Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2003 Sep;69(9):5207–5211. doi: 10.1128/AEM.69.9.5207-5211.2003

Identification of cry1I-Type Genes from Bacillus thuringiensis Strains and Characterization of a Novel cry1I-Type Gene

Fuping Song 1, Jie Zhang 1, Aixing Gu 1, Yue Wu 1, Lanlan Han 1, Kanglai He 1, Zhongyi Chen 1, Jiang Yao 1, Yuqin Hu 1, Guoxun Li 2, Dafang Huang 3,*
PMCID: PMC194953  PMID: 12957903

Abstract

A PCR-restriction fragment length polymorphism method for identification of cry1I-type genes from Bacillus thuringiensis was established by designing a pair of universal primers based on the conserved regions of the genes to amplify 1,548-bp cry1I-type gene fragments. Amplification products were digested with the Bsp119I and BanI enzymes, and four kinds of known cry1I-type genes were successfully identified. The results showed that cry1I-type genes appeared in 95 of 115 B. thuringiensis isolates and 7 of 13 standard strains. A novel cry1I-type gene was found in one standard strain and six isolates. The novel cry1I gene was cloned from B. thuringiensis isolate Btc007 and subcloned into vector pET-21b. Then it was overexpressed in Escherichia coli BL21(DE3). The expressed product was shown to be toxic to the diamondback moth (Plutella xylostella), Asian corn borer (Ostrinia furnacalis), and soybean pod borer (Leguminivora glycinivorella). However, it was not toxic to the cotton bollworm (Helicoverpa armigera), beet armyworm (Spodoptera exigua), or elm leaf beetle (Pyrrhalta aenescens) in bioassays. Subsequently, the Cry protein encoded by this novel cry gene was designated Cry1Ie1 by the B. thuringiensis δ-endotoxin nomenclature committee.


Crystal proteins from the gram-positive spore-forming bacterium Bacillus thuringiensis are toxic to a wide variety of insects that are economically important as pests. Many different genes encoding the B. thuringiensis endotoxin have been isolated and characterized. The genes have been classified as cry1 to cry40, cyt1, and cyt2 and are ranked according to their homology (10, 21; see also the B. thuringiensis toxin nomenclature website at http://www.biols.susx.ac.uk/home/Neil_Crickmore/Bt/). Cry1 proteins that are active against lepidopteran insects are produced as crystalline parasporal inclusions during sporulation. Generally, the crystals are composed of protoxins of approximately 130 kDa, but cry1I-type genes are usually silent genes capable of encoding a protein of about 81 kDa in B. thuringiensis strains (9, 13, 21, 24). We decided to screen B. thuringiensis isolates for cry1I genes with the aim of finding novel cry1I genes, which could encode insecticidal proteins toxic to insensitive or resistant insect pests.

This screening approach included the development of an analysis protocol based on PCR-restriction fragment length polymorphism (RFLP). PCR-based methods have been developed to detect different cry genes from B. thuringiensis strains (1-8, 11, 13, 15, 17, 23). More than 80 primer pairs have been designed to identify entire groups and individual cry genes (19). Several specific primers and probes for Southern blotting were designed to detect cry1I-type genes. A wide distribution of cry1I-type genes among many different B. thuringiensis strains has been reported (13, 22, 25). However, the list of cry genes is increasing, and novel PCR primers are needed in order to identify some of the recently described genes (5).

The present study establishes a PCR-RFLP method for identifying cry1I-type genes from B. thuringiensis isolates. Both known and new cry1I genes can be determined by using the new method with universal primers that were designed based on the conserved regions of cry1I-type genes. One novel cry1I-type gene from a B. thuringiensis isolate, Btc007, was found and characterized by this method.

