Abstract
A total of 232 isolates of gram-negative bacteria were recovered from mammals, reptiles, and birds housed at Asa Zoological Park, Hiroshima prefecture, Japan. Forty-nine isolates (21.1%) showed multidrug resistance phenotypes and harbored at least one antimicrobial resistance gene. PCR and DNA sequencing identified class 1 and class 2 integrons and many β-lactamase-encoding genes, in addition to a novel AmpC β-lactamase gene, blaCMY-26. Furthermore, the plasmid-mediated quinolone resistance genes qnr and aac(6′)-Ib-cr were also identified.
Problems associated with the development and spread of antibiotic resistance in clinical practice have been increasing since the early 1960s and are currently viewed as a major threat to the public health on a global level (15). Animals, particularly wild animals, are believed to be the source of >70% of all emerging infections (13). A recent report identified more than 25 human infectious disease outbreaks over a 10-year period (1990 to 2000) as being associated with visits to animal exhibits (2). Of particular concern is the potential transmission of multidrug-resistant zoonotic pathogens from zoo animals to humans. As little is known about antimicrobial-resistant bacteria in zoo animals, this study was conducted to monitor the incidence and prevalence of antimicrobial resistance genes in gram-negative bacteria isolated from zoo animals in Japan.
A total of 103 swabs (68 fecal, 33 water, and 2 nasal swabs) were randomly taken from different mammals, reptiles, birds, and water sources between June and September 2006 at Asa Zoological Park, Hiroshima prefecture, Japan. A total of 232 gram-negative bacteria were isolated, and the biochemical identification showed that the most prevalent species was Escherichia coli (122 isolates; 52.6%), followed by Klebsiella pneumoniae (17 isolates; 7.3%), Proteus mirabilis (16 isolates; 6.9%), Enterobacter aerogenes (14 isolates; 6.0%), Klebsiella oxytoca (13 isolates; 5.6%), Pseudomonas aeruginosa (12 isolates; 5.2%), Enterobacter cloacae (11 isolates; 4.7%), Proteus vulgaris (5 isolates; 2.2%), Citrobacter koseri (5 isolates; 2.2%), Citrobacter freundii (4 isolates; 2.2%), Morganella morganii (4 isolates; 1.7%), Salmonella spp. (3 isolates; 1.3%), Serratia marcescens (2 isolates; 0.9%), and a single isolate (0.43%) of Acinetobacter baumannii, Aeromonas spp., Pseudomonas fluorescens, and Edwardsiella tarda.
The antimicrobial sensitivity phenotypes of recovered bacteria were determined by using a disk diffusion assay according to the standards and interpretive criteria described by CLSI (5). The results showed that 49 isolates (21.1%) showed resistance phenotypes to two or more antimicrobial agents. The most commonly reported resistance phenotypes were against ampicillin, cephalothin, streptomycin, trimethoprim-sulfamethoxazole, kanamycin, tetracycline, nalidixic acid, and ciprofloxacin. Similar resistance phenotypes have been recorded previously for strains of E. coli isolated from wild animals in Portugal, from free-living Canada geese in Georgia and North Carolina, and from black-headed gulls in the Czech Republic (6-8). Interestingly, many isolates showed resistance phenotypes to extended-spectrum β-lactam antibiotics, such as cefotaxime, ceftazidime, cefpodoxime, ceftriaxone and aztreonam, which are widely used for the treatment of serious infections in hospitals (3).
Integrons play a major role in the spread of antibiotic resistance genes in gram-negative bacteria (28). In this study, primers 5′-CS and 3′-CS, which amplify the region between the 5′ conserved segment and 3′ conserved segment of class 1 integrons, were used as previously described (Table 1) (14). PCR screening detected class 1 integrons in 16 bacterial isolates (6.9%); 11 E. coli isolates, 2 P. vulgaris isolates, and 1 isolate of E. cloacae, M. morganii, and P. mirabilis (Table 2). DNA sequencing results for the inserted gene cassettes identified seven profiles of class 1 integrons (Table 2). The identified antimicrobial resistance genes were dfrA1, dfrA5, dfrA12, dfrA15, and dfrA17, dihydrofolate reductase types which confer resistance to trimethoprim, and aadA1, aadA2 and aadA5, aminoglycoside adenyltransferase types which confer resistance to streptomycin and spectinomycin. The resistance phenotypes were expressed for most of these genes (Table 2). It was of interest that class 1 integrons harboring aadA1 have been previously identified for E. coli isolated from free-living Canada geese in Georgia and North Carolina and black-headed gulls in the Czech Republic (6, 8), while another type of class 1 integron harboring aadA7 has been previously identified in an E. coli strain isolated from the Washington Zoo, Seattle, WA (17). On the other hand, for the detection of class 2 integrons, PCR was performed with the primer pair hep74 and hep51, specific to the conserved regions of class 2 integrons, as described previously (Table 1) (31). Class 2 integrons were detected in four isolates (1.7%), including three E. coli isolates and one P. mirabilis isolate (Table 2). DNA sequencing results for the inserted gene cassettes within class 2 integrons identified the three classic resistance genes dfrA1, sat2, and aadA1, which are usually associated with transposon Tn7 (11). To the best of our knowledge, this is the first report for class 2 integrons from zoo animals.
