Phospholipase Cγ2 Contributes to Light-Chain Gene Activation and Receptor Editing

Abstract

Phospholipase Cγ2 (PLCγ2) is critical for pre-B-cell receptor (pre-BCR) and BCR signaling. Current studies discovered that PLCγ2-deficient mice had reduced immunoglobulin λ (Igλ) light-chain usage throughout B-cell maturation stages, including transitional type 1 (T1), transitional type 2 (T2), and mature follicular B cells. The reduction of Igλ rearrangement by PLCγ2 deficiency was not due to specifically increased apoptosis or decreased proliferation of mutant Igλ⁺ B cells, as lack of PLCγ2 exerted a similar effect on apoptosis and proliferation of both Igλ⁺ and Igκ⁺ B cells. Moreover, PLCγ2-deficient Ig^HEL transgenic B cells exhibited an impairment of antigen-induced receptor editing among both the endogenous λ and κ loci in vitro and in vivo. Importantly, PLCγ2 deficiency impaired BCR-induced expression of IRF-4 and IRF-8, the two transcription factors critical for λ and κ light-chain rearrangements. Taken together, these data demonstrate that the PLCγ2 signaling pathway plays a role in activation of light-chain loci and contributes to receptor editing.

During B-cell development, pro-B cells begin the process of immunoglobulin (Ig) heavy (H) gene rearrangement (1, 8, 38, 50). Successful rearrangement of Ig H-chain variable (V), diversity (D), and joining (J) gene segments leads to the formation of the pre-B-cell receptor (pre-BCR), which contains the newly generated H chain in complex with the Vpre-B/λ5 surrogate light (L) chain. Signals from the pre-BCR instruct pre-B cells to expand and halt further H-chain VDJ rearrangement to ensure allelic exclusion (15, 30, 39). Subsequently, the rapidly proliferating pre-B cells exit the cell cycle and undergo rearrangement of Ig L-chain V and J gene segments. The Ig L chain is encoded by the κ and λ loci. Rearrangements within the κ and λ L-chain loci occur independently with a sequential activation of the κ and λ loci (2, 10, 39, 72). In mice, the κ locus comprises 70 to 90 functional Vκ and four functional Jκ gene segments whereas the λ locus contains three functional Vλ and three functional Jλ segments (2, 55). It is believed that the kinetics and efficiency of gene segment rearrangements as well as the number of functional Vκ and Vλ gene segments largely determine the ratio of Igκ⁺ to Igλ⁺ mature B cells (2, 10, 14, 72). In mice, the ratio is 95% κ to 5% λ (14, 61). A successfully rearranged L chain in combination with the previously rearranged H chain generates a surface IgM form of the BCR. B cells with a functional BCR quickly progress into immature B cells and emerge from bone marrow (BM) into the spleen (16, 20). In the spleen, signals emanating from the BCR direct immature B cells to mature through transitional B cells of type 1 (T1) and type 2 (T2) stages and thereafter to long-lived follicular B cells (34). Deletion of the BCR not only arrests B-cell development but also causes apoptosis (25, 27).

To establish B-cell tolerance, immature B cells expressing a self-reactive BCR are negatively selected during maturation by several distinct mechanisms, including clonal deletion, clonal anergy, and receptor editing (20, 42, 45, 49, 50, 56). The BCR signaling threshold appears to regulate the negative selection process. Highly self-reactive cells recognizing membrane-bound self antigens are eliminated by clonal deletion (17, 43), whereas self-reactive cells recognizing soluble self antigens become unresponsive to antigens, a state termed anergy (13). Moreover, self-reactive immature B cells can initiate new rearrangements of V genes, mainly at L-chain loci, to change receptor specificity by receptor editing (5, 7, 12, 48, 63). However, the mechanism that regulates the sequential activation of the κ and λ loci for recombination and the initiation of receptor editing in self-reactive B cells is not clear. Elevation of RAG1 and RAG2 mRNA levels has been observed during receptor editing in B cells (21, 36, 37). Although signals from the BCR have been shown to be involved (33, 67), the basis of this RAG up-regulation is not known. IRF-4 and IRF-8 are two members of the interferon regulatory factor (IRF) family of transcription factors whose expression can be induced by BCR engagement (9, 35, 62). Studies have implied important roles for both IRF-4 and IRF-8 in regulating L-chain rearrangements (4, 40, 46, 59). Importantly, lack of both IRF-4 and IRF-8 prevents rearrangements of Ig L-chain but not H-chain genes during B-cell development (31).

The BCR initiates signaling cascades via the two transmembrane molecules Igα and Igβ and sequential activation of members of three distinct families of cytoplasmic protein tyrosine kinases, including Lyn, Syk, and Btk (22, 24, 64). Subsequent recruitment and tyrosine phosphorylation of the adapter protein, B-cell linker protein (BLNK), and transmembrane protein CD19 facilitate activation of the lipid kinase phosphatidylinositol 3-kinase (22, 26, 44, 51). An important outcome of these events is activation of phospholipase Cγ2 (PLCγ2), which hydrolyzes phosphatidylinositol 4,5-bisphosphate to generate diacylglycerol and inositol 1,4,5-trisphosphate, both of which are required second messengers for cellular responses (53, 54). PLCγ2-deficient mice exhibit impaired early and late B-cell development, and PLCγ2-deficient B cells are unable to respond to antigens, demonstrating that PLCγ2 plays an essential role in B-cell development and function (18, 68-70). Our current studies demonstrate that PLCγ2 plays an important role in activation of the L-chain loci for recombination and receptor editing of self-reactive B cells.

MATERIALS AND METHODS

Mice.