MATERIALS AND METHODS

Bacterial strains and plasmid. Thirteen B. thuringiensis standard serotype strains imported from the Pasteur Institute were supplied by the Bacterial Stock Center of the Chinese Academy of Forestry Sciences. B. thuringiensis isolates were obtained from the B. thuringiensis R&D Center of the Hubei Academy of Agricultural Sciences, the Bacterial Stock Center of the Chinese Academy of Forestry Sciences, and the Department of Plant Protection of Northeast Agriculture University, Harbin, China. Vector pET-21b(+) and Escherichia coli BL21(DE3) were purchased from Novagen Co.

Chemical reagents and enzymes.

Chemical reagents were purchased from Sigma, and Taq DNA polymerase was purchased from Promega. Restriction enzymes were obtained from New England Biolabs, Inc., and MBI Fermentas.

Preparation of template and PCR-RFLP.

B. thuringiensis strains were incubated overnight at 30°C and 220 rpm in LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl; pH 7.0). A 1-ml volume of culture was collected after centrifugation, and the pellet was resuspended in 100 μl of purified water, boiled 5 min, and spun at 14,000 rpm for 5 min. The supernatant was collected as a template for PCR amplification. Based on the conserved regions of cry1I genes (cry1Ia, cry1Ib, cry1Ic, and cry1Id) (9, 10, 22, 25), a pair of universal primers (S5uni-S3uni) was designed (Table 1). The 50-μl PCR mixture was composed of 1 μl of templates with reaction buffer, 250 μM each deoxynucleoside triphosphate, 0.2 μM each primer, and 0.5 U of Taq DNA polymerase. PCR was carried out for 32 cycles (at 94°C for 1 min, 52°C for 1 min, and 72°C for 3 min). PCR products were digested with both Bsp119I and BanI enzymes. The restriction fragments were separated in 1.5% agarose gels. Table 1 shows the predicted fragment sizes of PCR products for four kinds of known cry1I genes and the novel cry1I-type gene found in this study.

TABLE 1.

PCR-RFLP system of cry1I genes

Gene or primer Accession no. Sequenceb Positions Coding region (nt)c Product size (bp) Fragment size (nt) (bp) with Bsp119I and BanI
Primers
    S5uni GCTGTCTACCATGATTCGCTTG
    S3uni CAGTGCAGTAACCTTCTCTTGC
Genes
    cry1Ia1 X62821 GCTGTCTACCATGATTCGCTTG 760-781 355-2514 1,584 141, 444, 571, 47, 381
     CAGTGCAGTAACCTTCTCTTGC 2343-2322
    cry1Ib1 U07642 GCcGTCTACCATGAaTCGCTTG 642-663 237-2396 1,584 1,156, 47, 381
     CAGTGCAGTAACCTTCTCTTGC 2225-2204
    cry1lc1 AF056933 GCTGTCTACCATGAaTCGCTTG 406-427 1-2160 1,584 522, 634, 47, 381
     CAGTGCAGTAACCTTCTCTTGC 1989-1968
    cry1Id1 AF047579 GCTGTCTACCATGAaTCtCTTG 907-928 502-2661 1,584 141, 444, 999
     CAtTGCAGTAACtcTaTCTTGt 2490-2469
    cry1Ie1a AF211190 GCTGTCTACCATGAaTCGCTTG 715-736 310-2469 1,584 585, 571, 47, 381
     CAGTGCAGTAACCTTCTCTTGC 2298-2277
a

The novel gene found in this study

b

Lowercase letters indicate nucleotides that differ from those in the primer sequences.

c

nt, nucleotides.

Preparation of DNA and Southern blotting.

