (). A boldface line indicates colinear codons within each expression plasmid, whereas the numbers above each line indicate the first and last codons of each segment. Each construct was cloned into the mammalian expression vector pcDNA3.

To transfer U_L15 cDNA into a defined site within CV1 cells, a shuttle plasmid (designated pJB414) was constructed by producing a PCR amplicon (using pRB4120 as a template) that contained a His₆ tag fused to the C terminus of U_L15 cDNA. This amplicon was then inserted into the polylinker of the pCDNA5/FRT vector (Invitrogen) at the HindIII and EcoRV sites.

To construct a cell line expressing U_L15 lacking an NLS [pU_L15-NLS(−)], another shuttle plasmid, pJB509, was constructed. Thus, pJB502 [containing U_L15-NLS(−), as indicated in Fig. 2] was digested with HindIII and EcoRV, and the U_L15-containing DNA fragment was gel purified and cloned into pCDNA5/FRT at the HindIII and EcoRV sites. In all cases, the constructs were confirmed by DNA sequencing and immunoblotting with appropriate antibodies.

A plasmid encoding the U_L15 NLS fused to enhanced green fluorescent protein (EGFP) was constructed by annealing oligonucleotides 5′-AGC TTA TGG GCC CAC CTA AGA AAC GGG CCA AGG TGC GG-3′ and 5′-GAT CCC GCA CCT TGG CCC GTT TCTT AGG TGG GCC CAT A-3′ (encoding an NLS) and cloning them into the HindIII and BamHI sites in the pEGFP-N1 vector (Clontech) such that they were in frame with the N terminus of EGFP. The genotype of the construct was confirmed by DNA sequencing.

Constructions of recombinant viruses.

Recombinant viruses were constructed by en passant mutagenesis, a two-step Red-mediated recombination system described previously by Tischer et al. (35). The Red recombination system was induced by heating log-phase Escherichia coli strain EL250 cells harboring the entire HSV-1(F) genome in a bacterial artificial chromosome (BAC) (32) for 15 min at 42°C, followed by chilling and preparation for electroporation. A Kan resistance gene (aphAI) was amplified by PCR using plasmid pEPkan-S as a template and the primer combinations listed in Table 1. The resulting PCR products were flanked by sequences homologous to the target gene. The PCR products were then treated with DpnI to digest the template DNA and gel purified on agarose gels prior to transformation into electrocompetent EL250 bacteria. After electroporation, the competent cells were resuspended in 1.0 ml of LB broth, incubated at 32°C with shaking for 2 h, and then plated onto LB plates containing 50 μg/ml Kan and 30 μg/ml chloramphenicol (Cmp). After 24 h incubation at 32°C, the Kan^r Cmp^r colonies were screened by restriction fragment length polymorphism of BAC DNA for insertion of the Kan resistance cassette into the proper genomic locus.

For the second Red recombination event to simultaneously remove the Kan^r cassette and insert the desired mutation, pBAD-I-SceI, encoding ampicillin (Amp) resistance and the SceI restriction endonuclease, was electroporated into bacteria bearing the BAC with the proper Kan^r insertion. Cmp^r Amp^r Kan^r colonies were selected and grown to early log phase, and 1% arabinose was added to induce the expression of the SceI restriction endonuclease. After incubation for 1 h at 32°C with shaking, the Red recombination system was induced by incubation in a 42°C water bath with shaking for 30 min, followed by a further incubation for 1 h at 32°C. The pBAD-I-SceI-containing bacteria were then plated onto LB plates containing Cmp, Amp, and 1% arabinose and incubated overnight at 32°C. Individual colonies were replica plated to identify Cam^r/Kan^s colonies, and the BAC DNA in these colonies was again characterized by restriction fragment length polymorphism, PCR, and DNA sequencing. BAC DNA with the proper mutation was cotransfected with a Cre expression plasmid, pCAGGS-nelsCre, into CV15 cells (a U_L15 complementing cell line) or rabbit skin cells (a cell line lacking U_L15) using Superfect reagents (QIAGEN) according to the manufacturer's protocol. It was anticipated that the expression of Cre recombinase would cause a deletion of the BAC vector sequences inasmuch as they were flanked by appropriate recombination sites (32). Each recombinant virus was further subjected to two rounds of plaque purification. The genotypes of the recombinant viruses as indicated in Tables 1 and 2 were confirmed by Southern blot and PCR to ensure that the BAC was removed and the target gene was mutated as designed.

Constructions of cell lines.

U_L15-expressing cell lines were constructed by using the Flp-In-CV1 system (Invitrogen) according to the manufacturer's protocol and as described previously (21). Briefly, either pJB414 or pJB509 was cotransfected with a plasmid (pOG44) containing Flp recombinase under the control of a constitutive CMV promoter/enhancer into an engineered cell line (Flp-CV1). After recombination, cells resistant to hygromycin were selected by growth in DMEM supplemented with 10% fetal bovine serum and 200 μg/ml hygromycin B.

Transfections and immunofluorescence microscopy.

Glass coverslips in six-well plates were seeded with 2.5 × 10 ⁵ cells/well Hep2 cells and were incubated overnight in growth medium. A transfection mixture containing 4.0 μg of plasmid and 10 μl of Lipofectamine 2000 was prepared according to the manufacturer's instructions. Briefly, transfection reagent was diluted into 250 μl of OptiMEM, incubated for 5 min at room temperature, and mixed gently with plasmids in an additional 250 μl OptiMEM. The transfection mixture was incubated for 20 min at room temperature and added to a 2.0-ml overlay of normal growth medium without antibiotics. Incubation was continued at 37°C in a humidified 5% CO₂ incubator for a further 24 h before the cells were fixed and examined by fluorescence or prepared for indirect immunofluorescence.

Preliminary indirect immunofluorescence assays indicated that it was necessary to reduce background staining of the pU_L28 antisera described previously (9). To preadosorb the U_L28-specific antisera against proteins other than pU_L28, one 850-cm² roller bottle containing approximately 2 × 10⁸ Hep2 cells was infected with a U_L28 deletion virus (gCB) at a multiplicity of infection (MOI) of 5.0 PFU/cell. At 18 h postinfection (hpi), cells were harvested and washed extensively with phosphate-buffered saline (PBS). An acetone powder of the infected cells was prepared according to the protocol described previously by Sambrook et al. (30). The powder was added to anti-U_L28 serum and PBS, making the final antiserum concentration 1%. The mixture was then mixed on a rotator at 4°C overnight, debris was removed by centrifugation at 10,000 × g for 10 min at 4°C, and the diluted supernatant was used for indirect immunofluorescence as detailed below. The anti-pU_L6 rabbit polyclonal antiserum was preadsorbed in a similar fashion except that cells used for the preadsorption were previously infected with a U_L6 null mutant (25).