TABLE 1.
Primers used in this study
| Target category and primer | Sequence (5′ to 3′) | Target | Reference or GenBank accession no. |
|---|---|---|---|
| Integrons | |||
| 5′-CS | GGCATCCAAGCAGCAAG | Class 1 integron | 14 |
| 3′-CS | AAGCAGACTTGACCTGA | ||
| hep74 | CGGGATCCCGGACGGCATGCACGATTTGTA | Class 2 integron | 31 |
| hep51 | GATGCCATCGCAAGTACGAG | ||
| IntI2-F2 | GATCCTGCCATCATTGAGTA | Within class 2 integron | 1 |
| IntI2-R2 | AGGGGAAGCCGAAGTTTCC | ||
| β-Lactamases | |||
| TEM-F | ATAAAATTCTTGAAGACGAAA | blaTEM | 1 |
| TEM-R | GACAGTTACCAATGCTTAATC | ||
| SHV-F | TTATCTCCCTGTTAGCCACC | blaSHV | 1 |
| SHV-R | GATTTGCTGATTTCGCTCGG | ||
| SHV-F-2 | CGGCCTTCACTCAAGGATGTA | Whole blaSHV | DQ247972 |
| SHV-R-2 | GTGCTGCGGGCCGGATAAC | ||
| OXA-F | TCAACTTTCAAGATCGCA | blaOXA | 1 |
| OXA-R | GTGTGTTTAGAATGGTGA | ||
| CTX-M-F | CGCTTTGCGATGTGCAG | blaCTX-M | 1 |
| CTX-M-R | ACCGCGATATCGTTGGT | ||
| CTX-M-F2 | CCAGAATAAGGAATCCCATG | Whole blaCTX-M | NC_004464 |
| CTX-M-R2 | GCCGTCTAAGGCGATAAAC | ||
| CMY-F | GACAGCCTCTTTCTCCACA | blaCMY | 33 |
| CMY-R | TGGAACGAAGGCTACGTA | ||
| CMY-F2 | ACGGAACTGATTTCATGATG | Whole blaCMY | AY899928 |
| CMY-R2 | GAAAGGAGGCCCAATATCCT | ||
| Oxy-F | GGTTTTGGTAACTGTGACGGG | blaOXY | 10 |
| Oxy-R | CAGAGTGCAGAGTGTTGCAG | ||
| Oxy-F2 | GGCAATCCAGCCGGGGCCAA | Whole blaOXY | Z30177 |
| Oxy-R2 | CGGGCCTGTTCCCGGGTTAA | ||
| Plasmid-mediated quinolone resistance genes | |||
| qnrA-F | ATTTCTCACGCCAGGATTTG | qnrA | 27 |
| qnrA-R | GATCGGCAAAGGTTAGGTCA | ||
| qnrB-F | GATCGTGAAAGCCAGAAAGG | qnrB | 27 |
| qnrB-R | ACGATGCCTGGTAGTTGTCC | ||
| qnrS-F | ACGACATTCGTCAACTGCAA | qnrS | 27 |
| qnrS-R | TAAATTGGCACCCTGTAGGC | ||
| aac(6′)-Ib-F | TTGCGATGCTCTATGAGTGGCTA | aac(6′)-Ib | 22 |
| aac(6′)-Ib-R | CTCGAATGCCTGGCGTGTTT |
TABLE 2.