Plasmid DNA was prepared from a B. thuringiensis isolate Btc007 cell grown to an optical density at 600 nm of 1.0. Cells were pelleted by centrifugation and resuspended in protoplast buffer (20 mg of lysozyme/ml in 0.3 M sucrose, 25 mM Tris-Cl [pH 8.0], 25 mM EDTA). After incubation at 37°C for 1 h, protoplasts were lysed for 10 min by the addition of 9 volumes of a solution containing 10 mM Tris-Cl, 1 mM EDTA, 0.085 M NaOH, and 1% sodium dodecyl sulfate (SDS). One-half volume of 3 M potassium acetate (pH 4.8) was then added, and the cellular material was neutralized overnight at 4°C. After centrifugation, the plasmid DNA was precipitated from the supernatant with isopropanol and was purified by isopycnic centrifugation on cesium chloride-ethidium bromide gradients by the method described by Sambrook et al. (20). For Southern blot analysis, 2 μg of plasmid DNA was digested with the restriction enzymes HindIII, PstI, and ClaI and electrophoresed on a 0.8% agarose gel. The digested DNA was denatured and transferred to a nylon membrane (Hybond N+; Amersham) by using 0.4 M NaOH. The product amplified from Btc007 with primers S5uni and S3uni was labeled with [32P]dCTP by using a random-priming labeling kit (Promega) as a probe. Prehybridization and hybridization were carried out as described by Sambrook et al. (20).

Cloning of a novel insecticidal crystal protein gene.

Southern blotting was performed against plasmid DNA purified from B. thuringiensis Btc007 digested with HindIII, PstI, and ClaI. Among the positive signals obtained in the Southern blot analysis, a 4.8-kb ClaI fragment from B. thuringiensis Btc007 plasmid DNA was cloned into the pUCP19 ClaI site and transformed into E. coli DH5α according to the procedure of Sambrook et al. (20). To obtain subclones for analysis of the DNA sequence, a restriction enzyme map was constructed using various restriction enzymes such as ClaI, EcoRI, HindIII, XhoI, and KpnI. Each of the DNA fragments of approximately 1 kb obtained by restriction with the EcoRI, HindIII, and ClaI enzymes existing on the cloned DNA was eluted to facilitate analysis of the DNA sequences and subcloned into pBlueScript II SK(+) with appropriate enzyme sites. Subcloned DNA fragments were sequenced with an automated DNA sequencer.

Expression of the cry1Ie1 gene and protein analysis.

To express the cloned insecticidal crystal protein gene, a pair of primers was designed to amplify the full-length gene. The sequence of the forward primer was 5′-CGCGGATCCGATGAAACTA AAGAATCCAG-3′, with the restriction enzyme BamHI at the 5′ end, and that of the reverse primer was 5′-ACGCGTCGACGGCAT GTTACGCTCAATATGG-3′, with SalI at the 5′ end. The PCR product was inserted into the pET-21b vector BamHI and SalI sites and transformed into E. coli BL21(DE3). E. coli BL21(DE3) harboring the cloned crystal protein genes was grown in LB medium overnight and was then inoculated at a 1% concentration into fresh LB medium containing the antibiotic ampicillin (100 μg/ml). The cultures were incubated at 37°C with shaking (250 rpm) until an optical density of 0.6 to 0.8 was reached, and isopropyl-β-d-thiogalactopyranoside (IPTG) was added to a final concentration of 0.7 mM. The cultures were then maintained at 20°C for 12 h. Cry1Ie1 protein was purified and concentrated according to the method of Shin et al. (22). B. thuringiensis strains were incubated at 30°C and 220 rpm. Cultures for SDS-polyacrylamide gel electrophoresis (PAGE) analysis of total proteins were collected by centrifugation when the crystal was formed (about 30 h). The method of SDS-PAGE analysis described by Sambrook et al. (20) was used.

Insect bioassay.

Insecticidal activity against first-instar larvae of the Asian corn borer (Ostrinia furnacalis), cotton bollworm (Helicoverpa armigera), and beet armyworm (Spodoptera exigua) was measured by incorporating a suspension containing twofold serial dilutions of purified inclusions into the artificial diet. Toxicity studies on larvae of the diamondback moth, Plutella xylostella (third-instar larvae), elm leaf beetle (Pyrrhalta aenescens) (second-instar larvae), and soybean pod borer (Leguminivora glycinivorella) (second-instar larvae) were conducted on fresh leaf disks by leaf dip bioassays (24). Disks cut from leaves of cabbages grown in the greenhouse were used for P. xylostella, disks cut from elm leaves were used for P. aenescens, and disks cut from green pods of soybean were used for L. glycinivorella. Ten larvae were each given an artificial diet or placed on a leaf disk, and their fates were monitored after 2 days for P. xylostella and after 7 days for the other insects. Bioassays were repeated at least twice, and 50% lethal concentrations (LC50) were calculated by probit analysis (12).