Either 24 h after transfection or 18 h after infection, cells on glass coverslips were washed with PBS, fixed with 3% (wt/vol) paraformaldehyde (in PBS) for 10 min at room temperature, and then permeabilized with 0.2% Triton X-100 in PBS for 5 min. The coverslips were blocked with 10% human serum in PBS for 2 h at room temperature. Cells were reacted with the following primary antibodies diluted in 10% human serum and PBS at room temperature for 60 min: anti-FLAG monoclonal antibody (M2; Sigma) diluted 1:100, preadsorbed anti-pU_L28 diluted 1:80 for transiently transfected cells and 1:40 for virus-infected cells, anti-ICP35 (MCA406; Serotec) diluted 1:250, and preadsorbed anti-pU_L6 diluted 1:100. After extensive washing in PBS, the cells were incubated for 60 min at room temperature with secondary antibodies including goat anti-mouse IgG conjugated to Alexa Fluor 488 (green), goat anti-rabbit IgG conjugated to Alexa Fluor 488, or goat anti-mouse IgG conjugated to Alexa Fluor 568 (red) diluted 1:200 in 10% human serum and PBS. The cells were counterstained with Hoechst stain to detect nuclei, mounted in Vectashield mounting medium (Vector Laboratories, Burlingame, CA), and visualized using a Nikon Eclipse E600 fluorescence microscope, with a 60× Plan Apo objective. Images were captured with a cooled SensiCam charge-coupled-device camera. Image files were exported in TIF format for processing with Adobe Photoshop 6.0. Each experiment was repeated at least three times.

Cell fractionation.

Approximately 5.0 × 10⁷ CV1 cells were mock infected or infected with the indicated viruses at an MOI of 5 PFU/cell. Eighteen hours after infection, cells were harvested and washed with cold PBS, resuspended in 3.0 ml of buffer A (10 mM HEPES, 10 mM KCl, 1.5 mM MgCl₂, 5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 10 μg of aprotinin/ml), incubated on ice for 1 h, and Dounce homogenized (25 to 30 strokes), and the fractions were observed microscopically to ensure adequate cell lysis. The nuclei were pelleted by centrifugation at 1,000 × g for 5 min, and the supernatant was stored as the cytoplasmic fraction. The pellets were then washed with excess cold buffer A twice, and 3.0 ml ice-cold radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris [pH 7.4], 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM EDTA) containing a cocktail of protease inhibitors (as described above) was added. The mixture was incubated on ice for 30 min to extract nuclear proteins. The nuclear fraction was clarified by centrifugation at 14,000 rpm for 15 min in a microcentrifuge. Separately, equal amounts of 2× RIPA buffer were added to the cytoplasmic fraction to ensure that immunoprecipitations from nuclear and cytoplasmic fractions were performed under similar conditions. The cytoplasmic and nuclear extracts and nuclear pellets were denatured by boiling in sodium dodecyl sulfate (SDS) and mercaptoethanol and electrophoretically separated on separate lanes of 12% denaturing polyacrylamide gels, or the extracts were divided into three equal aliquots and subjected to immunoprecipitation with either anti-pU_L15N, anti-pU_L28, or anti-pU_L33 antibody.

Immunoprecipitation and immunoblotting.

Immunoprecipitation and immunoblotting were performed as previously described (43). In the case of pU_L6 immunoprecipitation and immunoblotting, the virus-infected cells were treated with RIPA buffer that was unsupplemented or supplemented with various concentrations of NaCl as indicated in Results. The antisera used for immunoprecipitation were diluted 1:100. The primary antibodies for immunoblotting were diluted in PBS plus 2% bovine serum albumin as follows: anti-pU_L6 was diluted 1:1,000, anti-pU_L15C was diluted 1:1,000, anti-pU_L28 was diluted 1:1,000, anti-pU_L33 was diluted 1:400, anti-FLAG (designated M2) was diluted 1:2,000, anti-lamin A/C mouse monoclonal antibodies were diluted 1:200, and anti-superoxide dismutase 4 rabbit polyclonal antibodies were diluted 1:1,000. Horseradish peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG diluted 1:5,000 in PBS plus 2% bovine serum albumin was reacted with the primary antibodies. Bound immunoglobulins were revealed by enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech).

Virus replication assay.

Cells in 25-cm² flasks were infected with viruses (indicated in Table 2) at an MOI of 0.01 PFU/cell. After adsorption for 2 h at 37°C with shaking, the inoculum was removed, and the cells were washed with CBS buffer (40 mM citric acid, 10 mM KCl, 135 mM NaCl [pH 3.0]) to remove residual infectivity. The cells were washed sequentially with excess PBS and medium 199 supplemented with 1% bovine serum and overlaid with 5 ml DMEM supplemented with 5% newborn calf serum and antibiotics. Twenty-four hours after infection, virus was harvested by three cycles of freezing and thawing. Infectivity was determined by plaque assay on monolayers of cells as indicated in Table 2. Each experiment was repeated three times.

RESULTS

pU_L15, pU_L28, and pU_L33 form a complex in the cytoplasm and nucleus.

Previously, we reported that pU_L15, pU_L28, and pU_L33 of HSV-1(F) form a complex in transiently transfected cells and virus-infected cells (43). To determine whether the complex forms initially in the cytoplasm or nucleus, CV1 cells were mock infected or infected with HSV-1(F), and cytoplasmic and nuclear lysates were prepared at 18 hpi. (Fig. 1). Immunoblots of the lysates were then probed with antibodies directed against superoxide dismutase 4, an exclusively cytoplasmic protein, and anti-lamin A/C, an exclusively nuclear protein.

FIG. 1.

Immunoblots of the pU_L15/pU_L28/pU_L33 complex immunoprecipitated from cytoplasmic or nuclear lysates of virus-infected cells. CV1 cells were mock infected (M) or infected with HSV-1(F) (designated F) at an MOI of 5.0 PFU/cell. Eighteen hours after infection, cells were lysed and separated into cytoplasmic and nuclear fractions. (A and B) Immunoblots of cytoplasmic (designated C above each lane) or nuclear (N) lysates were denatured, electrophoretically separated, transferred onto nitrocellulose, and probed with antibody directed against superoxide dismutase 4 (a cytoplasmic marker) (A) or lamin A/C (a nuclear marker) (B). After extensive washing, bound immunoglobulin was revealed by using appropriately conjugated secondary antibodies, followed by ECL and exposure to X-ray film. (C) Immunoblot to detect pU_L15 in immunoprecipitations. Proteins from the cytoplasmic (lanes 1 to 4) or nuclear (lanes 5 to 8) lysates shown in A and B were immunoprecipitated with rabbit antisera directed against the N terminus of pU_L15, full-length pU_L28, or pU_L33. The presence of pU_L15 in the immunoprecipitated material was determined by elution, electrophoretic separation, and immunoblotting with antibodies to the C terminus of pU_L15. Bound IgG was revealed using horseradish peroxidase-conjugated anti-rabbit antibodies and ECL. The positions of pU_L15 and the IgG heavy chain are indicated.