Resistance phenotype and prevalence of integrons and resistance genes in gram-negative bacteria
| Isolate | Animal(s) (source) | Bacteria | Resistance phenotypea | Integron/resistance gene(s) |
|---|---|---|---|---|
| AZ1-1 | Wild birds (feces) | A. baumannii | AMP, CEF | blaTEM-1 |
| AZ2-3 | Wild birds (feces) | E. coli | TET, STR, NAL, SXT | Class 2 (dfrA1-sat2-aadA1) |
| AZ5-3 | Wild birds (water) | E. coli | AMP, CEF, SXT, CHL | Class 1 (dfrA17-aadA5), blaTEM-1 |
| AZ10-1 | Scarlet macaw (feces) | E. coli | AMP, CEF, TET, STR, NAL, CIP, SXT, GEN, NOR, | Class 1 (dfrA1-aadA1), blaTEM-1 |
| AZ12-2 | Turtle (water) | P. fluorescens | NAL, SXT | qnrB |
| AZ15-3 | White pelican (water) | E. coli | TET, STR, SXT | Class 2 (dfrA1-sat2-aadA1) |
| AZ19-1 | Rhesus monkey (feces) | E. coli | AMP, CEF | blaTEM-1 |
| AZ20-1 | Horned owl (feces) | E. coli | TET, KAN, STR, NAL, SXT | Class 2 (dfrA1-sat2-aadA1) |
| AZ23-2 | Falcon (feces) | E. coli | STR, TET, NAL, SXT | Class 1(dfrA15-aadA1), qnrB |
| AZ23-3 | Falcon (feces) | P. vulgaris | TET, STR, NAL, SXT | Class 1 (dfrA1-orf) |
| AZ23-4 | Falcon (feces) | E. coli | STR, SXT | Class 1 (dfrA15-aadA1) |
| AZ26-2 | Jaybird (feces) | K. oxytoca | FOX, CTT, AMP, CEF, CRO, AMC, SXT, KAN | blaCMY-26 |
| AZ26-4 | Jaybird (feces) | E. coli | TET, STR, NAL, CIP, AMP, SXT, CHL, NOR | Class 1 (aadA2) |
| AZ29-2 | Kite and owl (feces) | E. coli | TET, STR, NAL, SXT | Class 1 (dfrA15-aadA1) |
| AZ29-4 | Kite and owl (feces) | M. morganii | TET, STR, NAL, SXT | Class 1 (dfrA12-orf-aadA2) |
| AZ30-1 | Goshawk (feces) | E. coli | AMP, CEF | blaTEM-1 |
| AZ31-2 | Falcon (feces) | P. vulgaris | TET, KAN, NAL, AMP, CEF, SXT, CHL | Class 1 (dfrA1-orf), blaTEM-1 |
| AZ31-3 | Falcon (feces) | P. mirabilis | TET, KAN, NAL, AMP, SXT, CHL | Class 1 (dfrA1-orf) |
| AZ33-1 | Honey buzzard (feces) | E. coli | AMP, CEF | blaTEM-1 |
| AZ33-3 | Honey buzzard (feces) | P. mirabilis | STR, NAL, AMP, SXT, CHL | Class 2 (dfrA1-sat2-aadA1) blaTEM-1 |
| AZ35-3 | Falcon (feces) | E. coli | TET, STR, KAN, CIP, CHL, NOR | Class 1 (dfrA17-aadA5) |
| AZ36-1 | Birds (feces) | E. coli | AMP, CEF, CPD, CAZ, IMP, NAL, SXT, TET | blaSHV-36 |
| AZ36-4 | Wild birds (feces) | E. coli | AMP, CEF | blaTEM-1 |
| AZ37-1 | Wild birds (feces) | E. coli | AMP, CEF | blaTEM-1 |
| AZ39-1 | Japanese four-striped rat snake (feces) | K. oxytoca | AMP, CEF, AMC, AZT | blaOXY-2 |
| AZ54-2 | Red rat snake (feces) | E. coli | AMP, CEF | blaTEM-1 |
| AZ58-1 | Giant salamander (water) | K. oxytoca | AMP, CEF, CPDX, AZT | blaOXY-2 |
| AZ60-2 | Eastern box turtle (water) | K. oxytoca | NAL | qnrB |
| AZ62-1 | Indian star tortoise/feces | K. pneumoniae | AMP, NAL, SXT | qnrB |
| AZ66-2 | Aldabra giant tortoise (feces) | E. coli | AMP, CEF | blaTEM-1 |
| AZ67-1 | Aldabra giant tortoise (water) | E. coli | NAL, TET | qnrS |
| AZ73-2 | Colombian rainbow boa (feces) | K. oxytoca | AMP, CEF, AMC, AZT | blaOXY-2 |
| AZ74-1 | Snowy owl (feces) | E. coli | TET, CIP, AMP, CEF, SXT | Class 1 (dfrA1-aadA1), qnrS, blaTEM-1 |
| AZ75-2 | Bengalese finches (feces) | P. mirabilis | NAL, TET | qnrB |
| AZ71-1 | Elongated tortoise (water) | E. cloacae | AMP, CEF, CTX, CRO, CAZ, CPD, IMP, AMC | blaSHV-36 |
| 12-6-2 | Amur leopard (water) | C. freundii | NAL, TET | qnrB |
| 21-11-1 | Red fox (feces) | E. coli | AMP, CEF | blaTEM-1, qnrS |
| 25-13-1 | Eurasian badger (feces) | Aeromonas spp. | AMP, NAL, CIP, NOR, FOX, CHL | aac(6′)-Ib-cr |
| 28-14-2 | Masked palm civet (feces) | E. coli | CPD, CTX, CRO, AMP, CEF, NAL, SXT, STR, CIP, TET | blaCTX-M-2 |
| 40-23-1 | Reticulated giraffe (feces) | E. coli | TET, STR, AMP, SXT | Class 1 (dfrA1-aadA1) |
| 49-28-1 | Marten (feces) | E. coli | STR, SXT | Class 1 (dfrA2-orf-aadA2) |
| 52-5-3 | Amur tiger (water) | E. coli | AMP, CEF | blaTEM-1 |
| 55-8-3 | Wild boar (feces) | E. coli | AMP, CEF | blaTEM-1 |
| 59-11-3 | Red fox (feces) | E. coli | AMP, CEF | blaTEM-1 |
| 60-12-3 | Racoon dog (feces) | E. coli | TET, STR, AMP, SXT | Class 1 (dfrA5) |
| 61-13-3 | Eurasian badger (feces) | E. coli | AMP, CEF | blaTEM-1 |
| 62-14-3 | Masked palm civet (feces) | E. coli | AMP, CEF | blaTEM-1 |
| 73-28-3 | Marten (feces) | E. coli | AMP, CEF | blaTEM-1 |
| 79-13-4 | Eurasian badger (feces) | E. cloacae | STR, AMP, SXT, NAL | Class 1(dfrA12-orf-aadA2) qnrS |
AMP, ampicillin; AMC, amoxicillin-clavulanic acid; CEF, cephalothin; FOX, cefoxitin; CTT, cefotetan; CFP, cefoperazone; CTX, cefotaxime; CAZ, ceftazidime; CPD, cefpodoxime; CRO, ceftriaxone; ATM, aztreonam; NAL, nalidixic acid; CIP, ciprofloxacin; NOR, norfloxacin; CHL, chloramphenicol; GEN, gentamicin; KAN, kanamycin; STR, streptomycin; TET, tetracycline; SXT, sulfamethoxazole-trimethoprim.
Resistance to β-lactam antibiotics in gram-negative bacteria is mediated primarily by β-lactamases (3, 23). The bacterial isolates were tested for TEM, SHV, CTX-M, OXA, and CMY β-lactamase-encoding genes by PCR using universal primers for the TEM, SHV, OXA, CTX-M and CMY families, as described previously (Table 1) (1, 33). Detection of the OXY β-lactamase-encoding gene in K. oxytoca was carried out as described previously (10). PCR and DNA sequencing screenings detected blaTEM-1, a narrow-spectrum β-lactamase gene which confers resistance against penicillins and narrow-spectrum cephalosporins, in 19 isolates (8.2%), which included 16 isolates of E. coli and 1 isolate of A. baumannii, P. mirabilis, and P. vulgaris (Table 2). All these isolates showed an ampicillin and cephalothin resistance phenotype (Table 2). TEM β-lactamase has been previously detected in E. coli isolated from wild animals in Portugal (7) and from free-living Canada geese in Georgia and North Carolina and black-headed gulls in the Czech Republic (6, 8). blaOXY-2, another narrow-spectrum β-lactamase, was identified in three strains of K. oxytoca. Interestingly, all three isolates are from reptiles (Japanese four-striped rat snake, Colombian rainbow boa, and giant salamander) (Table 2). blaOXY-2 is a K. oxytoca-linked β-lactamase that confers resistance to narrow-spectrum cephalosporins and, to a lesser extent, to broad-spectrum cephalosporins, such as cefoperazone, and to monobactams, such as aztreonam (9). To the best of our knowledge, this is the first report of the blaOXY gene from zoo animals.
Recently, there has been a dramatic increase in the incidence and prevalence of extended-spectrum β-lactamases (ESBLs) (3, 23). In this study, blaSHV-36, an ESBL-encoding gene, was identified in two isolates (0.9%), an E. coli isolate from birds and an E. cloacae isolate from a tortoise (Indotestudo elongata) (Table 2). blaSHV-36 was detected previously in a clinical isolate of Klebsiella spp. isolated from a fecal sample from a hospitalized patient in York, United Kingdom (19), while blaSHV-12 was identified previously from E. coli isolated from wild birds in Portugal (7). Furthermore, blaCTX-M-2, another ESBL-encoding gene, was identified in one E. coli isolate from the masked palm civet (Table 2). In Japan, blaCTX-M-2 was previously identified in ESBL-producing E. coli strains isolated from domestic animals (12, 29). It is worth noting that blaCTX-M-1 and blaCTX-M-14 have been previously isolated from wild animals in Portugal (7).
Furthermore, this study also identified a novel type of AmpC β-lactamase-encoding gene named blaCMY-26, according to the previously assigned numbers of blaCMY. blaCMY-26 was identified in a single isolate of K. oxytoca from a jaybird. This K. oxytoca strain showed a typical AmpC β-lactamase resistance phenotype, i.e., it was resistant to ampicillin, cephalothin, cefoxitin, cefotetan, ceftriaxone, and amoxicillin-clavulanic acid, in addition to other non-β-lactam antibiotics, such as streptomycin and kanamycin (Table 2). The putative CMY-26 enzyme showed 98% amino acid identity to CMY-13 (accession number AY339625) (18).
In 1998, Martínez-Martínez et al. discovered plasmid-mediated quinolone resistance in a K. pneumoniae clinical strain isolate from Alabama (16). The gene responsible for quinolone resistance, qnr, encodes a protein of the pentapeptide repeat family, which has been shown to block the action of ciprofloxacin on purified DNA gyrase and topoisomerase IV (30). To date, three main types of qnr genes, qnrA, qnrB, and qnrS, have been identified (20, 25). In this study, different primers were used for the screening of the qnr-related genes qnrA, qnrB, and qnrS, as described previously (Table 1) (27). A multiplex PCR screening detected qnr genes in 10 (4.3%) of the tested isolates and, interestingly, 4 of them were from reptiles (Table 2). DNA sequencing results for the 10 PCR amplicons showed that 6 were qnrB and 4 were qnrS. The six qnrB genes were identified for E. coli, K. pneumoniae, K. oxytoca, C. freundii, P. mirabilis, and P. fluorescens (Table 2). Note that qnrB was previously identified for E. coli from K. pneumoniae in the United States (27) and Korea (21) and from C. freundii in Palestine (accession no. AB281054). However, to the best of our knowledge, this is the first report of qnrB in K. oxytoca, P. mirabilis, and P. fluorescens and is also the first report of the incidence of qnrB in Japan. The four qnrS genes were identified from three isolates of E. coli and one isolate of E. cloacae (Table 2). qnrS has been reported previously from human clinical isolates of E. coli in France and Scandinavia (4, 24) and has also been detected in clinical isolates of E. cloacae from France and Taiwan (24, 32).
More recently, a new mechanism of plasmid-associated quinolone resistance, involving the ciprofloxacin-modifying aminoglycoside acetyltransferase gene, aac(6′)-Ib-cr, has been discovered (26). In this study, universal primers for detection of all types of aac(6′)-Ib, including its variants, were used as described previously (22). PCR and DNA sequencing results identified aac(6′)-Ib-cr, with the typical amino acid substitutions (Trp102Arg and Asp179Tyr) (26), in a single isolate of Aeromonas spp. (Table 2). The aac(6′)-Ib-cr gene has been identified previously from E. coli, K. pneumoniae, and Enterobacter sp. isolates in the United States (22). To our knowledge, this is the first report for this gene in Japan.
In summary, the results of the current study highlight zoo animals as a potential reservoir of antimicrobial-resistant bacteria and clinically important resistance genes.
Nucleotide sequence accession number.
The nucleotide sequence of the new AmpC β-lactamase gene, blaCMY-26, described in this study was deposited in GenBank under accession no. AB300358.
Acknowledgments
A.M.A. is supported by a postdoctoral fellowship from the Japan Society for the Promotion of Science. This work was supported by a Grant-in-Aid for Scientific Research to T.S. from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
Footnotes
Published ahead of print on 24 August 2007.
REFERENCES
- 1.Ahmed, A. M., K. Furuta, K. Shimomura, Y. Kasama, and T. Shimamoto. 2006. Genetic characterization of multidrug resistance in Shigella spp. from Japan. J. Med. Microbiol. 55:1685-1691. [DOI] [PubMed] [Google Scholar]
- 2.Bender, J. B., and S. A. Shulman. 2004. Reports of zoonotic disease outbreaks associated with animal exhibits and availability of recommendations for preventing zoonotic disease transmission from animals to people in such settings. J. Am. Vet. Med. Assoc. 224:1105-1109. [DOI] [PubMed] [Google Scholar]
- 3.Bradford, P. A. 2001. Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 14:933-951. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Cavaco, L. M., D. S. Hansen, A. Friis-Moller, F. M. Aarestrup, H. Hasman, and N. Frimodt-Moller. 2007. First detection of plasmid-mediated quinolone resistance (qnrA and qnrS) in Escherichia coli strains isolated from humans in Scandinavia. J. Antimicrob. Chemother. 59:804-805. [DOI] [PubMed] [Google Scholar]
- 5.Clinical and Laboratory Standards Institute. 2002. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Approved standard, 2nd ed. NCCLS document M31-A2. Clinical and Laboratory Standards Institute, Wayne, PA.
- 6.Cole, D., D. J. V. Drum, D. E. Stallknecht, D. G. White, M. D. Lee, S. Ayers, M. Sobsey, and J. J. Maurer. 2005. Free-living Canada geese and antimicrobial resistance. Emerg. Infect. Dis. 11:935-938. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Costa, D., P. Poeta, Y. Saenz, L. Vinue, B. Rojo-Bezares, A. Jouini, M. Zarazaga, J. Rodrigues, and C. Torres. 2006. Detection of Escherichia coli harbouring extended-spectrum β-lactamases of the CTX-M, TEM and SHV classes in faecal samples of wild animals in Portugal. J. Antimicrob. Chemother. 58:1311-1312. [DOI] [PubMed] [Google Scholar]
- 8.Dolejska, M., A. Cizek, and I. Literak. 2007. High prevalence of antimicrobial-resistant genes and integrons in Escherichia coli isolates from black-headed gulls in the Czech Republic. J. Appl. Microbiol. 103:11-19. [DOI] [PubMed] [Google Scholar]
- 9.Farzaneh, S., J. Peduzzi, L. Sofer, A. Reynaud, M. Barthelemy, and R. Labia. 1997. Characterization and amino acid sequence of the OXY-2 group for β-lactamase of pI 5.7 isolated from aztreonam-resistant Klebsiella oxytoca strain HB60. J. Antimicrob. Chemother. 40:789-795. [DOI] [PubMed] [Google Scholar]
- 10.Fevre, C., M. Jbel, V. Passet, F. X. Weill, P. A. Grimont, and S. Brisse. 2005. Six groups of the OXY β-lactamase evolved over millions of years in Klebsiella oxytoca. Antimicrob. Agents Chemother. 49:3453-3462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hansson, K., L. Sundström, A. Pelletier, and P. H. Roy. 2002. IntI2 integron integrase in Tn7. J. Bacteriol. 184:1712-1721. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kojima, A., Y. Ishii, K. Ishihara, H. Esaki, T. Asai, C. Oda, Y. Tamura, T. Takahashi, and K. Yamaguchi. 2005. Extended-spectrum-β-lactamase-producing Escherichia coli strains isolated from farm animals from 1999 to 2002: report from the Japanese Veterinary Antimicrobial Resistance Monitoring Program. Antimicrob. Agents Chemother. 49:3533-3537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kuiken, T., F. A. Leighton, R. A. Fouchier, J. W. LeDuc, J. S. Peiris, A. Schudel, K. Stohr, and A. D. Osterhaus. 2005. Public health: pathogen surveillance in animals. Science 309:1680-1681. [DOI] [PubMed] [Google Scholar]
- 14.Lévesque, C., L. Piché, C. Larose, and P. H. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185-191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Levy, S. B., and B. Marshall. 2004. Antibacterial resistance worldwide: causes, challenges and responses. Nat. Med. 10:S122-S129. [DOI] [PubMed] [Google Scholar]
- 16.Martínez-Martínez, L., A. Pascual, and G. A. Jacoby. 1998. Quinolone resistance from a transferable plasmid. Lancet 351:797-799. [DOI] [PubMed] [Google Scholar]
- 17.Mazel, D., B. Dychinco, V. A. Webb, and J. Davies. 2000. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob. Agents Chemother. 44:1568-1574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Miriagou, V., L. S. Tzouvelekis, L. Villa, E. Lebessi, A. C. Vatopoulos, A. Carattoli, and E. Tzelepi. 2004. CMY-13, a novel inducible cephalosporinase encoded by an Escherichia coli plasmid. Antimicrob. Agents Chemother. 48:3172-3174. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Munday, C. J., G. M. Whitehead, N. J. Todd, M. Campbell, and P. M. Hawkey. 2004. Predominance and genetic diversity of community- and hospital-acquired CTX-M extended-spectrum β-lactamases in York, UK. J. Antimicrob. Chemother. 54:628-633. [DOI] [PubMed] [Google Scholar]
- 20.Nordmann, P., and L. Poirel. 2005. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J. Antimicrob. Chemother. 56:463-469. [DOI] [PubMed] [Google Scholar]
- 21.Pai, H., M.-R. Seo, and T. Y. Choi. 2007. Association of QnrB determinants and production of extended-spectrum β-lactamases or plasmid-mediated AmpC β-lactamases in clinical isolates of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 51:366-368. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Park, C. H., A. Robicsek, G. A. Jacoby, D. Sahm, and D. C. Hooper. 2006. Prevalence in the United States of aac(6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother. 50:3953-3955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Paterson, D. L., and R. A. Bonomo. 2005. Extended-spectrum β-lactamases: a clinical update. Clin. Microbiol. Rev. 18:657-686. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Poirel, L., C. Leviandier, and P. Nordmann. 2006. Prevalence and genetic analysis of plasmid-mediated quinolone resistance determinants QnrA and QnrS in Enterobacteriaceae isolates from a French university hospital. Antimicrob. Agents Chemother. 50:3992-3997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Robicsek, A., G. A. Jacoby, and D. C. Hooper. 2006. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect. Dis. 6:629-640. [DOI] [PubMed] [Google Scholar]
- 26.Robicsek, A., J. Strahilevitz, G. A. Jacoby, M. Macielag, D. Abbanat, C. H. Park, K. Bush, and D. C. Hooper. 2006. Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 12:83-88. [DOI] [PubMed] [Google Scholar]
- 27.Robicsek, A., J. Strahilevitz, D. F. Sahm, G. A. Jacoby, and D. C. Hooper. 2006. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 50:2872-2874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Rowe-Magnus, D. A., A. M. Guerout, P. Ploncard, B. Dychinco, J. Davies, and D. Mazel. 2001. The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons. Proc. Natl. Acad. Sci. USA 98:652-657. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Shiraki, Y., N. Shibata, Y. Doi, and Y. Arakawa. 2004. Escherichia coli producing CTX-M-2 β-lactamase in cattle, Japan. Emerg. Infect. Dis. 10:69-75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Tran, J. H., and G. A. Jacoby. 2002. Mechanism of plasmid-mediated quinolone resistance. Proc. Natl. Acad. Sci. USA 99:5638-5642. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.White, P. A., C. J. McIver, and W. D. Rawlinson. 2001. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob. Agents Chemother. 45:2658-2661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wu, J.-J., W.-C. Ko, S.-H. Tsai, and J.-J. Yan. 2007. Prevalence of plasmid-mediated quinolone resistance determinants QnrA, QnrB, and QnrS among clinical isolates of Enterobacter cloacae in a Taiwanese hospital. Antimicrob. Agents Chemother. 51:1223-1227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhao, S., S. Qaiyumi, S. Friedman, R. Singh, S. L. Foley, D. G. White, P. F. McDermott, T. Donkar, C. Bolin, S. Munro, E. J. Baron, and R. D. Walker. 2003. Characterization of Salmonella enterica serotype Newport isolated from humans and food animals. J. Clin. Microbiol. 41:5366-5371. [DOI] [PMC free article] [PubMed] [Google Scholar]