Nucleotide sequence accession number.

The nucleotide sequence data published in this paper were assigned GenBank accession number AF211190.

RESULTS

Identification of cry1I genes from B. thuringiensis strains.

cry1I genes were detected in 13 standard strains and 115 isolates by use of this PCR-RFLP method. Seven standard strains contained cry1I genes (Table 2), and 95 isolates harbored cry1I genes based on a positive PCR signal. The cry1I-type genes of these strains were determined according to the patterns of fragments of products digested with BanI and Bsp119I. Four kinds of cry1I-type RFLP patterns were found in the agarose gel (Fig. 1). Four standard strains and 71 isolates had a cry1Ia-type RFLP pattern. The gel revealed three main bands of 0.57, 0.44, and 0.38 kb, sizes which conformed to those of the predicted fragments of the cry1Ia-type genes (Fig. 1, lanes 3, 5, 6, 8, 10, 12, 14, 15, and 17). Two standard strains and 26 isolates showed a cry1Ib-type RFLP pattern, which had two main bands of 1.16 and 0.38 kb (Fig. 1, lanes 4 and 9). A novel cry1I-type pattern which had two main bands of 0.58 and 0.38 kb was found in Bacillus thuringiensis subsp. thuringiensis HD-2 and in six isolates, including B. thuringiensis Btc007 (Fig. 1, lanes 1, 2, 7, 11, and 13; Table 2). Four isolates had both cry1Ia-type and cry1Ie-type patterns (Fig. 1, lane 16). Eight isolates contained cry1Ic genes, and both cry1Ia and cry1Ib genes were found in five isolates. Three isolates contained both cry1Ib and cry1Ic genes (data not shown). No cry1Id genes were detected.

TABLE 2.

cry1I gene types of B. thuringiensis strains

B. thuringiensis standard strain (serotype) cry1I gene typea
B. thuringiensis subsp. aizawai HD-11 (H7) cry1Ia
B. thuringiensis subsp. alesti HD-4 (H3a) —
B. thuringiensis subsp. canadensis HD-224 (H5a5c) —
B. thuringiensis subsp. entomocidus HD-9 (H6) cry1Ia
B. thuringiensis subsp. finitimus HD-3 (H2) —
B. thuringiensis subsp. galleriae HD-29 (H5a5b) cry1Ib
B. thuringiensis subsp. kurstaki HD-73 (H3a3b) —
B. thuringiensis subsp. morrisoni HD-12 (H8a8b) cry1Ib
B. thuringiensis subsp. pakistani HD-395 (H13) cry1Ia
B. thuringiensis subsp. sotto HD-770 (H4a4b) —
B. thuringiensis isolate Btc007 cry1Ie
B. thuringiensis subsp. thompsoni HD-542 (H12) cry1Ia
B. thuringiensis subsp. thuringiensis HD-2 (H1) cry1Ie
B. thuringiensis subsp. toumanoffi HD-210 (H11a11b) —
a

—, no positive PCR signal.

FIG. 1.

FIG. 1.

PCR-RFLP patterns of cry1I-type genes from B. thuringiensis standard strains and isolates. Lanes: 1 and 10 to 17, B. thuringiensis isolates; 2, B. thuringiensis isolate Btc007; 3, Bacillus thuringiensis subsp. aizawai (H7); 4, B. thuringiensis subsp. morrisoni (H8a8b); 5, Bacillus thuringiensis subsp. entomocidus (H6); 6, B. thuringiensis subsp. pakistani (H13); 7, B. thuringiensis subsp. thuringiensis (H1); 8, Bacillus thuringiensis subsp. thompsoni (H13); 9, B. thuringiensis subsp. galleriae (H5a5b); M, Molecular mass marker (pUC mix).