Figure 1A shows that superoxide dismutase 4, with an apparent M_r of 23,000, was readily detected in the cytoplasmic lysate of mock-infected cells and virus-infected cells but was not detectable in nuclear lysates. In contrast, immunoblotting with lamin A/C antibody (Fig. 1B) showed that lamin A/C was present exclusively in the nuclear fractions of mock- and HSV-1(F)-infected cells (Fig. 1, lanes marked M/N and F/N, respectively). Similar results were obtained with lysates prepared at 12 h after infection (data not shown). These data indicate that the cytoplasmic and nuclear fractions were appropriate for subsequent analyses to determine the cytoplasmic or nuclear distribution of the U_L15-, U_L28-, and U_L33-encoded protein complex.

The nuclear and cytoplasmic fractions were subjected to immunoprecipitation with antibodies directed against either pU_L15, pU_L28, or pU_L33, and the presence of pU_L15 in the immunoprecipitated material was determined by immunoblotting. Figure 1C shows that pU_L15 was immunoprecipitated by antiserum directed against the N-terminal 35 amino acids of pU_L15 in roughly equal amounts from both the cytoplasmic and nuclear fractions (lanes 2 and 6). Moreover, pU_L15 was coimmunoprecipitated with pU_L28 or pU_L33 antibody from both the cytoplasmic and nuclear fractions (Fig. 1C, lanes 3 and 4 and lanes 7 and 8, respectively). In contrast, no pU_L15 was detected in mock-infected cells (Fig. 1C, lanes 1 and 5). That all three proteins were coimmunoprecipitated was also determined by immunoblotting with all three antibodies (not shown). These results indicate that the complex of pU_L15, pU_L28, and pU_L33 is detectable in the cytoplasm and nuclei of infected cells.

Identification of a functional NLS in pU_L15.

The simplest explanation for the results obtained thus far is that the pU_L15/pU_L28/pU_L33 complex forms initially in the cytoplasm and is imported into the nucleus. Because we could not formally exclude the possibility that some nuclear protein leaked into the cytoplasmic extracts during preparation, additional experiments were performed to confirm the conclusion that the putative terminase complex forms in the cytoplasm. We reasoned that if one of the proteins was responsible for nuclear import of the complex and the complex formed in the cytoplasm, then ablation of the NLS in that protein should preclude the nuclear import of the entire complex. Therefore, the amino acid sequences of pU_L15, pU_L28, and pU_L33 were scanned in silico for putative NLSs using PSORT II (http://psort.nibb.ac.jp). With the caveat that many NLSs are not detectable by such programs (12), the results of this analysis indicated that only pU_L15 contained a canonical NLS at amino acids 183 to 189 (PKKRAKV [pattern 7]). This region was similar to the NLS of polyomavirus large T antigen and matched the consensus sequence K(K/R)X(K/R).

A series of experiments was then undertaken to determine if this sequence could function as an NLS and, more importantly, if it was necessary for the nuclear import of pU_L15 and the putative terminase complex. As a first step in this regard, a series of pU_L15 deletion mutants fused to an N- or C-terminal FLAG epitope was constructed (diagrammed in Fig. 2) and verified by DNA sequencing and immunoblotting (data not shown). The various U_L15 expression plasmids were then transfected into Hep2 cells, and the intracellular distribution of pU_L15 was determined by indirect immunofluorescence microscopy using an anti-FLAG monoclonal antibody.

As shown in Fig. 3, full-length pU_L15 localized exclusively in the nuclei of transfected cells, indicating the presence of an NLS somewhere within the protein. Similarly, mutants lacking amino acids 1 to 68 and 233 to 735 localized within the nucleus. In contrast, mutants lacking amino acids 1 to 212, 1 to 343, 1 to 442, and 181 to 735 localized exclusively within the cytoplasm. These data indicated that amino acids between positions 180 and 212 were necessary for the nuclear localization of pU_L15, consistent with the potential NLS (identified above) located at amino acids 183 to 189. The finding that this was a likely NLS was confirmed inasmuch as a deletion of only amino acids 182 to 189 caused pU_L15 to remain in the cytoplasm (Fig. 3, bottom).

FIG. 3.

Conventional indirect immunofluorescence showing localization of pU_L15-FLAG expressed in Hep2 cells. Hep2 cells were transiently transfected with the expression plasmids shown in Fig. 2, encoding FLAG-tagged full-length pU_L15 or various deletion mutants thereof. Twenty-four hours posttransfection, the cells were fixed in paraformaldehyde, permeabilized, and reacted with mouse anti-FLAG antibody, followed by reaction with Alexa Fluor 488-labeled goat anti-mouse IgG. Nuclei were identified by Hoechst staining. The missing codons in each construct and summary of the localization of each protein are indicated to the right (C, cytoplasmic; N, nuclear). The images are representative of three independent assays. WT, wild type; aa, amino acids.

To determine whether 183-PKKRAKV-189 was sufficient to serve as an NLS, DNA encoding this motif was fused in frame to the N terminus of the gene encoding EGFP. Plasmids encoding EGFP and the putative pU_L15 NLS fused to EGFP were transfected into Hep2 cells, and the intracellular distributions of EGFP and the chimeric protein were determined by fluorescence microscopy. As shown in Fig. 4, in cells expressing EGFP alone, the fluorescence was diffuse and localized within both the cytoplasm and nucleus. In contrast, the NLS-EGFP localized predominantly within the nucleus. These observations indicate that pU_L15 contains a functional NLS between amino acids 183 and 189.

FIG. 4.

Nuclear import of EGFP by the U_L15 NLS. The sequence encoding the U_L15 NLS (amino acids 182 to 189) was cloned upstream of the EGFP gene in vector pEGFP-N1 as shown on the right. Plasmid DNA encoding EGFP or the EGFP fusion protein was transfected into Hep2 cells, and the cellular distribution of NLS-EGFP was analyzed by fluorescence microscopy 24 h posttransfection. Nuclei are identified with Hoechst counterstain. The data are representative of three independent experiments.

pU_L28 targeting to the nucleus in infected cells requires the NLS of pU_L15.