PLCγ2-deficient mice were generated previously (68) and have been backcrossed to the C57BL/6 background. Ig^HEL transgenic mice (C57BL/6 MD4), which bear rearranged Ig H- and Igκ L-chain genes that encode a hen egg lysozyme (HEL)-specific BCR, and sHEL transgenic mice (C57BL/6 ML5), which express soluble HEL (sHEL), were obtained from the Jackson Laboratory. These transgenic mice were bred with heterozygous PLCγ2^+/− mice to ultimately generate wild-type Ig^HEL, PLCγ2-deficient Ig^HEL, wild-type Ig^HEL sHEL, and PLCγ2-deficient Ig^HEL sHEL mice. Mice used for the experiments were generally 8 to 12 weeks of age except where specifically indicated.

Induction of receptor editing in vitro.

BM cells were isolated from the indicated mice and were depleted of red blood cells by lysis with Gey's solution (0.15 M NH₄Cl, 1 mM KHCO₃, and 0.1 mM Na₂EDTA). The cells (2 × 10⁶ cells/ml) were cultured in complete medium RPMI 1640 containing 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin, and 2 ng/ml interleukin-7 (IL-7) (R&D Systems) for 5 days. Then, cells were washed extensively with phosphate-buffered saline (PBS) and recultured at 1 × 10⁶ cells/ml in complete medium without IL-7 and in the presence or absence of HEL (500 ng/ml) (lysozyme-biotin-caproyl; lot no. 071k1567; Sigma). After a further 2-day culture, the cells were harvested for analysis of λ chain protein expression and λ chain gene rearrangements.

Splenocytes (2 × 10⁶/ml) from the indicated mice were cultured in complete medium in the presence or absence of freshly added HEL (500 ng/ml). After a 2-day culture, the cells were harvested for analysis of λ chain protein expression and λ chain gene rearrangements.

Detection of λ and κ chain gene rearrangements.

Genomic DNA was isolated from the indicated cells and was quantified by semiquantitative PCR amplification of the β-actin gene (5′ primer, ACTCCTATGTGGGTGACGAG; 3′ primer, CAGGTCCAGACGCAGGATGGC). The genomic DNA then was subjected to semiquantitative PCR analysis of endogenous λ or κ chain gene rearrangement. Primers employed in the PCR were the same as previously described (41, 73). Specifically, Vλ1/2 (AGAAGCTTGTGACTCAGGAATCTGCA) and Jλ1 (CAGGATCCTAGGACAGTCAGTTTGGT) primers were used to amplify λ1 rearrangements, Vλ2 (ACTGGTCTAATCGGTGGTACCAG) and Cλ2 (AGGAAGCTGCTGGCCATGAACTTGTTGC) primers were used to amplify λ2 rearrangements, and Vλx (GAGCTTAAGAAAGATGGAAGCCA) and Cλ2 primers were used to amplify λx rearrangements. The Vκ degenerate primer (GGCTGCAGSTTCAGTGGCAGTGGRTCW) and the reverse primer downstream of the Jκ1 coding region (GTTCTTTGCCTTGGAGAGTGCCAGAATC) were used to amplify V-Jκ1 rearrangement (11, 21). PCRs were performed as previously described (47, 65). Briefly, the PCR was carried out in a 25-μl final volume containing 0.5 μl of deoxynucleoside triphosphate (10 mM), 1 μl of the primers (10 μM), 2.5 μl of 10× PCR buffer, 5 μl 5× Q solution, 2.5 units of Taq enzyme (QIAGEN), and a serial dilution of template (25 to 1 ng). For detection of λ chain gene rearrangement, cycling conditions were 94°C for 4 min followed by 42 cycles of 94°C for 20 s, 60°C for 30 s, and 72°C for 90 s and a final extension step at 72°C for 5 min. For detection of V-Jκ1 rearrangement, cycling conditions were 97°C for 45 s, 70°C for 1 min, and 72°C for 2.5 min for five cycles; followed by 94°C for 45 s, 70°C for 1 min, and 72°C for 2.5 min for another 29 to 32 cycles; and final extension at 72°C for 6 min.

PCR detection of recombination sequence (RS) rearrangement in the genomic DNA from the indicated cells was performed as previously described (19). Briefly, the primers within the Jκ intron (CTGACTGCAGGTAGCGTGGTCTTCTAG) and downstream of the recombination signal sequence (RSS) (TTGACTGTTTGCTACTTCAGCTCACTG) were used. Cycling conditions were 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min for 35 cycles. Products were separated by electrophoresis in a 1% agarose gel, transferred to a nylon membrane, and hybridized with ³²P-labeled 3′ primer. Genomic DNA was quantified by semiquantitative PCR amplification of the β-actin gene.

Flow cytometry.

Single-cell suspensions of spleen and BM cells were treated with Gey's solution to remove red blood cells. Freshly isolated or cultured cells were resuspended in PBS supplemented with 2% fetal bovine serum and then stained with a combination of fluorescence-conjugated antibodies. CyChrome-conjugated anti-B220 (150452) and allophycocyanin-conjugated anti-IgM (17-5790-82) antibodies were purchased from eBioscience. Phycoerythrin (PE)-conjugated anti-IgD (1120-09L), PE-conjugated anti-Igκ (1170-09), and PE-conjugated anti-Igλ (1175-09L) antibodies were purchased from Southern Biotechnology. Fluorescein isothiocyanate (FITC)-conjugated anti-Igλ (553434) antibodies were purchased from BD Biosciences. Samples were applied to a flow cytometer (LSRII; BD Biosciences), and data were collected and analyzed using CellQuest software (BD Biosciences). For all analyses, forward and side scatter gates were set to include viable cells and to exclude dead cells and debris.