Cloning and sequence analysis of the cry1Ie1 gene.

The ClaI fragment from B. thuringiensis Btc007 was cloned. Subcloned DNA fragments of about 1 kb were sequenced with an automated DNA sequencer. The sequence analysis showed the presence of an open reading frame encoding a protein of 719 amino acid residues with a predicted molecular mass of 81 kDa. Homology analysis with four known holotype Cry1I proteins indicated that the sequence of Cry1Ie1 protein showed the maximum identity (94.9%) with the Cry1Ib1 protein sequence (Cry1Ie1 sequence identities with the other Cry1I proteins were 93.4% [Cry1Ia1], 91.6% [Cry1Ic1], and 87.7% [Cry1Id1]). Five common conserved regions of Cry protein (14, 21) existed in the Cry1Ie1 sequence; they were located between amino acid residues 186 and 202, 253 and 298, 491 and 526, 557and 567, and 634 and 643.

Expression of the cry1Ie1 gene.

A full-length cry1Ie1 gene containing a BamHI site at the 5′ end and a SalI site at the 3′ end was amplified with a pair of primers. This fragment was inserted into BamHI and SalI sites of the pET-21b vector, generating pETB-1IE. After sequencing analysis proved the sequence of the fragment to be identical to that of cry1Ie1, the recombinant E. coli BL21(DE3) harboring vector pETB-1IE was induced to express the product of the cry1Ie1 gene. The product expressed formed an inclusion in E. coli. SDS-PAGE analysis indicated that the expressed product had a molecular mass of 84.2 kDa (more than 81 kDa of Cry1I protein), because the product was fused with 14 amino acid residues at the N terminus containing a T7 tag and 15 amino acid residues at the C terminus containing a His tag (Fig. 2). More than 70% of the total protein expressed by recombinant E. coli BL21(DE3) harboring the cry1Ie1 gene was the 84.2-kDa fusion protein (Fig. 2, lane 3). The purified Cry1Ie1 inclusion is shown in Fig. 2, lane 2. The cry1Ie1 gene from isolate Btc007 was overexpressed in E. coli BL21(DE3) cells. No 81-kDa expressed product was apparent after the crystal was formed in the Btc007 cells containing cry1Ie1 (Fig. 2, lane 1).

FIG. 2.

FIG. 2.

Electrophoretic analysis of proteins from recombinant E. coli BL21(DE3) and B. thuringiensis isolate Btc007 on an SDS-10% polyacrylamide gel. Lanes: M, high-molecular-mass protein marker; 1, total proteins from B. thuringiensis isolate Btc007 after the formation of the crystal; 2, purified inclusions from recombinant E. coli BL21(DE3) harboring the cry1Ie1 gene; 3, total proteins from recombinant E. coli BL21(DE3) harboring the cry1Ie1 gene; 4, total proteins from E. coli BL21(DE3).

Insect bioassay.

The purified fusion protein Cry1Ie1 was tested for insecticidal activities against five lepidopteran insects and one coleopteran insect. Cry1Ie1 was highly active against the Asian corn borer, with an LC50 of 2.22 μg/ml (95% confidence interval [95% CI], 1.77 to 2.75); the diamondback moth, with an LC50 of 0.20 μg/ml (95% CI, 0.13 to 0.27); and the soybean pod borer, with an LC50 of 9.02 μg/ml (95% CI, 3.50 to 23.24). Cry1Ie1 protein showed no toxicity against the cotton bollworm, the beet armyworm, or the elm leaf beetle (data not shown).

DISCUSSION

Several PCR-based methods for cry gene identification of B. thuringiensis strains have been developed (1-8, 11, 13, 15, 17, 23). Specific-primer PCR and multiplex PCR can directly detect known cry genes from B. thuringiensis (2, 4, 6-8). Exclusive PCR and PCR-RFLP can identify not only known cry genes but also novel cry genes (3, 5, 11, 15, 17, 23). We established a PCR-RFLP method to identify cry1I genes by using the conserved regions of four known cry1I genes as a basis for designing a pair of universal primers for cry1I-type genes which were different from the primers previously reported (18, 19, 22). According to restriction analysis of the sequences of predicted PCR fragments from four genes, two restriction enzymes, Bsp119I and BanI, were used to produce the predicted RFLP patterns. Many B. thuringiensis strains were detected by this method.