Thus far, previously reported studies were conducted using transiently expressed proteins in uninfected cells. Because it is possible that in infected cells, other viral proteins might affect the nuclear import of terminase components, we constructed recombinant viruses as detailed in Materials and Methods. Genotypes of viruses used in these studies are listed in Table 2 and are as follows: vJB12 lacks the pU_L15 NLS as a consequence of a deletion of U_L15 codons 182 to 189, vJB13 contains DNA encoding the FLAG epitopic tag fused to the C terminus of pU_L15, and vJB16 was derived from vJB13 and encodes both the U_L15-FLAG fusion and a deletion of the putative pU_L15 NLS.

That the recombinant viruses expressed FLAG-tagged pU_L15 was determined by infection of cells followed by immunoblotting with anti-FLAG antibody. As shown in Fig. 5, the FLAG-tagged pU_L15 was readily detected in lysates of cells infected with either vJB13 or vJB16 (Fig. 5A, lanes 4 and 5). In contrast, no FLAG-specific immunoreactivity was detected in lysates of cells that were mock infected (Fig. 5A, lane 1) or that were infected with wild-type HSV-1(F) (Fig. 5A, lane 3) or the U_L15 deletion mutant (Fig. 5A, lane 2). The finding that the FLAG epitope was fused to pU_L15 was further confirmed upon probing the same blot with anti-pU_L15C antibody. Specifically, the bands containing FLAG-specific immunoreactivity also reacted with the pU_L15-specific antiserum. (Fig. 5B).

FIG. 5.

pU_L28 and pU_L15 localization in virus-infected cells. (A) Immunoblot probed with antibodies directed against the FLAG epitope or the C terminus of pU_L15. CV1 cells were mock infected or infected at an MOI of 5 PFU/cell with a U_L15 deletion virus (15 null), wild-type HSV-1(F) (designated F), vJB13 encoding a FLAG-tagged pU_L15, or vJB16 encoding a FLAG-tagged pU_L15 lacking amino acids 182 to 189. Whole-cell lysates were prepared 18 hpi and separated on a denaturing 12% SDS-polyacrylamide gel. After transferring onto a nitrocellulose membrane, immunoblotting was performed using anti-FLAG antibodies. (B) The nitrocellulose sheet was stripped of immunoreactivity and reprobed with antibody directed against the C terminus of pU_L15. (C) Indirect immunofluorescence of pU_L15 and pU_L28 in infected cells. Hep2 cells were mock infected or infected with 0.1 PFU/cell vJB13, vJB16, or vJB19 (derived from vJB16 but containing restored U_L15 codons 182 to 189). Infected cells were fixed in 3% paraformaldehyde and permeabilized with 0.2% Triton X-100 18 hpi and then coimmunostained with anti-FLAG monoclonal antibody and preadsorbed anti-pU_L28 rabbit polyclonal antibody. Bound primary antibody was visualized by reaction with Alexa Fluor 488-labeled goat anti-rabbit IgG (green) and Alexa Fluor 568-labeled goat anti-mouse IgG (red). Nuclei were identified by Hoechst staining. The images are representative of three independent experiments.

To test the effects of the deletion of the pU_L15 NLS and insertion of the FLAG epitope at the pU_L15 C terminus on viral replication, Vero cells were infected with 0.01 PFU per cell wild-type HSV-1(F) or the recombinant virus vJB13 or vJB16. At 24 hpi, the yields of infectious virus were determined by plaque assay on Vero cells (in the case of vJB13) or a U_L15 complementing cell line (for vJB12 and vJB16). As shown in Table 2, vJB13 replicated in Vero cells to titers that were similar to those of the wild-type virus, indicating that the insertion of the FLAG epitope into the C terminus of pU_L15 did not greatly affect virus replication. In contrast, viruses lacking the NLS, whether they encoded a FLAG-tagged or untagged pU_L15 (vJB12 and vJB16, respectively) (Table 2), replicated to titers in Vero cells that were reduced more than 100,000-fold relative to those of wild-type HSV-1(F) or vJB13 bearing a FLAG-tagged pU_L15 with an intact NLS.

To ensure that the reduction in titer was a consequence of a deletion of the pU_L15 NLS, the NLS deletions in the recombinant BACs bJB12 and bJB16 were restored by using en passant mutagenesis, as described in Materials and Methods and as described previously (35), to yield the BACs bJB15 and bJB19, respectively. Viruses derived from the transfection of these BACs into rabbit skin cells were designated vJB15 and vJB19, respectively. Infection of Vero cells with these viruses followed by titration of infectivity by plaque assay 24 h later indicated that they replicated as well as wild-type virus HSV-1(F) (Table 2). Together, these data indicate that while an insertion of the FLAG epitope into pU_L15 did not affect virus yields, pU_L15 amino acids 182 to 189 were essential for virus replication.

To determine the role of the pU_L15 NLS in the nuclear import of pU_L28, Hep2 cells were mock infected or infected with vJB13, vJB16, or vJB19 at an MOI of 0.1 PFU/cell. At 18 hpi, cells were fixed and permeabilized and reacted with preadsorbed anti-pU_L28 rabbit polyclonal antiserum and anti-FLAG mouse monoclonal antibody, followed by reaction with the appropriate conjugated secondary antibodies and Hoechst stain to identify host chromosomal DNA. As shown in Fig. 5C, little immunofluorescence was detected in mock-infected cells, indicating that the antibodies did not recognize host proteins. In cells infected with vJB13, encoding a FLAG-tagged pU_L15, or vJB19, bearing a restored NLS within FLAG-tagged pU_L15, pU_L28- and pU_L15-specific immunofluorescence colocalized predominantly in cell nuclei. In contrast to these results, pU_L15-specific and pU_L28-specific immunofluorescence localized mostly in the cytoplasm of cells infected with vJB16 lacking the U_L15 NLS. This pattern of immunofluorescent staining was present in approximately 80% of over 300 cells examined (data not shown). These results indicate that the NLS of pU_L15 is required for the normal intranuclear localization of pU_L28.

We next wanted to determine whether the interaction between pU_L15 and pU_L28 was necessary for the nuclear import of the latter, as might be expected if the proteins interact in the cytoplasm, followed by nuclear import of the complex via recognition of the pU_L15 NLS. To test this possibility, we used two recombinant viruses bearing two different mutations in U_L28. In cells infected with the 741i recombinant virus, bearing an insertion of the amino acids ARSR at position 741 of U_L28, viral replication occurs, and pU_L15 and pU_L28 coimmunoprecipitate normally (18). In cells infected with the 741s virus, bearing an insertion encoding ARS stop at position 741, viral replication does not occur, and pU_L28 coimmunoprecipitates with pU_L15 poorly (18). The hypothesis that pU_L15 interacts with pU_L28 to transport it to the nucleus predicts that pU_L28 should be located in the cytoplasm of cells infected with 741S but in the nuclei of cells infected with 741i.