TUNEL assay.

Single-cell suspensions of spleen and BM cells were stained with a combination of CyChrome-conjugated anti-B220 and PE-conjugated anti-Igλ or PE-conjugated anti-Igκ antibodies. Then, the cells were washed with PBS, fixed for 2 h in 4% paraformaldehyde in PBS at room temperature, permeabilized with 0.1% Triton X-100 and 0.1% sodium citrate for 2 min on ice, and labeled with FITC-conjugated terminal deoxynucleotidyltransferase dUTP nick-end labeling (TUNEL) enzyme for 1 h in moist darkness at 37°C according to the manufacturer's instructions (In Situ Cell Death Detection Kit; Roche). The degree of TUNEL positivity in the gated B220⁺ Igλ⁺ or B220⁺ Igκ⁺ subpopulation was analyzed by flow cytometry using CellQuest software.

BrdU incorporation assay.

The in vivo 5-bromo-2′-deoxyuridine (BrdU) staining assay was performed as previously described (71). Briefly, mice were injected intraperitoneally with 1 mg BrdU in 200 μl PBS at 12-h intervals for 5 days. Single-cell suspensions of spleen and BM cells were stained with a combination of CyChrome-conjugated anti-B220 and PE-conjugated anti-Igλ or PE-conjugated anti-Igκ antibodies at 4°C for 30 min. The cells were washed with PBS, resuspended in ice-cold 0.15 M saline, and incubated on ice for 30 min with the addition of 95% ethanol. After washing, the cells were fixed with 1% paraformaldehyde containing 0.01% Tween 20 for 1 h at room temperature. Lastly, the cells were incubated with 50 Kunitz units/ml DNase at 37°C for 10 min, washed with PBS, and stained with FITC-conjugated anti-BrdU antibody (34783; BD Biosciences). The degree of BrdU positivity in the gated B220⁺ Igλ⁺ or B220⁺ Igκ⁺ subpopulation was analyzed by flow cytometry using CellQuest software.

Real-time quantitative RT-PCR analysis.

Total RNA was isolated from the indicated cells, and first-strand cDNA was synthesized from the total RNA with the OneStep reverse transcription-PCR (RT-PCR) kit (210210; QIAGEN) using random primers (HFR704; Gibco) according to the manufacturer's protocols. Real-time PCR was performed to quantitate germ line transcription of Vκ and Vλ using the following primers (23, 57): κ germ line 5′ primer, AGGAGGGTTTTTGTACAGCCAGA; κ germ line 3′ primer, TGGATGGTGGGAAGATGGAT; λ2 germ line 5′ primer, GCTGTGAGAGAACAGGACCA; λ2 germ line 3′ primer, CTCGGGGAAAAGTTGGAAAT. Levels of Vκ and Vλ germ line transcription were normalized to β-actin abundance. The primers used for β-actin were as follows: 5′ primer, CCACAGCTGAGAGGGAAATC, and 3′ primer, CTTCTCCAGGGAGGAAGAGG. Real-time PCR was performed to analyze IRF-4 and IRF-8 gene expression using the following primers: IRF-4 5′ primer, AGATTCCAGGTGACTCTGTG; IRF-4 3′ primer, CTGCCCTGTCAGAGTATTTC; IRF-8 5′ primer, GGGAAGTTTAAAGAGGGAGA; IRF-8 3′ primer, GATCAGCTCCTCAATCTCTG. Levels of IRF-4 and IRF-8 transcript were normalized to CD19 abundance. The primers used for CD19 were as follows: 5′ primer, AATCCACGCATTCAAGTCCAG, and 3′ primer, GAGCCCTCCTCGCTGTCTG. Real-time PCR was carried out in duplicate or triplicate at 50°C for 2 min and then 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min in an iCycler-iQ (Bio-Rad) in 25-μl reaction volumes containing cDNA, primers, and IQ Supermix (170-8862; Bio-Rad). SYBR green was used as the detection reagent. Data were analyzed using standard curves generated for each sample by a series of four consecutive 10-fold dilutions (1 × 10¹ to 1 × 10⁴) of the cDNA template and using iQ Cycler analyzing software and relative transcription calculated using the threshold cycle method. The specificity of the RT-PCR was controlled by the generation of melting curves, PCR efficiencies were 100% ± 15%, and correlation coefficients were 0.988 to 1.

RESULTS

PLCγ2-deficient mice have reduced Igλ L-chain usage throughout B-cell maturation.

To determine whether PLCγ2 plays a role in L-chain gene rearrangement, we examined the expression of Igλ and Igκ L chains in PLCγ2-deficient mice, which were generated previously (68). First, BM cells were stained with an antibody specific for the Igλ or Igκ L-chain constant regions in conjunction with anti-B220 antibody. The proportion of BM B cells that expressed Igλ L chain was markedly reduced in PLCγ2-deficient mice relative to wild-type mice (Fig. 1A and B). In contrast, the proportion of BM B cells that expressed Igκ L chain was comparable or slightly increased in PLCγ2-deficient mice relative to wild-type mice (Fig. 1A). Next, the expression of Igλ or Igκ L chain in splenic B cells was examined. Again, the fraction of splenic B cells expressing Igλ was markedly reduced in PLCγ2-deficient mice relative to wild-type mice (Fig. 1C and D), whereas the fraction of splenic B cells expressing Igκ was comparable between PLCγ2-deficient and wild-type mice (Fig. 1C). Therefore, PLCγ2 deficiency reduces the subpopulation of B cells that express Igλ.

FIG. 1.