We could not detect any cry1I-type gene in Bacillus thuringiensis subsp. kurstaki HD-73, Bacillus thuringiensis subsp. alesti HD-4, Bacillus thuringiensis subsp. canadensis HD-224, Bacillus thuringiensis subsp. finitimus HD-3, Bacillus thuringiensis subsp. sotto HD-770, or Bacillus thuringiensis subsp. toumanoffi HD-201 (Table 2), although B. thuringiensis subsp. alesti HD-4 and B. thuringiensis subsp. toumanoffi HD-201 showed weak signals in response to a cry1I-specific probe (22). Also, B. thuringiensis subsp. alesti HD-4 and B. thuringiensis subsp. toumanoffi HD-201 have been reported to produce no PCR products when PCR was performed with a cry1I-specific probe (13). B. thuringiensis subsp. kurstaki HD-73 was reported to contain a cry1I gene (25), but the present study showed it to harbor no cry1I-type gene. A cry1Ib-type gene was detected in Bacillus thuringiensis subsp. morrisoni HD-12, which showed weak signals by hybridization (22). Bacillus thuringiensis subsp. galleriae (HD-8) produced a PCR fragment, which was not cleaved by KpnI (13). A cry1Ia-type gene was found in Bacillus thuringiensis subsp. pakistani HD-395, and a novel cry1I-type gene—cry1Ie—was found in B. thuringiensis subsp. thuringiensis HD-2. This is surprising, because neither strain showed any signal by hybridization (22).

Our studies did not detect the 81-kDa protein by SDS-PAGE analysis after the crystal was formed in Btc007 cells (Fig. 2, lane 1). Some investigators have reported that many cry1I-type genes are silent in B. thuringiensis strains because they are often located downstream of the cry1 genes and a strong cry1 transcriptional terminator is present in the interval sequence between the cry1 and cry1I genes (13, 22, 25). However, Northern blot analysis showed that the mRNAs of cry1I genes in B. thuringiensis strains were detected at both the T2 and T5 stages of sporulation (18, 26). Cry1Ia is a secreted protein because of the presence of a putative signal peptide in the N-terminal domain I, so it was not accumulated and detected in the cell after the T5 stages of sporulation (16). Thus, we could not determine why no 81-kDa protein was expressed in Btc007 cells. The Northern blot analysis results and the interval sequence between the cry1 and cry1Ie1 genes in Btc007 should be further studied.

Although the first Cry1Ia1 protein reported by Tailor et al. had dual larvicidal activity against Lepidoptera and Coleoptera spp. (25), the Cry1I-type proteins found later had larvicidal activity only against lepidopteran insects (9, 13, 16, 22). Compared with Cry1Ia1, two Cry1Ia proteins (CGCryV and Cry732) that had single amino acid differences in domain I showed insecticidal activity against Lepidoptera and exhibited no activity against Coleoptera (9, 16). Cry1Ia3 (CryV1), Cry1Ib1 (CryV465), and Cry1Id1 proteins from recombinant E. coli were active only against lepidopteran insects (13, 22). Similarly, Cry1Ie1 showed no insecticidal activity against coleopteran insects. We found that the Cry1Ie1 protein was highly toxic to the soybean pod borer, though no insecticidal activity of any Cry protein against this pest had been reported.

Although many toxins have been found in B. thuringiensis strains, only a few of them have been used to effectively control some determined insect pests. Moreover, some insect pests have developed resistance against some B. thuringiensis toxins. In order to solve these problems, isolation of new strains and toxins is crucial. This study has provided a PCR-RFLP method for the rapid identification of cry1I-type genes that can be used not only to retrieve information on the presence of these genes in new isolates but also to discover novel cry1I genes. We also found a novel cry1I-type gene with new insecticidal properties.