Hep2 cells were infected with gCB (a U_L28 null mutant virus), HSV-1(F), 741s, or 741i at an MOI of 0.1 PFU/cell, and the intracellular localization of pU_L28 was determined 18 hpi by immunofluorescence using preadsorbed anti-pU_L28 antiserum. As a marker of HSV-infected nuclei, cells were also stained with anti-ICP35 monoclonal antibody (MCA406; Serotec). As shown in Fig. 6, no pU_L28-specific immunofluorescence was visualized upon immunostaining of gCB-infected cells, despite prominent ICP35-specific immunostaining indicating that the cells were infected (Fig. 6A, panels a through d). This indicated that the preadsorbed anti-pU_L28 antiserum did not cross-react with cellular or viral proteins other than pU_L28. As expected, pU_L28 localized in the nuclei of cells infected with HSV-1(F) (Fig. 6A, panels e through h). In cells infected with U_L28 mutant 741s, pU_L28 localized primarily in the cytoplasm (Fig. 6A, panels i through l), whereas pU_L28 localized in the nuclei of cells infected with 741i (panels m through p). To ensure that pU_L15 was expressed in infected nuclei, nuclear pellets of cells infected with HSV-1(F), 741s, and the U_L15 and U_L28 null mutants were subjected to immunoblotting with the pU_L15 antiserum. As shown in Fig. 6B, infected nuclei contained two proteins with apparent molecular weights of approximately 83,000 and 72,000 that reacted with the pU_L15 antiserum. That these were products of pU_L15 was indicated by their absence from cells infected with the U_L15 null mutant. Collectively, these results suggest that (i) the interaction between pU_L15 and pU_L28 is required for the translocation of pU_L28 into the nucleus, (ii) pU_L15 can enter the nucleus independently of U_L28, and (iii) the pU_L28/pU_L15 complex forms primarily in the cytoplasm of virus-infected cells.

FIG. 6.

Intracellular localization of pU_L28 and pU_L15 in virus-infected cells. Hep2 cells were infected with 0.1 PFU/cell gCB (a U_L28 null mutant), wild-type HSV-1(F), 741s, or 741i, containing stop or insertion mutations at codon 741 of U_L28, respectively. At 18 hpi, cells were fixed in 3% paraformaldehyde, permeabilized with 0.2% Triton X-100, and coimmunostained with preadsorbed anti-pU_L28 rabbit polyclonal antibody and a monoclonal antibody to ICP35, the major HSV scaffold protein. The secondary antibodies were Alexa Fluor 488-labeled goat anti-rabbit IgG (green) and Alexa Fluor 568-labeled goat anti-mouse IgG (red). Nuclei were identified by Hoechst staining. The images are representative of three independent assays. (B) Nuclear pellets of cells infected with the indicated viruses were solubilized in SDS and immunoblotted with pU_L15-specific antiserum.

The pU_L15/pU_L28/pU_L33 complex forms exclusively in the cytoplasm of cells infected with a mutant virus lacking the pU_L15 NLS.

A reasonable objection to experiments using viral mutants bearing deletions in the NLS within pU_L15 was the possibility that this deletion might interfere with the formation of the pU_L28/pU_L15/pU_L33 complex. Thus, the lack of nuclear import of pU_L28 observed in cells infected with vJB16 might be the consequence of a failure of pU_L15 to interact with pU_L28 rather than a specific effect on nuclear import. To exclude this possibility, we examined whether the pU_L15 lacking an NLS could interact with pU_L28 and pU_L33 and, if so, whether the complex was located in the cytoplasm or nucleus.

CV1 cells were mock infected or infected with vJB12 at an MOI of 5.0 PFU/cell. Cytoplasmic and nuclear fractions were prepared at 18 hpi and reacted with antiserum against pU_L15, pU_L28, or pU_L33. Whether pU_L15, pU_L28, or pU_L33 was present in the immunoprecipitated material was then determined by immunoblotting. As shown in Fig. 7, pU_L15, pU_L28, or pU_L33 was immunoprecipitated from the cytoplasmic fraction by its cognate antibody (Fig 7C, lane 2, A, lane 3, and B, lane 4, respectively). Importantly, pU_L28 was readily coimmunoprecipitated from the cytoplasmic fraction by both anti-pU_L15 antibodies (Fig. 7A, lane 2) and anti-pU_L33 antibodies (Fig. 7A, lane 4).

FIG. 7.

Immunoprecipitation of the pU_L15/pU_L28/pU_L33 complex from cytoplasmic and nuclear lysates of cells infected with a virus lacking the NLS of pU_L15. CV1 cells were mock infected (lanes 1 and 5) or infected with 5.0 PFU/cell vJB12, a virus lacking the NLS of pU_L15. Eighteen hours after infection, cells were lysed and separated into cytoplasmic and nuclear fractions. Immunoprecipitation from the respective lysates was performed with antibodies to the N terminus of pU_L15 or full-length pU_L28 or pU_L33. The immunoprecipitates were separated on a 12% SDS-polyacrylamide gel and transferred onto a nitrocellulose membrane, followed by immunoblotting with antibodies against pU_L28 (A), pU_L33 (B), or the C terminus of pU_L15 (C). Ab indicates the row of immunoprecipitating antibodies indicated to the right and above each lane.

Similar to the results with pU_L28, pU_L33 coimmunoprecipitated from the cytoplasmic fraction reacted with either anti-pU_L15 (Fig. 7B, lane 2) or anti-pU_L28 antibodies (Fig. 7B, lane 3), and pU_L15 was coimmunoprecipitated from the cytoplasmic fraction by anti-pU_L28 (Fig. 7C, lane 3) and anti-pU_L33 (Fig. 7C, lane 4) antisera.

These observations ruled out the possibility that the deletion of codons 183 to 189 of U_L15 precluded an interaction with pU_L28 and pU_L33 and were consistent with above-described data (Fig. 1, 5, and 6) indicating that the complex of pU_L28, pU_L15, and pU_L33 forms in the cytoplasm of virus-infected cells.

To determine the effects of the pU_L15 NLS on nuclear forms of the putative terminase, a similar experiment was performed using nuclear extracts. The results shown in Fig. 7 and repeated in at least three separate experiments indicated that pU_L15, pU_L28, and pU_L33 were immunoprecipitated from the nuclear fractions of cells infected with vJB12 with their cognate antibodies (Fig. 7A, lane 7, C, lane 6, and B, lane 8, respectively). This was not surprising, given the observation that immunofluorescence specific for pU_L15 and pU_L28 was detected within the nuclei of vJB16-infected cells by indirect immunofluorescence (Fig. 5), and pU_L33 is normally present in the cytoplasm and nucleus late in infection (28).