Reduction of Igλ chain expression in PLCγ2-deficient B cells. (A) BM cells were isolated from wild-type (PLCγ2^+/+) and PLCγ2-deficient (PLCγ2^−/−) mice and stained with a combination of anti-B220 and anti-Igλ or anti-Igκ antibodies. Percentages indicate Igλ⁺ or Igκ⁺ B cells in the gated live B220⁺ lymphoid population. Data are representative of 10 mice per genotype. (B) Statistical analysis of the percentages of Igλ⁺ B cells in the gated live BM B220⁺ lymphoid population from panel A (n = 10; *, P < 0.01). (C) Splenocytes were isolated from PLCγ2^+/+ and PLCγ2^−/− mice and stained with a combination of anti-B220 and anti-Igλ or anti-Igκ antibodies. Percentages indicate Igλ⁺ or Igκ⁺ B cells in the gated live B220⁺ lymphoid population. Data are representative of 10 mice per genotype. (D) Statistical analysis of the percentages of Igλ⁺ B cells in the gated live splenic B220⁺ lymphoid population from panel C (n = 10; *, P < 0.01).

Moreover, we further determined the effect of PLCγ2 deficiency on the expression of Igλ during the whole process of B-cell maturation. Based on the expression of IgM and IgD, B-cell maturation can be divided into several stages (29, 34). Interestingly, the proportions of IgM⁺ IgD⁻ immature B cells, IgM⁺ IgD^lo transitional B cells, and IgM⁺ IgD^hi mature B cells that expressed Igλ were all reduced in BM cells derived from PLCγ2-deficient mice relative to wild-type mice, with a more severe reduction in Igλ expression observed in B-cell subsets at earlier maturation stages (Fig. 2A and B). Similarly, a reduction of the proportion of cells expressing Igλ was observed in IgM^hi IgD⁻ T1, IgM^hi IgD⁺ T2, and IgM^lo IgD⁺ mature splenic B cells from PLCγ2-deficient mice relative to wild-type mice, with the reduction being more severe in the least-mature subpopulations (Fig. 2C and D). Taken together, these data demonstrate that PLCγ2 deficiency results in reduced Igλ usage throughout B-cell maturation.

FIG. 2.

Reduction of Igλ chain expression during B-cell development in PLCγ2-deficient mice. (A) BM cells were isolated from wild-type (PLCγ2^+/+) and PLCγ2-deficient (PLCγ2^−/−) mice and stained with a combination of anti-B220, anti-IgM, anti-IgD, and anti-Igλ antibodies. Based on expression of IgM and IgD, late BM B cells were defined as IgM⁺ IgD⁻ immature B-cell (I), IgM⁺ IgD^low transitional B-cell (II), and IgM⁺ IgD⁺ mature B-cell (III) subpopulations (top). The expression of B220 and Igλ in the gated B-cell subpopulations (I, II, and III) was analyzed (bottom). Percentages indicate Igλ⁺ B cells in the gated B-cell subpopulation. Data are representative of eight mice per genotype. (B) Statistical analysis of the percentages of Igλ⁺ B cells in the gated B-cell subpopulation from panel A (n = 8; *, P < 0.01). (C) Splenocytes were isolated from wild-type and PLCγ2-deficient mice and stained with a combination of anti-B220, anti-IgM, anti-IgD, and anti-Igλ antibodies. Based on expression of IgM and IgD, splenic B cells were defined as IgM^hi IgD⁻ T1 B-cell (I), IgM^hi IgD⁺ T2 B-cell (II), and IgM^lo IgD⁺ mature B-cell (III) subpopulations (top). The expression of B220 and Igλ in the gated B-cell subpopulations (I, II, and III) was analyzed (bottom). Percentages indicate Igλ⁺ B cells in the gated B-cell subpopulation. Data are representative of eight mice per genotype. (D) Statistical analysis of the percentages of Igλ⁺ B cells in the gated B-cell subpopulation from panel C (n = 8; *, P < 0.01).

Reduced Igλ usage as a consequence of PLCγ2 deficiency is not due to increased apoptosis or decreased proliferation of PLCγ2-deficient Igλ⁺ relative to Igκ⁺ B cells.

A possible explanation for the decreased frequency of Igλ⁺ B cells in PLCγ2-deficient mice relative to wild-type mice is that PLCγ2 deficiency specifically increases apoptosis or decreases proliferation of Igλ⁺ relative to Igκ⁺ B cells. To address this issue, we first used TUNEL staining to quantify the degree of apoptosis in Igλ⁺ and Igκ⁺ B cells from wild-type and PLCγ2-deficient mice. In freshly isolated BM, wild-type and PLCγ2-deficient Igκ⁺ B cells exhibited comparable fractions of TUNEL-positive cells (Fig. 3A). Similarly, PLCγ2-deficient and wild-type BM Igλ⁺ B cells also displayed comparable fractions of TUNEL-positive cells (Fig. 3A). Moreover, Igκ⁺ and Igλ⁺ B cells in the freshly harvested spleens of wild-type and PLCγ2-deficient mice had comparable fractions of TUNEL-positive cells (Fig. 3B). Therefore, PLCγ2 deficiency does not specifically increase apoptosis of Igλ⁺ B cells.

FIG. 3.

Comparable rates of apoptosis and proliferation of Igκ⁺ and Igλ⁺ B cells in wild-type and PLCγ2-deficient mice. Freshly isolated BM cells (A) and splenocytes (B) from wild-type (PLCγ2^+/+) and PLCγ2-deficient (PLCγ2^−/−) mice were stained with a combination of anti-B220 and anti-Igλ or anti-Igκ antibodies. Apoptotic cells were identified by TUNEL staining, and percentages indicate TUNEL-positive cells in the gated B220⁺ Igκ⁺ and B220⁺ Igλ⁺ BM or splenic B-cell populations. BM cells (C) and splenocytes (D) from wild-type (PLCγ2^+/+) and PLCγ2-deficient (PLCγ2^−/−) mice that were injected with BrdU every 12 h for 5 days (5 days) were stained with a combination of anti-BrdU, anti-B220, and anti-Igλ or anti-Igκ antibodies. Mice that were not injected with BrdU served as the baseline control (0 day). The degree of BrdU-positive proliferating cells in the gated B220⁺ Igκ⁺ or B220⁺ Igλ⁺ BM or splenic B-cell populations was determined by flow cytometry, and percentages indicate BrdU-positive cells in the gated cells. The figure shown is representative of five independent analyses.

Next, we compared the status of proliferation of Igλ⁺ and Igκ⁺ B cells in wild-type and PLCγ2-deficient mice. Following administration of BrdU for 5 days, BM was harvested from wild-type and PLCγ2-deficient mice. As expected, both PLCγ2-deficient BM Igκ⁺ and Igλ⁺ B cells incorporated markedly less BrdU than did the corresponding subpopulation of wild-type B cells (Fig. 3C). Similarly, both PLCγ2-deficient Igκ⁺ and Igλ⁺ splenic B cells incorporated clearly less BrdU than did the corresponding subpopulations of wild-type B cells (Fig. 3D). Thus, PLCγ2 deficiency impaired in vivo proliferation of both Igκ⁺ and Igλ⁺ B cells to a similar extent (Fig. 3C and D) and did not specifically decrease proliferation of Igλ⁺ B cells. Taken together, we conclude that reduced Igλ usage by PLCγ2-deficient B cells is not due to increased apoptosis or decreased proliferation of PLCγ2-deficient Igλ⁺ B cells.

PLCγ2 plays a role in receptor editing.

Receptor editing involves new Ig gene rearrangements, particularly at L-chain loci, and is accompanied by increased Igλ usage (5, 52, 63). The impaired Igλ usage by PLCγ2-deficient B cells prompted us to examine the role of PLCγ2 in receptor editing. PLCγ2-deficient mice were crossed with Ig^HEL transgenic mice, which bear rearranged H- and Igκ L-chain genes encoding a BCR that specifically recognizes HEL (13). BM cells from wild-type or PLCγ2-deficient Ig^HEL transgenic mice were cultured for 5 days with IL-7 to expand the virtually uniform B-cell population that expresses the Ig^HEL BCR (data not shown). Consistent with a previous study (65), BM-derived (Fig. 4A) and freshly isolated splenic (Fig. 4B) Ig^HEL B cells from wild-type transgenic mice underwent receptor editing and rearranged endogenous L-chain genes in response to HEL stimulation in vitro, resulting in a detectable fraction of cells expressing Igλ. In contrast, following HEL stimulation, BM-derived (Fig. 4A) and freshly isolated splenic (Fig. 4B) Ig^HEL B cells from PLCγ2-deficient mice exhibited a small but constant reduction in the population of cells expressing Igλ compared to wild-type cells. Of note, both the wild-type and PLCγ2-deficient BM-derived (Fig. 4A) and freshly isolated splenic (Fig. 4B) Ig^HEL B cells exhibited low background expression of endogenous Igλ when cultured with medium alone. Therefore, PLCγ2 deficiency reduces antigen-induced expression of Igλ associated with receptor editing in vitro.

FIG. 4.

Impairment of antigen-induced receptor editing in PLCγ2-deficient B cells. Antigen-induced receptor editing is impaired in PLCγ2-deficient BM-derived (A) and splenic (B) Ig^HEL B cells in vitro. BM cells from wild-type or PLCγ2-deficient Ig^HEL transgenic mice were initially cultured for 5 days with IL-7, and splenocytes were isolated from wild-type or PLCγ2-deficient Ig^HEL transgenic mice. The cells were then recultured without IL-7 and in the absence (medium) or presence (HEL) of HEL. After a further 2-day culture, the cells were harvested and stained with anti-B220 and anti-Igλ antibodies. Percentages indicate Igλ⁺ cells in the gated B220⁺ B lymphocytes. Data are representative of three independent experiments. Antigen-induced receptor editing is impaired in PLCγ2-deficient BM (C) and splenic (D) Ig^HEL B cells in vivo. BM cells from 21-week-old wild-type or PLCγ2-deficient Ig^HEL sHEL mice were stained with anti-B220, anti-IgM, and anti-Igλ antibodies. Fluorescence-activated cell sorting analysis with B220 and Igλ staining of IgM⁺ gated cells is shown. Splenocytes from 21-week-old wild-type or PLCγ2-deficient Ig^HEL sHEL mice were stained with anti-B220 and anti-Igλ antibodies. Percentages indicate Igλ⁺ cells in the gated B220⁺ B lymphocytes. Data are representative of three independent analyses. (E) Statistical analysis of the percentages of Igλ⁺ B cells in the gated live BM IgM⁺ B220⁺ lymphoid population from panel C (n = 3; *, P < 0.01). (F) Statistical analysis of the percentages of Igλ⁺ B cells in the gated live splenic B220⁺ lymphoid population from panel D (n = 3; **, P < 0.05).

Importantly, the effect of PLCγ2 deficiency on receptor editing was also confirmed in vivo. When wild-type Ig^HEL transgenic mice were bred with transgenic mice expressing sHEL, sHEL induced receptor editing and resulted in expression of Igλ in BM and splenic B cells of 21-week-old mice (Fig. 4C to F). Strikingly, PLCγ2-deficient Ig^HEL sHEL mice of the same age displayed a dramatic reduction in the fraction of BM and splenic B cells expressing Igλ relative to wild-type controls (Fig. 4C to F). Thus, PLCγ2 deficiency impairs antigen-induced expression of Igλ, which is associated with receptor editing in vivo.

Impaired antigen-induced rearrangement of endogenous Igλ associated with PLCγ2 deficiency in vivo was further confirmed at the level of genomic DNA. Genomic DNA was isolated from wild-type Ig^HEL, PLCγ2-deficient Ig^HEL, wild-type Ig^HEL sHEL, and PLCγ2-deficient Ig^HEL sHEL mice, and levels of endogenous Igλ gene rearrangements were determined by semiquantitative PCR. Splenic B cells from wild-type mice served as a positive control, in which rearrangements of V-Jλ1, V-Jλ2, and V-Jλx were easily detectable (Fig. 5A). Embryonic stem (ES) cells served as a negative control, in which rearrangements of V-Jλ1, V-Jλ2, and V-Jλx were not detectable (Fig. 5A). As expected, both wild-type Ig^HEL and PLCγ2-deficient Ig^HEL splenic B cells had barely detectable levels of rearrangements of endogenous V-Jλ1, V-Jλ2, and V-Jλx (Fig. 5A). Interestingly, whereas splenic B cells from wild-type Ig^HEL sHEL mice exhibited apparent rearrangements of endogenous V-Jλ1, V-Jλ2, and V-Jλx, such rearrangements were not detectable in PLCγ2-deficient Ig^HEL sHEL splenic B cells (Fig. 5A).

FIG. 5.

Impairment of antigen-induced receptor editing among the endogenous λ and κ loci in PLCγ2-deficient Ig^HEL B cells. (A) Impairment of antigen-induced receptor editing among the endogenous λ and κ loci in PLCγ2-deficient splenic Ig^HEL B cells in vivo. Genomic DNA was isolated from the splenocytes derived from wild-type Ig^HEL, PLCγ2-deficient Ig^HEL, wild-type Ig^HEL sHEL, or PLCγ2-deficient Ig^HEL sHEL mice. Subsequently, the genomic DNA was subjected to a semiquantitative PCR analysis of the β-actin gene; of endogenous λ1, λ2, λx, and Jκ1 rearrangements, and of RS rearrangement. Genomic DNA of splenic B cells from wild-type mice served as a positive control, whereas genomic DNA from ES cells served as a negative control. Data are representative of three independent experiments for λ rearrangements and two independent experiments for Jκ1 and RS rearrangements. (B) Impairment of antigen-induced rearrangements of endogenous λ and κ chain in PLCγ2-deficient BM-derived Ig^HEL B cells in vitro. BM cells from wild-type or PLCγ2-deficient Ig^HEL transgenic mice were cultured for 5 days with IL-7 to expand into a B-cell population that expresses the Ig^HEL BCR. Following further stimulation with (HEL) or without (medium) HEL for 2 days, genomic DNA was isolated from the cells and subsequently subjected to a semiquantitative PCR analysis of the β-actin gene and of endogenous λ1 and Jκ1 rearrangements. Genomic DNA of BM B cells from wild-type mice served as a positive control, whereas genomic DNA from ES cells served as a negative control. Data are representative of three independent experiments for λ rearrangements and two independent experiments for Jκ1 rearrangement. WT, wild type.

Further, we examined the effect of PLCγ2 deficiency on antigen-induced rearrangement of endogenous Igκ, which is also associated with receptor editing in vivo. Ig^HEL transgenic mice have a rearranged V-Jκ2 transgene (60). Thus, we examined the rearrangement of endogenous V-Jκ1 in genomic DNA derived from wild-type Ig^HEL, PLCγ2-deficient Ig^HEL, wild-type Ig^HEL sHEL, and PLCγ2-deficient Ig^HEL sHEL mice by semiquantitative PCR. Both wild-type Ig^HEL and PLCγ2-deficient Ig^HEL splenic B cells had low levels of rearrangements of endogenous V-Jκ1 (Fig. 5A). Notably, antigen-induced rearrangement of endogenous V-Jκ1 was reduced in splenic B cells derived from PLCγ2-deficient Ig^HEL sHEL mice relative to wild-type controls (Fig. 5A). Moreover, RS rearrangement between an intron RS within the Jκ-Cκ intron and an RSS located downstream of Cκ, a critical mechanism for the receptor editing of Igκ (52), was reduced in splenic B cells derived from PLCγ2-deficient Ig^HEL sHEL mice relative to wild-type controls (Fig. 5A). Therefore, PLCγ2 contributes not only to Igλ but also to Igκ rearrangement.

Impaired antigen-induced rearrangements of Igλ and Igκ genes in PLCγ2-deficient B cells were also confirmed at genomic DNA levels in an in vitro receptor editing experiment. BM cells from wild-type or PLCγ2-deficient Ig^HEL transgenic mice were cultured for 5 days with IL-7 to expand the uniform B-cell population that expresses the Ig^HEL BCR. Following further stimulation with HEL or medium, genomic DNA was isolated from the cells and levels of endogenous gene Igλ and Igκ rearrangements were determined by semiquantitative PCR. BM B cells from wild-type mice served as a positive control, in which V-Jλ1 rearrangements were easily detectable (Fig. 5B). ES cells served as a negative control, in which V-Jλ1 rearrangements were not detectable (Fig. 5B). Both wild-type and PLCγ2-deficient BM-derived Ig^HEL B cells had low background levels of rearrangements of endogenous Igλ and Igκ genes when cultured with medium alone (Fig. 5B). Upon HEL stimulation, wild-type BM-derived Ig^HEL B cells underwent receptor editing such that rearrangements of endogenous V-Jλ1 and V-Jκ1 gene were easily detectable (Fig. 5B), consistent with a previous study (65). In contrast, PLCγ2-deficient BM-derived Ig^HEL B cells displayed a barely detectable level of rearrangement of V-Jλ1 and a reduced level of rearrangements of V-Jκ1 following HEL stimulation (Fig. 5B). These genomic data further confirm that PLCγ2 deficiency impairs activation of Igλ and Igκ locus. Taken together, our results demonstrate that PLCγ2 plays a role in rearrangements of Igλ and Igκ, which are associated with receptor editing.

Ig L recombination requires accessibility of both the V region and J region to the recombination machinery, and germ line transcription of Vλ and Vκ positively correlates with their accessibility (3). Thus, we compared germ line transcription of Vλ and Vκ genes in wild-type and PLCγ2-deficient pro/pre-B cells. B220^low IgM⁻ pro/pre-B cells were sorted out from BM of wild-type or PLCγ2-deficient mice. The levels of Vλ and Vκ germ line transcription in these cells were quantitated by real-time PCR. The level of Vλ germ line transcription was markedly decreased in PLCγ2-deficient pro/pre-B cells compared to wild-type controls (Fig. 6A). Of note, the level of Vκ germ line transcription was also decreased in PLCγ2-deficient pro/pre-B cells compared to wild-type controls (Fig. 6A). Thus, consistent with an important role for PLCγ2 in rearrangements of Igλ and Igκ, PLCγ2 deficiency reduces the germ line transcription of both Vλ and Vκ genes, especially the former.

FIG. 6.

Impairment of germ line transcription of light-chain genes and BCR-mediated expression of IRF-4/IRF-8 in PLCγ2-deficient B cells. (A) Reduction of germ line transcription of λ and κ chain in PLCγ2-deficient pro/pre-B cells. The pro/pre-B (B220^low IgM⁻) cells were sorted from BM of 4-month-old PLCγ2^+/+ and PLCγ2^−/− mice. Then, total RNA was isolated from the cells and subjected to real-time RT-PCR analysis of germ line transcription of λ and κ chain. Data are a combination of results from two independent experiments. (B) BCR-induced expression of IRF-4 and IRF-8 is impaired in PLCγ2-deficient BM-derived Ig^HEL B cells in vitro. BM cells were isolated from wild-type (PLCγ2^+/+ Ig^HEL) and PLCγ2-deficient (PLCγ2^−/− Ig^HEL) Ig^HEL mice and were initially cultured with IL-7 for 5 days. The cells were then stimulated with (α-IgM) or without (medium) anti-IgM for 2 h. Total RNA was isolated from the cells and subjected to real-time RT-PCR analysis of IRF-4 and IRF-8 gene expression. The figures shown are representative of three independent experiments. (C) Impairment of BCR-induced expression of IRF-4 and IRF-8 in PLCγ2-deficient splenic Ig^HEL B cells in vivo. Splenic B cells were isolated from wild-type and PLCγ2-deficient Ig^HEL sHEL mice. Total RNA was isolated from the cells and subjected to real-time RT-PCR analysis of IRF-4 and IRF-8 gene expression. The figure shown is representative of four independent experiments.

PLCγ2 deficiency impairs BCR-induced expression of IRF-4 and IRF-8.

IRF-4 and IRF-8 are transcription factors whose expression can be induced by BCR engagement (9, 35, 62). Both transcription factors play essential roles in rearrangement of Ig L-chain genes during B-cell development, and their deficiencies block rearrangement of κ and λ chain genes (31). Thus, we examined the effect of PLCγ2 deficiency on BCR-mediated induction of IRF-4 and IRF-8 expression. BM cells from wild-type or PLCγ2-deficient Ig^HEL transgenic mice were cultured for 5 days with IL-7 to expand the Ig^HEL BCR-expressing uniform B-cell progenitors. Cross-linking of the BCR dramatically induced expression of IRF-4 and IRF-8 in wild-type BM-derived Ig^HEL B cells (Fig. 6B). In contrast, BCR-induced expression of IRF-4 and IRF-8 was markedly impaired in PLCγ2-deficient BM-derived Ig^HEL B cells (Fig. 6B). In addition, we examined the effect of PLCγ2 deficiency on BCR engagement-induced expression of IRF-4 and IRF-8 in vivo. Splenic B cells were isolated from wild-type or PLCγ2-deficient Ig^HEL transgenic mice that also express sHEL, and expression of IRF-4 and IRF-8 in these cells was determined by real-time RT-PCR. The expression of IRF-4 and IRF-8 was markedly reduced in PLCγ2-deficient Ig^HEL sHEL B cells compared to wild-type Ig^HEL sHEL splenic B cells (Fig. 6C). Thus, PLCγ2 deficiency severely impairs antigen-induced expression of IRF-4 and IRF-8 both in vitro and in vivo.

DISCUSSION

Although previous studies have shown that PLCγ2 plays an important role in early B-cell development at the pro-B to pre-B transition and is essential for maturation of T2 to follicular B cells (68-70), our current studies discovered that PLCγ2 deficiency impairs rearrangements of Igλ and Igκ L-chain genes, resulting in an impairment of antigen-induced receptor editing. Although the impairment of Igκ rearrangement is not obvious in nontransgenic PLCγ2-deficient mice, it is clearly detected in the PLCγ2-deficient Ig^HEL sHEL transgenic mice. Previous studies have demonstrated that rearrangements of Igκ and Igλ occur independently with different kinetics, such that the κ locus is activated and the λ locus is not subsequently activated until rearrangements of κ genes fail to yield a functional Igκ L chain (2, 10, 39, 72). A different regulation of the activation of these two loci for recombination might explain that differential effect of PLCγ2 deficiency on the κ versus the λ locus. PLCγ2 provides an important signal involved in the activation of both the λ and κ loci, although the signal seems to be more essential for the activation of λ. Interestingly, the two signaling molecules that are upstream of PLCγ2 in BCR signaling, the adapter molecule BLNK and the tyrosine kinase Btk, have also been shown to play roles in the activation of the L-chain loci (6, 19). Similar to deficiency of PLCγ2, lack of BLNK impairs the activation of both Igλ and Igκ loci, leading to an impairment of antigen-induced receptor editing (19). In contrast, Btk deficiency has no effect on antigen-induced receptor editing, although it severely reduces the expression of Igλ chain (6). One possible explanation is that PLCγ2 and BLNK initiate additional Btk-independent signals that are required for receptor editing.

The ratio of Igκ⁺ versus Igλ⁺ mature B cells is ultimately determined by the kinetics and efficiency of activation of κ and λ loci, the number of functional Vκ and Vλ gene segments, and the survival and proliferation rates of B cells that have undergone L-chain gene rearrangement (28, 72). Although PLCγ2 is known to be involved in the survival and proliferation of transitional and mature B cells (68, 70), our analysis of apoptosis and proliferation rates in Igλ⁺ and Igκ⁺ B-cell populations derived from wild-type and PLCγ2^−/− mice demonstrates that PLCγ2 deficiency does not specifically increase apoptosis or decrease proliferation of Igλ⁺ B cells relative to Igκ⁺ B cells. Therefore, the reduced usage of Igλ relative to Igκ in nontransgenic PLCγ2-deficient B cells is not due to a shortened life span or decreased proliferative capacity of Igλ⁺ B cells relative to Igκ⁺ B cells. Instead, the reduced usage of Igλ by PLCγ2-deficient B cells appears to be due solely to the absence of signals from PLCγ2 that differentially regulate activation of the Igλ and Igκ loci. Consistently, overexpression of the antiapoptotic molecule Bcl-2 protects Btk-deficient B cells from apoptosis but does not alter the frequency of Igλ expression in the mutant B cells (6).

Binding of self antigen to self-reactive B cells can initiate new Ig gene rearrangements, especially at L-chain loci, to replace a self-reactive receptor with a new receptor (5, 7, 12, 48, 63). The BCR signaling pathway that specifically regulates receptor editing is not clear, although BLNK has been shown to play an important role in receptor editing (19). Although development of anergy is a dominant phenotype in the Ig^HEL sHEL transgenic mode, this model can be used to study receptor editing (66). Previous studies have demonstrated that sHEL is able to induce autoreactive Ig^HEL B cells to undergo receptor editing in vitro (65, 66). Consistent with these previous studies, we found that both BM culture-derived and primary splenic B cells from wild-type Ig^HEL mice undergo sHEL-induced Igλ expression in vitro. However, sHEL-induced expression of Igλ is severely impaired in PLCγ2^−/− Ig^HEL B cells. Expression of sHEL as a “self antigen” in mice that express Ig^HEL might be expected to induce editing of the “autoreactive” Ig^HEL receptor and consequent expression of endogenous Igλ in vivo. Whereas a previous study failed to detect elevated levels of Igλ expression in B cells from young (<12 weeks of age) Ig^HEL sHEL double-transgenic mice in vivo (65), we constantly observed Igλ expression in B cells from older (>13 weeks of age), but not younger (data not shown), Ig^HEL sHEL double-transgenic mice in vivo. Importantly, Igλ expression was much lower in B cells from older PLCγ2-deficient mice than in B cells from wild-type Ig^HEL sHEL double-transgenic mice. Taken together, our results show that PLCγ2 signaling downstream of BCR engagement plays a role in receptor editing both in vitro and in vivo.

IRF-4 and IRF-8 are two members of the IRF family of transcription factors that are essential for down-regulation of both surrogate L-chain expression and rearrangement of Igκ and Igλ chain genes during B-cell development (32). In the absence of IRF-4 and IRF-8, rearrangement of both Igκ and Igλ chain genes is blocked (32). We show in the present studies that the PLCγ2 pathway plays a critical role in BCR-induced expression of IRF-4 and IRF-8. Nevertheless, although PLCγ2 deficiency severely impairs up-regulation of both transcription factors, it more severely impairs rearrangement of Igλ than Igκ chain genes in nontransgenic mice. One possible explanation for this observation is that high levels of IRF-4 and IRF-8 may be required for Igλ chain gene rearrangement whereas low levels of IRF-4 and IRF-8 may be sufficient for Igκ chain gene rearrangement. Thus, the complete absence of IRF-4 and IRF-8 caused by targeted gene disruption would be expected to block rearrangement of both Igκ and Igλ chain genes, whereas reduced expression of IRF-4 and IRF-8, for example as a consequence of PLCγ2 deficiency, would be expected to affect rearrangement of Igλ more than that of Igκ. In fact, a recent study has demonstrated that IRF-4 is expressed in a graded manner in differentiating B cells and that different concentrations of IRF-4 regulate expression of distinct genes that coordinate isotype switching during plasma cell differentiation (58). Moreover, both IRF-4 and IRF-8 are essential for germ line transcription of Vκ and Vλ (31). Levels of germ line transcription of Vκ and Vλ positively correlate with their accessibility to the recombination machinery (3). The impaired expression of IRF-4 and IRF-8 as a consequence of PLCγ2 deficiency should contribute to the reduction of the germ line transcription of Vκ and particularly Vλ genes. Nonetheless, further studies are required to fully understand the mechanism by which the PLCγ2 pathway regulates L-chain gene rearrangement and receptor editing.