Acknowledgments

We thank David J. Ellar of the Department of Biochemistry, Cambridge University, and Jianzhou Zhao of the Department of Entomology, Cornell University, for helpful suggestions and revision of the manuscript. We are grateful to the Research Group on cotton insect pests and corn borers in our Institute for providing the insect larvae and bioassays. We thank Lianyun Dai for providing the B. thuringiensis standard strains.

This study was supported by grants 2001AA214011 and 2001AA212051 from the National High-Technology Plan Project of the People's Republic of China.

REFERENCES

  • 1.Ben-Dov, E., R. Manasherob, A. Zaritsky, Z. Barak, and Y. Margalith. 2001. PCR analysis of cry7 genes in Bacillus thuringiensis by the five conserved blocks of toxins. Curr. Microbiol. 42:96-99. [DOI] [PubMed] [Google Scholar]
  • 2.Ben-Dov, E., Q. Wang, A. Zaritsky, R. Manasherob, Z. Barak, B. Schneider, A. Khamraev, M. Baizhanov, V. Glupov, and Y. Margalith. 1999. Multiplex PCR screening to detect cry9 in Bacillus thuringiensis strains. Appl. Environ. Microbiol. 65:3714-3716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ben-Dov, E., A. Zaritsky, E. Dahan, Z. Barak, R. Sinai, R. Manasherob, A. Khamraev, E. Troitskaya, A. Dubitsky, N. Berezina, and Y. Margalith. 1997. Extended screening by PCR for seven cry-group genes from field-collected strains of Bacillus thuringiensis. Appl. Environ. Microbiol. 63:4883-4890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bourque, S. N., J. R. Valero, J. Mercier, M. C. Lavoie, and R. C. Levesque. 1993. Multiplex polymerase chain reaction for detection and differentiation of the microbial insecticide Bacillus thuringiensis. Appl. Environ. Microbiol. 59:523-527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bravo, A., S. Sarabia, L. Lopez, H. Ontiveros, C. Abarca, A. Ortiz, M. Ortiz, L. Lina, F. J. Villalobos, G. Pena, M. E. Nunez-Valdez, M. Soberon, and R. Quintero. 1998. Characterization of cry genes in a Mexican Bacillus thuringiensis strain collection. Appl. Environ. Microbiol. 64:4965-4972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Carozzi, N. B., V. C. Kramer, G. W. Warren, S. Evola, and M. G. Koziel. 1991. Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles. Appl. Environ. Microbiol. 57:3057-3061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cerón, J., L. Covarrubias, R. Quintero, A. Ortíz, M. Ortíz, E. Aranda, L. Lina, and A. Bravo. 1994. PCR analysis of the cryI insecticidal family genes from Bacillus thuringiensis. Appl. Environ. Microbiol. 60:353-356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cerón, J., A. Ortíz, R. Quintero, L. Guereca, and A. Bravo. 1995. Specific PCR primers directed to identify cryI and cryIII genes within a Bacillus thuringiensis strain collection. Appl. Environ. Microbiol. 61:3826-3831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Choi, S. K., B. S. Shin, E. M. Kong, H. M. Rho, and S. H. Park. 2000. Cloning of a new Bacillus thuringiensis cry1I-type crystal protein gene. Curr. Microbiol. 41:65-69. [DOI] [PubMed] [Google Scholar]
  • 10.Crickmore, N., D. R. Zeigler, J. Feitelson, E. Schnepf, J. Van Rie, D. Lereclus, J. Baum, and D. H. Dean. 1998. Revision of the nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62:807-813. [DOI] [PMC free article] [PubMed]
  • 11.Ferrandis, M. D., V. M. Juárez-Pérez, R. Frutos, Y. Bel, and J. Ferre. 1999. Distribution of cryI, cryII and cryV genes within Bacillus thuringiensis isolates from Spain. Syst. Appl. Microbiol. 22:179-185. [Google Scholar]