In stark contrast to the results with cytoplasmic extracts of cells infected with vJB16, however, coimmunoprecipitation of pU_L15, pU_L28, and pU_L33 from nuclear extracts was, at best, inefficient. Specifically, pU_L15 did not coimmunoprecipitate with detectable pU_L28 or pU_L33 (Fig. 7, lane 6), and pU_L33 did not coimmunoprecipitate with detectable pU_L15 or pU_L28 (Fig. 7, lane 8). Moreover, the anti-pU_L28 antiserum coimmunoprecipitated no detectable pU_L15 and only a small amount of pU_L33 (Fig. 7, lane 7). These observations were also in contrast to the results obtained upon immunoprecipitation of pU_L15, pU_L28, and pU_L33 from nuclear extracts of cells infected with wild-type HSV-1(F) (Fig. 1). These data suggest that efficient formation of the pU_L15/pU_L28/pU_L33 complex requires that interactions between these proteins occur in the cytoplasm of cells infected with wild-type viruses. We speculate that in the absence of a cytoplasmic interaction, interactions in the nucleus either cannot occur or occur only very inefficiently. Alternatively, the data do not exclude the possibility that the interactions between pU_L15, pU_L33, and pU_L28 within the nucleus require amino acids 182 to 189, whereas interactions in the cytoplasm do not.

The portal encoded by pU_L6 is translocated into the nucleus independently of pU_L15.

We reasoned that if pU_L6 and pU_L15 were to interact in the cytoplasm, retention of some pU_L15 in the cytoplasm by the deletion of its NLS should also retain pU_L6 in the cytoplasm in both infected and uninfected cells.

To test these possibilities, pU_L15-FLAG with or without its NLS was transiently coexpressed with pU_L6 in Hep2 cells, and the subcellular localizations of pU_L6 and pU_L15 were determined by immunofluorescence using an anti-pU_L6 polyclonal antiserum and anti-FLAG monoclonal antibody to detect pU_L15. Nuclei were identified with Hoechst stain. As expected, when full-length pU_L15-FLAG and pU_L6 were coexpressed, both localized exclusively in cell nuclei (Fig. 8a to d). In contrast, when pU_L15-FLAG-NLS(−) was coexpressed with pU_L6, the pU_L15-specific signal localized predominantly in the cytoplasm, whereas pU_L6-specific immunoreactivity localized in the nucleus in a smooth, even pattern (Fig. 8e to h). This observation agrees with previous results indicating that both pU_L6 and pU_L15 can translocate to nuclei in the absence of other viral proteins but also indicates that these proteins can localize into nuclei independently of one another.

FIG. 8.

Indirect immunofluorescence of pU_L6 and pU_L15. Hep2 cells were either transiently transfected with expression plasmids (a through h) or infected with recombinant viruses (i through u) as indicated. Cells were fixed at 24 h posttransfection or 18 h after infection, and the intracellular localizations of pU_L6 and pU_L15 were determined by indirect immunofluorescence microscopy using mouse anti-FLAG antibody (to detect pU_L15) or rabbit antiserum directed against pU_L6. The cells were reacted with the secondary antibodies Alexa Fluor 488-labeled goat anti-rabbit IgG (green) and Alexa Fluor 568-labeled goat anti-mouse IgG (red). Nuclei were identified by Hoechst staining. The results are representative of three independent assays.

To investigate the effects of the pU_L15 NLS on the localization of pU_L6 in infected cells, Hep2 cells were infected with vJB13, vJB16, or vJB19 at an MOI of 0.1 PFU/cell, and the intracellular distributions of pU_L6 and pU_L15 were examined 18 hpi by indirect immunofluorescence as described above. As shown in Fig. 8m to p, pU_L15 localized predominantly in the cytoplasm of cells infected with vJB16 lacking the U_L15 NLS, whereas pU_L6 localized in small foci or larger globular regions within the nucleus. Parenthetically, this pattern of immunostaining was different from the smooth pattern obtained upon the transient expression of pU_L6 in uninfected cells (Fig. 8, compare b and f with j, n, and s). In contrast, FLAG-tagged pU_L15 containing an NLS as in vJB13-infected cells or a restored NLS as in vJB19-infected cells localized in a diffuse pattern throughout the DNA replication compartment (27), whereas pU_L6 localized in small foci or larger globular regions within or adjacent to the DNA replication compartment (Fig. 8i to l and r to u, respectively). These data suggest that pU_L15 and pU_L6 are imported separately into the nucleus of the infected cell.

pU_L15 lacking the NLS is a dominant-negative inhibitor of HSV-1 replication.

As shown in Table 2 and as discussed above, deletion of the NLS of pU_L15 as in recombinant viruses vJB12 and vJB16 precluded viral replication in Vero cells. Of additional interest, however, was the observation that the pU_L15 NLS deletion mutant vJB12 also replicated to titers about 17-fold lower than that of the U_L15 null mutant in the U_L15 complementing cell line clone 17 (data not shown) and CV15 (Table 2). Moreover, in U_L15 complementing cells, vJB12 replicated to titers about 33-fold lower than those of the corresponding genetically repaired virus vJB15 or wild-type HSV-1(F) (Table 2). Inasmuch as the NLS-repaired virus vJB15 derived from vJB12 replicated in Vero cells normally, the limited replication of vJB12 in complementing cells was not attributable to a mutation other than a deletion of the NLS in U_L15. These data suggest that pU_L15 lacking an NLS interferes with the function of wild-type pU_L15 in the complementing cell lines.

To clarify whether the deletion of the NLS in pU_L15 created a dominant-negative protein, we constructed a new cell line, CV15M, containing pU_L15-NLS(−) as detailed in Materials and Methods. CV15M cells were infected with HSV-1(F), and the amount of infectious virus was determined by plaque assay. As shown in Table 2, HSV-1(F) titers in CV15M cell lines were reduced about 80-fold compared to those obtained from Vero cells or CV15 cells. As expected, a U_L15 null virus lacking most of the second exon of U_L15 did not replicate to an appreciable extent in CV15M cells, indicating that the NLS was necessary for complementing the replication of viral mutants bearing lethal mutations in U_L15. These results also indicate that mutant pU_L15 lacking an NLS acts in a dominant-negative fashion to inhibit the replication of wild-type HSV.

Interaction between terminase components and the portal protein pU_L6.

Previous attempts to coimmunoprecipitate putative terminase components and the portal protein were unsuccessful (9, 43). Those results might be explained by the insolubility of the interacting proteins, the interference of pU_L6 interactions by antibody binding, or the possibility that the proteins do not interact in infected cells. A systematic study was therefore undertaken to determine conditions under which the pU_L6 protein could be solubilized and, if it could be solubilized, whether pU_L6 could be coimmunoprecipitated with terminase components.

Cells were infected with 5 PFU per cell of wild-type virus HSV-1(F) and were extracted in RIPA buffer containing 50 mM Tris (pH 7.4), 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, and 1 mM EDTA. Alternatively, the cells were extracted in RIPA buffer supplemented with 500 mM NaCl, 1.0 M NaCl, 1.5 M NaCl, or 2 M NaCl (Fig. 9A). In all cases, insoluble material was separated from soluble material by centrifugation, and proteins in the pellets and supernatants were treated with SDS sample buffer, followed by denaturing gel electrophoresis and immunoblotting with a pU_L6-specific antibody. As shown in Fig. 9A, some pU_L6 was soluble in the presence of RIPA buffer alone, although a substantial amount of the protein was not solubilized in RIPA buffer. Increasing the salt concentration did not greatly increase the amount of pU_L6 that was solubilized, at least as assessed by immunoblotting. Even infected cells extracted in 2 M NaCl retained some pU_L6 in the insoluble fraction (Fig. 9A, compare lanes 4, 8, and 12).

FIG. 9.

Interaction between pU_L6 and putative component of terminase in virus-infected cells detected by coimmunoprecipitation. CV1 cells were infected with 5 PFU per cell of HSV-1(F) or the U_L6 null mutant. (A) At 18 hpi, cells were extracted with RIPA buffer (containing detergent and 150 mM NaCl) (lanes designated A) or RIPA buffer supplemented with NaCl at various concentrations for 30 min at room temperature. Each number above the lanes corresponds to the same sample or partitions thereof. Insoluble material was pelleted by centrifugation, and the materials in the supernatant (soluble) (B's) and pellet (insoluble) (C's) were denatured, electrophoretically separated, transferred onto nitrocellulose, and probed with antibody against pU_L6. (B, C, and D) Infected cell lysates harvested at the same time point as those in A were subjected to immunoprecipitation (IP) with the pU_L6-specific antibody. Immunoprecipitated proteins were separated in an SDS-polyacrylamide gel, transferred onto nitrocellulose, and identified by immunoblotting with antibodies to pU_L6 (B), pU_L15 (C), or pU_L28 (D). WB, Western blot.

pU_L6 solubilized in RIPA buffer and at various concentrations of NaCl was then subjected to immunoprecipitation with a pU_L6-specific polyclonal antibody, and the presence of pU_L6, pU_L15, pU_L28, and pU_L33 in the immunoprecipitates was assessed by immunoblotting. The results using RIPA buffer alone or containing 1 M NaCl are shown in Fig. 9B to D. As a control, cells infected with 5 PFU per cell of a U_L6 null virus were treated similarly.

pU_L6 was readily immunoprecipitated from cells infected with HSV-1(F) that were lysed in the presence of unsupplemented RIPA buffer (Fig. 9B, lane 2), but the immunoprecipitated material did not contain pU_L15, pU_L28 (Fig. 9C and D, lanes 2), or pU_L33 (data not shown). The finding that the immunoprecipitated protein was the product of U_L6 was confirmed by its absence from immunoprecipitation reactions in which lysates of cells infected with the U_L6 null virus were reacted with the pU_L6-specific antibody (Fig. 9B, lane 1). The lack of coimmunoprecipitation of pU_L15, pU_L28, and pU_L33 with pU_L6 in RIPA lysates of HSV-1(F)-infected cells is consistent with previous observations suggesting that highly soluble pU_L6 does not interact with the terminase components pU_L15, pU_L28, and pU_L33. This result was also consistent with conclusions presented above indicating that pU_L6 does not interact with pU_L15 in the cytoplasm.

Like pU_L6 solubilized in RIPA buffer, pU_L6 extracted from infected cells in RIPA buffer containing 1.0 M NaCl was readily immunoprecipitated with the pU_L6-specific antibody (Fig. 9B, lane 3), indicating that the high salt concentration did not affect the immunoreactivity of pU_L6 with its cognate antibody. In the negative control reaction, neither pU_L15 nor pU_L28 was coimmunoprecipitated with pU_L6 in 1 M NaCl extracts of cells infected with the pU_L6 deletion mutant (Fig. 9C and D, lanes 1). Importantly, pU_L15 was readily coimmunoprecipitated with pU_L6-specific antibody in extracts produced in the presence of 1.0 M NaCl (Fig. 9C, lane 3). Whereas pU_L28 immunoreactivity was also detectable in the pU_L6 immunoprecipitates under these conditions, the pU_L28-specific signal was considerably weaker than that of pU_L15 (Fig. 9D, lane 3). pU_L33 did not coimmunoprecipitate with pU_L6 in 1.0 M NaCl above background levels (data not shown). These results suggest that at least the pU_L15 and pU_L28 components interact with the portal encoded by U_L6 in infected cells, thus supporting previous results using heterologously expressed proteins (40). The data also suggest that the pU_L6/pU_L15/pU_L28 complex is considerably less soluble than the pU_L15/pU_L28/pU_L33 complex in infected cells. Less solubility might be expected of proteins associated with the nucleus, cytoskeletal components, or large complexes (e.g., procapsids or portal rings) that must be disrupted.

DISCUSSION

Nuclear localization of the putative terminase.

This study identifies a functional NLS within pU_L15 and shows that this is necessary to import normal levels of the complex of pU_L15 and pU_L28 into the nucleus. In addition, when the interaction of pU_L28 and pU_L15 is reduced by the truncation of U_L28 at codon 741 (18), pU_L28 remains in the cytoplasm. Thus, both the interaction between pU_L28 and pU_L15 and the NLS of pU_L15 are required for the nuclear localization of pU_L28 in infected cells. The disruption of the NLS in pU_L15 did not preclude an interaction between pU_L28 and pU_L33 inasmuch as all three proteins were successfully coimmunoprecipitated from the cytoplasm of the U_L15 NLS(−) mutant. Together, these data suggest that the terminase forms in the cytoplasm and is incorporated into the nucleus as a complex of all three proteins by virtue of the NLS in pU_L15.

We did not perform indirect immunofluorescence to determine the localization of pU_L33 in these studies for the following reasons. First, pU_L33 is arguably smaller than the diffusion limit of the nuclear pore, and a portion would be expected to be imported into the nucleus independently of the pU_L15/pU_L28/pU_L33 complex. Thus, any effects of the U_L15 NLS mutation on pU_L33 localization would be difficult to discern. This expectation is consistent with the observation that pU_L33 is present in both the cytoplasm and nucleus by immunofluorescence assay, even late in infection (28). Second, pU_L33 interacts directly with pU_L28 but only indirectly with pU_L15 (43). Thus, any influence of pU_L15 mutations on pU_L33 localization would likely be mediated through effects on pU_L28. These studies therefore focused primarily on the effects of U_L15 mutations on the localization of pU_L28.

Although the nuclear import of pU_L15 and pU_L28 is greatly affected by the ablation of the pU_L15 NLS, some pU_L15 and pU_L28 can be imported into the nucleus in the absence of the pU_L15 NLS. This is supported by both indirect immunofluorescence and immunoblots of nuclear lysates probed with pU_L15- and pU_L28-specific antibodies (Fig. 5 and 7). (As a caveat, it should be noted that the signals on the immunoblots may not reflect the relative quantities of the probed proteins inasmuch as such quantification requires that the proteins be in the linear range of detection.) It is currently unclear how some pU_L15 lacking an NLS and pU_L28 are imported into the nuclei of cells infected with the mutant virus, although it seems likely that NLSs other than amino acids 183 to 189 of pU_L15 are used. In any event, the data indicate that the nuclear import of the pU_L15/pU_L28 complex is negatively affected in the absence of the classical NLS within pU_L15.

In nuclear lysates of cells infected with wild-type virus, pU_L15, pU_L28, and pU_L33 could be coimmunoprecipitated, suggesting that the interactions between these proteins are maintained in the nucleus after nuclear import. In contrast, these proteins either did not coimmunoprecipitate (pU_L15 and pU_L28) or coimmunoprecipitated poorly (pU_L28 and pU_L33) from nuclear lysates of cells infected with the viral mutant lacking the NLS within pU_L15. These data argue that in the event that the putative terminase does not form in the cytoplasm, components that become incorporated into the nucleoplasm through independent means cannot interact efficiently. We cannot exclude the possibilities that (i) the NLS of U_L15 is necessary for the interaction of these proteins in the nucleus but dispensable for interactions in the cytoplasm or (ii) the smaller amounts of proteins imported into nuclei in the absence of the pU_L15 NLS preclude the detection of coimmunoprecipitated proteins.

Interaction between the portal protein and terminase components.

The current data suggest that pU_L6 is imported into the nucleus independently of the putative terminase components pU_L15, pU_L33, and pU_L28. This hypothesis is supported by the observations that (i) U_L6 is incorporated into the nucleus whether or not the NLS within pU_L15 is ablated and (ii) the pU_L6 purified from lysates produced under mild conditions did not contain either pU_L15 (Fig. 9C, lane 2), pU_L28 (Fig. 9D, lane 2), or pU_L33 (data not shown). These conclusions are in contrast to those from previous studies in which pU_L6 was mutated such that it remained cytoplasmic and, when transiently expressed, precluded coexpressed pU_L15 from translocation into the nucleus (40). These disparate results may be a consequence of transient expression in the previous study versus the use of infected cells in the current study. Given that in infected cells, the proteins of interest are expressed at physiological levels and in the presence of other viral proteins that likely influence the nuclear import of portal, capsid, and terminase components, we give more credence to the current results.

Although they use different routes to the intranuclear DNA packaging reaction, the current data also suggest that pU_L6 and the putative terminase interact (Fig. 9). The possibility that such interactions can occur is also supported by (i) the coimmunoprecipitation of pU_L6 with pU_L28 and pU_L15 with pU_L6 when overexpressed in a recombinant baculovirus system (40), (ii) the observation that treatment with an antiviral drug directed against U_L6 decreases the incorporation of both pU_L6 and pU_L15 into capsids (22, 38), and (iii) the finding that decreased amounts of pU_L15 associate with U_L6(−) capsids (46). On the other hand, one to two copies of pU_L15 and pU_L28 and an unknown number of copies of pU_L33 can associate with capsids isolated from cells infected with a U_L6 deletion mutant, suggesting that the interactions of terminase proteins and the capsid also involve capsid components other than pU_L6 (7, 8). It is also worth noting that like pU_L6, the U_L15, U_L28, and U_L33 proteins have been shown to associate with the external surface of the capsid, as might be expected when the terminase docks with the capsid (23, 41).

It is of interest that pU_L15 coimmunoprecipitates with pU_L6 more readily than does pU_L28 or pU_L33. U_L15 and U_L28 coimmunoprecipitate with one another in 1 M NaCl (not shown); therefore, the relatively high amount of salt in the extraction buffer cannot fully explain why less pU_L28 than pU_L15 coimmunoprecipitates with pU_L6. Although this observation might simply reflect pU_L6-specific antibody interference with the pU_L28 interaction, it is also consistent with an emerging model in which pU_L15, as the ATPase subunit, is more intimately associated with the portal than its interaction partners encoded by pU_L28 and pU_L33. The latter two proteins interact directly with one another and might represent the DNA binding portion of the terminase (1, 43). Supporting this model are the observations that pU_L15 is highly enriched in capsids believed to result from aborted DNA packaging events (type A capsids), whereas pU_L28 was not detected in these capsids (8). In that work, it was speculated that in binding to the DNA, pU_L28 was lost from the capsid along with the DNA.

The relative insolubility of the pU_L6/pU_L15 complex suggests localization in the nucleus (14), association with cytoskeletal elements, or interaction with larger complexes that must be disrupted by extraction in high salt. Such larger complexes might include the procapsid/terminase complex, which may or may not be associated with nuclear matrix loci that augment procapsid formation or function (10, 39, 42). The resistance of the pU_L15/pU_L6 complex to extraction under mild conditions helps to explain previous and current results that show interactions between putative terminase components but not between the terminase and the portal protein (7, 43). pU_L33 interacts directly with pU_L28 but only indirectly with pU_L15 (43). We speculate that the inability to coimmunoprecipitate pU_L33 with pU_L6 reflects antibody interference or the rather stringent extraction conditions required to solubilize the portal/terminase complex. It seems unlikely that the result can be explained by the absence of pU_L33 from capsids inasmuch as a relatively stable association of pU_L33 with the capsid surface has been documented (7).

Assuming that a single terminase complex mediates all terminase functions, the simplest model to explain the current results would propose that pU_L15, pU_L28, and pU_L33 form a complex in the cytoplasm. The complex is then imported into the nucleus via an NLS in pU_L15. The terminase then presumably identifies terminal ends of concatameric genomes. The terminase/DNA complex then interacts with the U_L6-encoded portal vertex primarily through the pU_L15 moiety, followed by the cleavage/packaging of the DNA. Further experimentation is clearly warranted to test aspects and implications of this model and to elucidate the reactions in more molecular detail.