  • 12.Finney, D. J. 1971. Probit analysis. Cambridge University Press, Cambridge, United Kingdom.
  • 13.Gleave, A. P., R. Williams, and R. J. Hedges. 1993. Screening by polymerase chain reaction of Bacillus thuringiensis serotypes for the presence of cryV-like insecticidal protein genes and characterization of a cryV gene cloned from B. thuringiensis subsp. kurstaki. Appl. Environ. Microbiol. 59:1683-1687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hofte, H., and H. R. Whiteley. 1989. Insecticidal crystal proteins of Bacillus thuringiensis. Microbiol. Rev. 53:242-255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Juárez-Pérez, V. M., M. D. Ferrandis, and R. Frutos. 1997. PCR-based approach for detection of novel Bacillus thuringiensis cry genes. Appl. Environ. Microbiol. 63:2997-3002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kostichka, K., G. W. Warren, M. Mullins, A. D. Mullins, N. V. Palekar, J. A. Craig, M. G. Koziel, and J. J. Estruch. 1996. Cloning of a cryV-type insecticidal protein gene from Bacillus thuringiensis: the cryV-encoded protein is expressed early in stationary phase. J. Bacteriol. 178:2141-2144. (Erratum, 178:3990.) [DOI] [PMC free article] [PubMed]
  • 17.Kuo, W. S., and K. F. Chak. 1996. Identification of novel cry-type genes from Bacillus thuringiensis strains on the basis of restriction fragment length polymorphism of the PCR-amplified DNA. Appl. Environ. Microbiol. 62:1369-1377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Masson, L., M. Erlandson, M. Puzstai-Carey, R. Brousseau, V. Juárez-Pérez, and R. Frutos. 1998. A holistic approach for determining the entomopathogenic potential of Bacillus thuringiensis strains. Appl. Environ. Microbiol. 64:4782-4788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Porca, M., and V. Juárez-Pérez. 2003. PCR-based identification of Bacillus thuringiensis pesticidal crystal genes. FEMS Microbiol. Rev. 26:419-432. [DOI] [PubMed] [Google Scholar]
  • 20.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 21.Schnepf, E., N. Crickmore, J. Van Rie, D. Lereclus, J. Baum, J. Feitelson, D. R. Zeigler, and D. H. Dean. 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62:775-806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shin, B. S., S. H. Park, S. K. Choi, B. T. Koo, S. T. Lee, and J. I. Kim. 1995. Distribution of cryV-type insecticidal protein genes in Bacillus thuringiensis and cloning of cryV-type genes from Bacillus thuringiensis subsp. kurstaki and Bacillus thuringiensis subsp. entomocidus. Appl. Environ. Microbiol. 61:2402-2407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Song, F., J. Zhang, D. Huang, T. Xie, Z. Yang, L. Dai, and G. Li. 1998. Establishment of PCR-RFLP identification system of cry genes from Bacillus thuringiensis. Sci. Agric. Sin. 31:19-24. [Google Scholar]
  • 24.Tabashnik, B. E., N. Finson, C. F. Chilcutt, N. L. Cushing, and M. W. Johnson. 1993. Increasing efficiency of bioassays: evaluation of resistance to Bacillus thuringiensis in diamondback moth (Lepidoptera: Plutellidae). J. Econ. Entomol. 86:635-644. [Google Scholar]
  • 25.Tailor, R., J. Tippett, G. Gibb, S. Pells, D. Pike, L. Jordan, and S. Ely. 1992. Identification and characterization of a novel Bacillus thuringiensis delta-endotoxin entomocidal to coleopteran and lepidopteran larvae. Mol. Microbiol. 6:1211-1217. [DOI] [PubMed] [Google Scholar]
  • 26.Tounsi, S., and S. Jaoua. 2002. Identification of a promoter for the crystal protein-encoding gene cry1Ia from Bacillus thuringiensis subsp. kurstaki. FEMS Microbiol. Lett. 208:215-218. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES