Skip to main content
BMC Evolutionary Biology logoLink to BMC Evolutionary Biology
. 2007 Nov 22;7:233. doi: 10.1186/1471-2148-7-233

Glacial vicariance in Eurasia: mitochondrial DNA evidence from Scots pine for a complex heritage involving genetically distinct refugia at mid-northern latitudes and in Asia Minor

Krassimir Naydenov 1,✉, Sauphie Senneville 2, Jean Beaulieu 2,3, Francine Tremblay 1, Jean Bousquet 2
PMCID: PMC2222255  PMID: 18034901

Abstract

Background

At the last glacial maximum, Fennoscandia was covered by an ice sheet while the tundra occupied most of the rest of northern Eurasia. More or less disjunct refugial populations of plants were dispersed in southern Europe, often trapped between mountain ranges and seas. Genetic and paleobotanical evidences indicate that these populations have contributed much to Holocene recolonization of more northern latitudes. Less supportive evidence has been found for the existence of glacial populations located closer to the ice margin. Scots pine (Pinus sylvestris L.) is a nordic conifer with a wide natural range covering much of Eurasia. Fractures in its extant genetic structure might be indicative of glacial vicariance and how different refugia contributed to the current distribution at the continental level. The population structure of Scots pine was investigated on much of its Eurasian natural range using maternally inherited mitochondrial DNA polymorphisms.

Results

A novel polymorphic region of the Scots pine mitochondrial genome has been identified, the intron 1 of nad7, with three variants caused by insertions-deletions. From 986 trees distributed among 54 populations, four distinct multi-locus mitochondrial haplotypes (mitotypes) were detected based on the three nad7 intron 1 haplotypes and two previously reported size variants for nad1 intron B/C. Population differentiation was high (GST = 0.657) and the distribution of the mitotypes was geographically highly structured, suggesting at least four genetically distinct ancestral lineages. A cosmopolitan lineage was widely distributed in much of Europe throughout eastern Asia. A previously reported lineage limited to the Iberian Peninsula was confirmed. A new geographically restricted lineage was found confined to Asia Minor. A new lineage was restricted to more northern latitudes in northeastern Europe and the Baltic region.

Conclusion

The contribution of the various ancestral lineages to the current distribution of Scots pine was asymmetric and extant endemism reflected the presence of large geographic barriers to migration. The results suggest a complex biogeographical history with glacial refugia shared with temperate plant species in southern European Peninsulas and Asia Minor, and a genetically distinct glacial population located more North. These results confirm recent observations for cold tolerant species about the possible existence of refugial populations at mid-northern latitudes contributing significantly to the recolonization of northern Europe. Thus, Eurasian populations of nordic plant species might not be as genetically homogenous as assumed by simply considering them as offsets of glacial populations located in southern peninsulas. As such, they might have evolved distinctive genetic adaptations during glacial vicariance, worth evaluating and considering for conservation.

Background

The cold periods of the Pleistocene have had a dramatic impact on most organisms in temperate regions. Whereas the Artic ice sheet began to grow about 2.5 Myr ago, more severe climatic oscillations occurred mainly during the last 700 000 year [1] with the consequence that the European biota has experienced repeatedly some drastic climate changes. Tree species responded through migration to regions where environmental conditions allowed them to survive [2,3]. Phylogeography investigates on the spatio-temporal dynamics of populations. It relies on inference from two main sources of information, i) macrofossils and pollen in sediment profiles, ii) population structure in DNA markers ideally inferred at the sequence level. Cytoplasmic markers, which are uniparently inherited in most plant species, are especially well suited for phylogeographic studies. They helped infer the number of genetically distinct ancestral lineages, their location during the last glacial maximum, and the postglacial migration routes for several tree and plant species in Europe [e.g. [4-11]]. These studies and others based on fossil evidence suggested that most plant and tree refuges were located in southern European peninsulas and the Balkans [12-15]. Glacial refugia and recolonization routes were found to coincide often for a number of plant and animal species [[3,16] and [17]]. In North America, common patterns are also starting to emerge and much knowledge has been rapidly gained from the analysis of species with wide distributions [e.g. [18-20]]. However, there is now increasing evidence that some European species were established much further north and east than previously assumed during glacial time [21-25]. Similar inferences have also been made in North America, where genetic and palynological evidence is accumulating for the presence of glacial populations much closer to the ice fronts as once thought [e.g. [26-29]]. Phylogeographic studies in Europe also indicate asymmetric contributions of glacial refugia to Holocene colonization: some ancestral lineages remained endemic, because of geographic barriers limiting migration, while others contributed considerably to the postglacial colonization of more northern latitudes [[3,6,8] and [30]].

Scots pine (Pinus sylvestris L., subgenus Diploxylon) is a long-lived evergreen monoecious forest tree species growing in a large variety of ecological conditions from western Europe to Asia. Of all pine species, it has the largest distribution [31,32]. Its natural range extends northwards from Spain to northern Fennoscandia, and westwards from longitudes 5°W in Spain and Scotland to 135°E in Siberia. While most of its natural range is contiguous, there are also large populations of Scots pine disconnected from the main natural range such as in Scotland, Spain, France, Turkey, and former Yugoslavia. Extensive variations in phenotypic traits as well as geographic races and types have been reported [33-37]. Much of this variation has been usually attributed to adaptation to edaphic and climatic factors [35,38]. Studies carried out over the last 30 years using isozymes, terpenes and flavonoid markers have also revealed the existence of distinct evolutionary units in Scots pine, which might be indicative of isolation in different glacial refugia. Although these studies were not entirely congruent and not aimed at deciphering effects related to glacial and postglacial history, they helped define biogeographical hypotheses for the western and northwestern European range of Scots pine [39-45]. Because of the regional scope of many of these studies and the different phenotypic or genetic attributes used, much biogeographical knowledge on the glacial and postglacial history of Eurasia remains to be gained from analysing the broad geographic distribution of Scots pine and by using homologous gene markers with stronger historical imprints.

In the Pinaceae, mtDNA is maternally inherited and dispersed through seeds only [46,47]. This mode of dispersion helps avoid the problems with inferring history from present-day distributions of nuclear or cpDNA markers because the latter are dispersed by both seeds and pollen in the Pinaceae, which produce a more rapid breakdown of the historical genetic signatures induced by glacial vicariance. However, one of the major difficulties one faces with plant mtDNA is the low level of variation in their exons and introns [48,49], which limits the detection of variation between and within species at the sequence level [e.g. [47,50]]. An indel has been discovered in the intron B/C of the mitochondrial gene nad1 in Scots pine, which allowed identifying a genetically distinct ancestral lineage in the Iberian Peninsula [6]. Restriction fragment length polymorphisms (RFLP) of a region encompassing the mitochondrial gene cox1 have also been found in populations of Scots pine from western Europe [5,51], which helped identifying two genetically distinct groups of populations each distributed on a large latitudinal range. The possibility for a refuge at northern latitudes was suggested in a previous study [5]. Given the little diversity observed in the mtDNA regions surveyed and the population sampling limited mostly to western Europe, it is likely that the pan-Eurasian Scots pine possesses more genetically distinct ancestral lineages. Such evidence would contribute towards a more complete understanding of the historical factors and processes leading to the current distribution of species genetic diversity throughout Eurasia.

In an effort to discern from a phylogeographic perspective the possible existence and contribution of mid-northern refugia to the glacial and postglacial history of Eurasian biota, we investigated the extant genetic structure of Scots pine with a set of populations covering much of the natural range in Europe and also in Asia. We also report on a novel polymorphic mtDNA region in Scots pine, the intron 1 of the gene nad7, which is indicative of unknown genetically distinct maternal lineages. The location of one of these lineages in northern Europe supports the view that Quaternary refugia located outside European peninsulas at mid-northern latitudes might have played a significant role in the Holocene recolonization of Europe [22].

Results

mtDNA polymorphisms and population differentiation

Out of 15 mtDNA regions surveyed (Table 1), intraspecific polymorphism was detected for only two loci in Scots pine. Polymorphism was detected de novo for the intron 1 of nad7 with three length variants. They were 1175, 1170 and 1143 bp long and are hereafter called haplotypes A, B, and C, respectively. The size differences were caused by two single indels: one of 32 bp exclusive to haplotype C and one of 5 bp exclusive to haplotype B (Table 2). As previously reported from a more limited sampling [6], two size variants were detected for the intron B/C of nad1 among the 986 samples analysed herein. These fragments differed by a 31 bp indel and are hereafter called haplotypes A (217 bp) and B (248 bp). A third variant restricted to Italy was recently reported for this gene [30]. It was not detected in our sampled trees which were all from outside the Italian Peninsula. Primers for these two mtDNA regions were also tested on 100 to 500 individuals for each of five other pines of the subgenus Diploxylon (P. resinosa, P. mugo, P nigra, P. heldreichii, and P. contorta) and positive amplifications were obtained (data not shown). The first four species belong to the section Pinus, but the first three are members of subsection Pinus (as for Scots pine) and Pinus heldreichii is member of subsection Pinaster. As for P. contorta, it belongs to section Trifoliae, subsection Contortae. Fragment length polymorphism was detected for both nad1 intron B/C and nad7 intron 1 in P. heldreichii. For P. nigra, only nad1 intron B/C showed polymorphism. No polymorphism was detected in P. mugo and P. resinosa. For P. contorta, polymorphism was only observed for nad7 intron 1 involving the same minisatellite-like marker as previously reported for this species and the closely related P. banksiana [20].

Table 1.

Mitochondrial regions tested1.

Genomic region Annealing temperature (°C) PCR product size (bp) Restriction enzymes tested Primer source
matR (intron1) 58 550 Sau3AI, RsaI, HindIII, MseI, TaqI, BstUI [47]
mh05 59 1500 4 - [91]
mh09 62 180 - [91]
mh09' 62 900 4 - [91]
mh33 55 900 4 - [91]
mh35 59 Not amplified - [91]
mh44 59 Not amplified - [91]
nad1 intron B/C, primers H/I 2 55 217–248 - [6]
nad3 intron 1 58 120 - [92]
nad3-rps12 (i.r.) 3 58 360 - [92]
nad5 intron 1 55 1100 Sau3AI, RsaI, HindIII, MseI, TaqI, BstUI, [47]
nad5 intron 4 59 900 Sau3AI, RsaI, HindIII, MseI, TaqI, BstUI, Tru9I [93]
nad7 intron 1 61 1200 Sau3AI, RsaI, HindIII, TaqI, BstUI, Tru9I [47]
SSU rRNA region V1 62 400 - [94]
SSU rRNA region V7 50 250 - [94]

1Targeted regions, annealing temperatures, expected size of PCR products and restriction enzymes tested for primer pairs used to amplify 15 mtDNA regions of Scots pine.

2nad1 intronB/C have been amplified (following Demesure et al [95] protocol) and tested with different restriction enzymes, only internal primers H and I of Soranzo et al [6] have shown polymorphism.

3Intergenic region.

4Multiple fragments.

Table 2.

Mitochondrial DNA sequence polymorphisms detected in Scots pine1.

Mitotype nad7 intron 1 (positions 621–681) nad1 intron B/C (positions 101–137)
AA GGGATGCGTAAGCAGGCTCGACTGTTAAGGAGAGGGGCAAATAAGTAAAAAAAAGGGCCTG GGA-------------------------------GAG
BA GGGATGCGTAAGCAGGCTCGACTGTTAAGGAGAGGGGCAAATAAGTAAAAAAA-----CTG GGA-------------------------------GAG
CA GGG--------------------------------GGCAAATAAGTAAAAAAAAGGGCCTG GGA-------------------------------GAG
AB GGGATGCGTAAGCAGGCTCGACTGTTAAGGAGAGGGGCAAATAAGTAAAAAAAAGGGCCTG GGACCCTTTAGGGGGCTCGACCATAGGGAGAGGAGAG

1Polymorphisms detected in the intron 1 of the mitochondrial gene nad7 and in the intron B/C of the mitochondrial gene nad1 in Scots pine, and nomenclature used for multi-locus haplotypes (mitotypes).

For Scots pine, the nomenclature used for mitochondrial multi-locus haplotypes (mitotypes) followed a two-letter code after the haplotypes observed for nad7 intron 1 (A, B, C) and nad1 intron B/C (A, B), respectively (Table 2). Among the four observed mitotypes, the most abundant one was AA (72.3 %), followed by BA (17.3 %), CA (5.8 %), and AB (4.6 %) (Table 3). The minimum spanning tree indicates that the mitotypes were more or less arranged as a star phylogeny with little sequence variation among them and no recombination (Figure 1B). The observed number of mitotypes per population (nh) was 1 or 2 without exception, with an average of 1.50 (Table 3). The mitotype diversity index per population (H) was low to moderate (average of 0.141) and ranged from 0 to 0.500 (Table 3). Population differentiation was high among the 54 populations, with GST and NST values of 0.657 and 0.685, respectively (Table 4). When excluding the six more diverse populations from a presumed zone of contact in central and northeastern Europe between two distinct mtDNA lineages (see below), the GST and NST values increased to 0.746 and 0.767, respectively, among the remaining populations. However, the presence of a formal phylogeographic structure was not supported, as NST was not significantly higher than GST. Lack of test power is likely the reason, given the small genetic divergence observed among the four mtDNA variants detected.

Table 3.

Multi-locus haplotype frequencies and genetic diversity estimates in 54 natural populations of Scots pine.

Population State1 Latitude (N) Longitude2 (E/w) Altitude (m) Sample size Mitotype counts3 nh4 H5


Nb Name AA AB BA CA
1 Bansko BG 41°48' 23°30' 1400 16 16 - - - 1 0
2 Borovo BG 41°30' 23°55' 1500 18 18 - - - 1 0
3 Chehliovo BG 41°53' 23°55' 1600 20 19 - - - 2 0.095
4 Chiroka Laka BG 41°41' 24°35' n.a. 20 20 - - - 1 0
5 Dospat BG 41°40' 24°30' 1550 10 9 1 - - 2 0.180
6 Laki BG 41°51' 24°50' 1400 20 18 2 - - 2 0.180
7 Nevestino BG 42°06' 22°42' 1850 20 20 - - - 1 0
8 Pechtera BG 42°03' 24°22' 1400 20 19 1 - - 2 0.095
9 Simitli BG 41°53' 23°10' n.a. 20 20 - - - 1 0
10 Smolian BG 41°30' 25°20' 1400 20 18 2 - - 2 0.180
11 Velingrad BG 42°05' 24°00' n.a. 20 20 - - - 1 0
12 Grosser Priel AT 47°42' 14°17' 620 20 18 - 2 - 2 0.180
13 Merkenstein AT 48°59' 16°08' 550 19 19 .- - - 1 0
14 Ilgaz Gakdake TR 41°02' 33°47' 1500 18 - - - 18 1 0
15 Eskipazan TR 40°53' 32°20' 1550 20 - - - 20 1 0
16 Ulupihar TR 40°53' 35°20' 1450 20 1 - - 19 2 0.095
17 Zelenoborsk RU 67°10' 32°21' n.a. 17 4 - 13 - 2 0.360
18 Sosnovec RU 64°30' 34°45' n.a. 20 3 - 17 - 2 0.255
19 Sucoozero RU 63°00' 32°21' n.a. 20 3 - 17 - 2 0.255
20 Shala RU 61°47' 36°00' n.a. 19 17 - 2 - 2 0.188
21 Sortovala RU 61°42' 30°41' n.a. 15 7 - 8 - 2 0.498
22 Cugir seed orchard RO 45°52' 23°23' 230 14 14 - - - 1 0
23 Kurim Tisnov CZ 49°30°' 16°30' 400 12 7 - 5 - 2 0.486
24 Luzna Olesna CZ 50°10' 13°70' 390 11 11 - - - 1 0
25 Murat FR 45°06' 2°15' n.a. 9 9 - - - 1 0
26 Balnagowan Wood UK 57°16' 3°09' 240 14 14 - - - 1 0
27 Morayshire UK 57°33' 3°29' n.a. 20 20 - - - 1 0
28 Hallestad District SE 58°46' 15°35' 85 13 11 - 2 - 2 0.260
29 Rumsulla District SE 57°41' 15°35' 150 20 15 - 5 2 0.375
30 Kiuruvesi FI 63°40' 26°40' n.a. 19 1 - 18 - 2 0.100
31 Vehkalahti FI 60°35' 27°20' n.a. 20 1 - 19 - 2 0.095
32 Voronezh RU 50°30' 40°00' n.a. 19 13 - 6 - 2 0.432
33 Orlovsk RU 52°30' 37°00' n.a. 20 15 - 5 - 2 0.375
34 Kaunas LT 54°45' 24°05' 100 20 20 - - - 1 0
35 Riga LV 56°53' 24°08' n.a. 20 11 - 9 - 2 0.495
36 Krasnoyarsk RU 60°00' 90°00' n.a. 20 20 - - - 1 0
37 Spirinsk RU 54°00' 81°00' n.a. 20 20 - - - 1 0
38 Vilnius LT 54°38' 25°28' 100 20 10 - 10 - 2 0.500
39 Krasnoe RU 54°00' 86°20' n.a. 20 20 - - - 1 0
40 Rokiskis LT 55°48' 25°33' 120 20 8 - 12 - 2 0.480
41 Kaluzhkaya Ob. RU 54°00' 35°00' n.a. 20 12 - 8 - 2 0.480
42 Tatarskaya Ob. RU 55°00' 50°00' n.a. 20 19 - 1 - 2 0.095
43 Dainava LT 53°55' 23°40' 80 20 12 - 8 - 2 0.480
44 Novosibirsk RU 55°05' 82°45' 200 20 16 - 4 - 2 0.320
45 Kievskaya Ob. UA 50°00' 30°00' n.a. 20 20 - - - 1 0
46 Groenendaal BY 50°50' 42°10' n.a. 18 18 - - - 1 0
47 Baiyinna-Heilongjiang CN 52°21' 125°40' n.a. 17 17 - - - 1 0
48 Jilin Prov. CN 43°00' 126°00' n.a. 17 17 - - - 1 0
49 Sung-Hua-Chiang CN 46°00' 127°00' 700 17 17 - - - 1 0
50 Heilongjiang Prov. CN 47°00' 127°00' n.a. 20 20 - - - 1 0
51 Sierras Penibeticas ES 37°20' 2°50'w 2000 18 18 - - - 1 0
52 Montes Universales ES 40°20' 1°50'w 1700 19 - 19 - - 1 0
53 Guadarrama ES 40°45' 4°05'w 1900 19 18 1 - - 2 0.100
54 Alto Tago ES 40°44' 2°10'w 1500 18 - 18 - - 1 0
Total 986 713 45 171 57 - -
Average 18.3 - - - - 1.50 0.141

1AT, Austria; BG, Bulgaria; BY, Belarus; CN, China; CZ, Czech Republic; ES, Spain; FI, Finland; FR, France; LT, Lithuania; LV, Latvia; RO, Romania; RU, Russian Federation; SE, Sweden; TR, Turkey; UA, Ukraine; UK, United Kingdom.

2The "w" indicates the longitude west of Greenwich meridian.

3The first letter of multi-locus haplotype (mitotype) refers to the haplotype observed at locus nad7 intron1 and the second letter refers to the haplotype observed at locus nad1 intron B/C following nomenclature in Table 2.

4Number of distinct mitotypes per population.

5Mitotype diversity.

Figure 1.

Figure 1

Geographic distribution of multi-locus mtDNA haplotypes (mitotypes) in Scots pine natural populations from Europe and Asia. (A) Gray color represents the natural range of Scots pine. The colours corresponding to the mitotypes are defined in plate B. Note a large mixed zone involving the ancestral lineages AA and BA over northeastern Europe. (B) Haplotype network of the four mitotypes identified in this study. Each link represents one indel. The size of circles is proportional to the relative frequency of mitotypes (for exact frequencies, see Table 3).

Table 4.

Genetic diversity parameters and population differentiation estimates1.

Group Populations Region (Country) N2 hh3 A4 H5 GST6 NST7 FCT8
I 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53 Most populations from Europe and Asia 795 3 1.48 0.147 0.262 0.270 0.785
II 17, 18, 19, 30, 31 Karelia and NE Scandinavia (Russia/Finland) 96 2 2.0 0.213 0.001 0.001
III 14, 15, 16 Middle East (Turkey) 58 2 1.33 0.032 0 0
IV 52, 54 Iberian Peninsula (Spain) 37 1 1.0 0 n.a. n.a.
Total 986 4 1.50 0.141 0.657 0.685

1Estimates for groups of populations of Scots pine delineated by SAMOVA and maximizing geographic structure.

2Sample size.

3Number of distinct multi-locus haplotypes (mitotypes) observed in each group.

4Average number of mitotypes per population in each group.

5Average mitotype diversity per population in each group.

6Differentiation among populations in each group.

7Fixation index using PERMUT software [88].

8Differentiation among the four groups.

Geographic structure

The geographic distribution of mitotypes appeared to be essentially non-random, with clusters of mitotypes geographically quite well delineated (Figure 1A, see also SAMOVA test below). The Mediterranean region showed the highest diversity with three of the four mitotypes revealed in the study. The cosmopolitan haplotype AA was largely distributed and found in most of the populations sampled. Geographic structuring was evident for other mitotypes. Mitotype CA was present only in Asia Minor, in the Pontide Mountains of Turkey (populations #14 to #16). Mitotype AB was found fixed in some high mountain populations of the Iberian Peninsula (Iberian cordillera – Zaragoza/Valencia provinces) (#52 and #54) and was observed as a rare variant in some populations of the Balkans (#3, #5, #6, #8 and #10). The distribution of mitotype BA was quite unexpected: it was largely distributed in the lowland region of middle to northern latitudes in eastern Europe. It was prevalent in the Baltic region and quite frequent in Russia, west of the Ural Mountains. But it was also detected in Siberia (population #44). A large zone composed of populations with variable mixed genetic background (mitotypes AA and BA) was observed in central and northeastern Europe. It includes most if not all populations bearing mitotype BA. The zone extends from the southeast of Russia to the Baltic States (see populations #32, #33, #35, #38, #40, #41, and #43). The within-population mitotype diversity of these populations (H = 0.463) was much higher than elsewhere.

SAMOVA was conducted repeatedly by increasing the value of the number of population groups (K) until the FCT value reached a maximum of 0.785, which was obtained for K = 4 (Table 4). For K = 3, a maximum FCT value of 0.720 was obtained. The four groups confirmed trends from visual inspection and corresponded to: (I) the majority of populations from Europe and Asia, (II) northeastern Europe, (III) Asia Minor and (IV) the high mountains of the Iberian Peninsula. Group I was the most widespread geographically, including 44 populations (Table 4). It contained mostly the cosmopolitan mitotype AA and, at a lower frequency, mitotype BA and AB. Differentiation among the populations of the group was moderate. Population differentiation within each of the three other groups (II, III, and IV) was smaller. Group II from northeastern Europe was largely dominated by mitotype BA. The two remaining groups III and IV were highly homogenous. Group III regrouped populations from Turkey fixed or nearly fixed for mitotype CA, and group IV regrouped populations from the Iberian Peninsula fixed for mitotype AB.

Discussion

mtDNA diversity and population differentiation

DNA sequence variation is low in the mtDNA of conifers [e.g. [47,50]]. Accordingly, little intraspecific variation has been found in the mtDNA of P. sylvestris in western Europe, including four RFLP variants for the cox1 region [5] and three size variants at the locus nad1 intron B/C, of which two were found endemic to the Iberian and Italian Peninsulas [6,30]. The three new size variants reported herein for the locus nad7 intron 1 indicate new region-specific variants for northeastern Europe and Asia Minor. No other length polymorphisms or substitutions were detected in Scots pine in spite of the screening of 15 distinct mtDNA regions. Highly informative minisatellite-like motifs such as those rarely detected in some spruce [52,53] and pine taxa [20] could not be detected in Scots pine.

The overall level of population differentiation estimated in this study from mitotype variation at the nad1 intron B/C and nad7 intron 1 loci was rather high and similar to that reported in earlier studies restricted to Scots pine populations from western Europe based on RFLPs of the cox1 region (GST = 0.83; [5]) or indels of the nad1 intron B/C (GST = 0.60; [6]). Such estimates are in line with averages reported for maternally inherited markers for a number of conifer and angiosperm taxa [54]. The amount of population differentiation determined by nuclear markers such as isozymes was generally much smaller in Scots pine with GST values ranging between 0.025 and 0.076 [43,55-61]]. However, these studies were carried out mostly at the regional level. Among-population differentiation was also much higher for mtDNA markers than for paternally inherited cpDNA markers in a Scots pine study covering much of the species range (GST = 0.11; [62]), as usually observed in other conifers [e.g. [54,63]].

Geographic structure

The present study confirms the existence of a genetically distinct set of populations in the high mountains of the Iberian Peninsula [5,6] while variants discovered in the intron 1 of nad7 signal distinctive evolution in Asia Minor and northeastern Europe. Haplotype B at locus nad1 intron B/C was observed mostly in the Iberian Peninsula in some high elevation populations of the Zaragoza/Valencia regions where it was fixed or nearly fixed. It was observed only sparingly west of Catalonia. Such a distribution indicates that these Catalan populations have been isolated during glaciations and have not contributed to the recolonization of Europe [[5,6] and [30]]. A distinct dynamics of Catalan populations from the rest of the Iberian Peninsula has also been reported for other species like Aleppo pine [64], Maritime pine [9,65], and white oaks [8]. In the present study, haplotype B of nad1 intron B/C has also been discovered, albeit at low frequency, in five other populations located in Bulgaria, in the Balkan Peninsula, thus far away from the center of prevalence for this haplotype in the Iberian Peninsula. Long-distance seed dispersal could be invoked but is unlikely over such long distances, given the heterogenous topography and relative isolation of Iberia. The probability of such long-distance movements would be higher in the northern and more eastern parts of Scots pine natural range, given the lack of major physical barriers. Another perhaps more plausible explanation for the rare presence of haplotype B of nad1 intron B/C in some Balkan populations could be that it is ancient and was present in more than one southern ice refugia. Its high or low frequency, depending on the region considered, could be attributable to stochastic variation, especially if southern refugia populations suffered from severe bottlenecks. The weak occurrence of this haplotype in the Balkans might also result from human activity, as previously suggested for the rare presence of this variant in Poland [6]. Whereas the hypothesis of seed source transfer cannot be totally ruled out, it is difficult to sustain because of (i) the lack of hard evidence for such seed source transfer between the Balkans and the Iberian Peninsula in the past; (ii) natural stands in which seeds were collected existed long before forest management activities began in Europe; and (iii) the relative conservatism of forest seed transfer guidelines in the Balkan region [66]. A third explanation could relate to ancient mtDNA capture from hybridizing species in the region [67,68]. Accordingly, phylogeographical studies of other pine species in the region using the same gene locus might help clarify the issue.

The detection and high prevalence of haplotype C of nad7 intron 1 in Asia Minor populations only is a strong signal for the presence of a genetically distinct glacial population. This relictual population would have experienced severe bottlenecks, because populations were all fixed for this haplotype except for one tree harbouring the cosmopolitan haplotype A. After glaciation, it would have remained isolated, eastward by the Caucasus Mountains, northward by the Black Sea, and westward by the Bosphorus passage. The cold and arid climate in this region during the Holocene might have also impeded the expansion of this population [69], but not its survival as Scots pine can survive under very harsh conditions [70].

The high prevalence of haplotype B of nad7 intron 1 in northeastern Europe suggests the presence of a genetically distinct glacial population at more northern latitudes than previously thought, an idea that had already been suggested for Scots pine [5]. A recent mutation during the Holocene giving rise to haplotype B of nad7 intron 1 is unlikely, given the widespread distribution of this haplotype. As well, homoplasy is unlikely, given the low rate of variation of angiosperm and conifer mitochondrial introns [47,49]. A large number of populations had mixed composition of both haplotypes A and B of nad7 intron 1 in central and northeastern Europe. Their diversity index was highest among all populations surveyed, which could result for the meeting of two genetically distinct glacial lineages (A and B), or indicates that the glacial population harboring haplotype B had mixed genetic composition. The uneven distribution of haplotype B of nad7 intron 1 among these populations, with a higher prevalence of haplotype B as one moves northward, could result from successive founder events during colonization [71], as recently proposed for European hedgehogs [72]. This is likely, given than that migration from more southern latitudes was necessary to colonize these previously glaciated areas.

Implications for glacial and postglacial history of European vegetation

There is some evidence from fossil and palynological data that cold adapted tree species occupied mid-altitude sites in the mountains of southern Europe during the last glacial stage [13]. Moreover, the southern peninsulas of Iberia, Italy, the Balkans, and Greece, which are separated from the rest of Europe by major mountain ranges such as the Pyrenees, Alps and Caucasus, were identified as major glacial refugia for many species [[14,30] and [65]]. Our genetic data indicates that a genetically distinct glacial refuge existed in Asia Minor as well. Tree pollen, including that of the genus Pinus, was recorded in the Balkans about 14 000 years BP [13] while it was barely present as late as 10 500 years BP in southwestern Turkey where the climate was cold and dry with steppe vegetation [69]. Pine pollen attained its maximum only in early Holocene in western Anatolia and in mid-Holocene in more eastern areas, likely because of similar climatic limitations [73,74]. Thus, it is apparent that tree populations would have been scarce in the region at LGM, 21 Kyr ago. The refuge is also unlikely to have contributed much to the postglacial colonization of Europe, given the genetic discontinuity detected in Scots pine. The peculiar location of Turkey between the Black and Mediterranean seas would have promoted isolation from more northern areas. It is likely that other elements of the steppe vegetation in the region also represent relicts from the pre-Holocene era and suffered similar effects during glacial periods, as shown recently for field mouse [75]. As such, it is expected that they would show a distinct genetic background, as that detected in Scots pine.

The exact location and size of the Scots pine glacial population giving rise to the large spread of haplotype B of nad7 intron 1 in eastern or northeastern Europe remain unknown. Based on fossil data, Scots pine glacial populations existed in the Balkans and possibly even in central Europe [Litynska-Zajac M. cited by Stewart and Lister [22,23]]. The large spread of haplotype A of nad7 intron 1 throughout Europe is likely the consequence of an expansion from glacial populations from that region [30]. Such spread northwestwards towards Germany and France and northeastwards throughout Eastern Europe and Siberia correlates geographic dispersion patterns and colonization routes inferred for a grasshopper [76], for European beech [77], for the oaks [4], and for Norway spruce [52,78]. However, some of these colonization routes are still open to alternative interpretation. Furthermore, such observations do not correlate well with the exceptionally northern location of haplotype B of nad7 intron 1.

The peculiar northern distribution of haplotype B of nad7 intron 1 indicates that Scots pine has likely survived in a refuge distinct from those usually recognized in the southern peninsulas of Europe, perhaps under the form of scattered glacial populations spread over sizeable latitudinal areas reaching European mid-latitudes not far from the ice front. Scots pine is known to survive and grow reasonably well upon permafrost [72]. Evidence is also accumulating regarding the existence of glacial populations located at more northern latitudes [e.g. [25,28] and [29]] and their significant contribution to Holocene colonization [22,25]. In addition, if the mixed zone observed in north-central and northeastern Europe between the cosmopolitan AA mitotype and the northern BA mitotype represents truly a zone of secondary contact, the northern location and shape of this zone would not correspond well to the meeting of two ancestral lineages both located in or near southern European peninsulas. While the existence of such zones with typically higher genetic diversity has been reported for other tree species in Europe [[3,4] and [16]] as well as in North America [19,20] where ancestral lineages from southern latitudes would converge at more northern latitudes, this possible zone of contact would more likely correspond to the junction between a lineage moving northwards from the Balkans or from even more east (the AA lineage), and a lineage of more northern or northeastern origin (the BA lineage). In one rare occurrence of similar observation, Taberlet et al [3] recognized a contact zone of migration fronts as far north as in Scandinavia for Picea abies. They proposed that the area was presumably colonized from the south and from the northeast by populations originating from different refugia.

While the current areas of maximum abundance of haplotype B of nad7 intron1, Finland and northwestern Russia, were completely glaciated at LGM [79], it is likely that trees colonizing the region would have migrated northward from a region anywhere west of the Ural Mountains. There are indications from general circulation models that the climate during the last glacial maximum was warm enough to allow Scots pine to survive well as far north as above 50°N in isolated regions of northern Ukraine and southwestern Russia, for instance [30]. A location more south is also possible if founder events after long-distance dispersal are hypothetized, followed by drift and lineage sorting to account for the high abundance of haplotype B of nad7 intron 1 as one moves into Finland and northwestern Russia. However, this hypothesis becomes unlikely for long-distance dispersal from refuges located in the southern European peninsulas, given the absence of haplotype B of nad7 intron 1 in southern populations of Scots pine.

More mtDNA polymorphisms will need to be discovered in order to distinguish Scots pine disjunct populations from eastern Europe and Asia and investigate if significant glacial vicariance factors existed in this vast region. Siberian populations where the cosmopolitan mitotype AA was dominant might have been established from a glacial population located in southwestern Siberia, in the upper Irtysh River Valley [80-82], or from a more southern location. As for Scots pine populations located in the far-east in China where the cosmopolitan mitotype AA was found fixed, it is not clear if it is derived from a more western refuge located in southwestern Siberia (see above) or if a refuge existed in northeastern China. Palynological evidence suggests that pine was present at several locations in the region during the last glaciation, but it is unclear if the fossil pollen was representative of Scots pine as many pine species are endemic to the region [82].

Conclusion

The present study suggests a more complex biogeographical history than previously thought for Scots pine and presumably, for its associated plant congeners. The study is congruent with others [[3,15,17] and [21]] about the asymetry of glacial refugia in contributing to the postglacial recolonization of Eurasia. This trend is best exemplified by the prevalent nad7 intron 1 haplotype found specific to the relictual population from Turkey and from nowhere else in Eurasia. It indicates that Asia Minor is likely to represent a prime area of endemism supporting genetically distinct lineages unlikely to be found in the rest of Eurasia. Such a trend highlights the geography of the region as an important vicariance factor limiting migration and gene flow. Similarly as for other areas of endemism in Europe (e.g. Iberian and Italian Peninsulas), seed source movements from the rest of Eurasia to Asia Minor should be restricted. Reserves could be considered to ensure in situ preservation of relictual genetic diversity and structure, which need to be further documented at the level of the chloroplast and nuclear genomes as well as for other plant and animal species.

The discovery of a genetically distinct North-European lineage suggests that some glacial populations may have survived isolated from refugia in South European peninsulas at more mid- northern latitudes. Given the colonization time lag for southern populations to reach northern latitudes due to distance, topographic barriers [2,83] and competition from a possible network of resident populations sparingly distributed, such genetically distinct glacial populations have apparently played a major role in the postglacial colonization of parts of northern Europe. A likely consequence of such glacial vicariance is that extant northern populations of nordic plant species might not be as homogenous as assumed by simply considering them as offsets of glacial populations located at southern latitudes. This observation implies that they might have evolved distinctive genetic adaptations during glacial vicariance, worth evaluating and considering in conservation programs [84,85]. As well, the extensive mixing of two ancestral lineages in central and northeastern Europe provides the opportunity to perhaps identify and preserve unique adaptive diversity.

Methods

Population sampling and DNA isolation

Fifty-four natural populations were sampled and their location was chosen in order to represent most of the natural range of the species in Europe and Asia. Twenty populations were from the eastern part of the Ural Mountains and Asia (Russia and China) as well as from Asia Minor (Turkey), and the remaining 34 populations from 13 European countries (Figure 1 and Table 3). Each seed lot represented a bulk of seeds from a minimum of 50 individuals with a minimum distance of 100 m between them. Seed samples were collected from each population and stored in darkness at 4°C until they were processed.

Seeds from each population were soaked on moistened filter paper in Petri dishes at 26°C under a photoperiod of 14 hours for 2 days until DNA extraction. DNA was extracted from the haploid megagametophyte for each of 9 to 20 seeds per population using a genomic DNA mini preparation kit (Sigma-Aldrich), for a total of 986 DNA samples and an average of 18.3 samples per population (Table 3). A screening for mtDNA polymorphism was conducted by assembling an exploratory panel of 26 out of the 986 DNA samples, each representative of a different population and ensuring that geographically widespread populations were represented.

Screening for mtDNA polymorphism and sequencing

A total of 15 mtDNA regions were screened for polymorphisms using various techniques (Table 1). Polymorphism was detected for only two regions, nad1 intron B/C (2 haplotypes), and nad7 intron 1 (3 haplotypes). DNA samples bearing different haplotypes for each of the variable mitochondrial regions were selected (3 DNA samples per locus and per haplotype from different populations) and sequenced in order to determine the exact nature of every fragment length polymorphism and to detect the presence of potential fragment length homoplasies. Direct sequencing of the two DNA strands was carried out on an automated 3730XL DNA analyser (Applied Biosystems) with the dideoxynucleotide chain termination procedure using the appropriate amplification primers and Big Dye Terminator kit-V.3.1 (Applied Biosystems). The complete sequences for nad7 intron 1 haplotypes have been deposited in GenBank (GenBank: DQ665913 to DQ665915). The complete sequence for nad1 intron B/C was already available in GenBank [6]. Multi-locus mtDNA haplotypes (mitotypes) were then defined by considering single-locus mtDNA genotypes simultaneously and their relationships were determined by statistical parsimony analysis of the aligned sequences using the program TCS [86].

mtDNA population survey and numerical analyses

Single-locus haplotypes were determined for each of 986 individuals with the internal primers pair nad1H and nad1I for nad1 intron B/C, as described by Soranzo et al [6], and the primers nad7 intron1 forward and nad7 intron1 reverse for nad7 intron 1, as described by Jaramillo-Correa et al [19]. Primers were synthetized by Invitrogen. DNA was amplified in a PTC225 thermal cycler (MJ Research) using Platinum Taq DNA Polymerase (Invitrogen) in a 12 μl reaction volume, following protocols published by Soranzo et al [6] for nad1 intron B/C and Jaramillo-Correa et al [19] for nad7 intron 1. PCR products of nad7 intron 1 were digested with the restriction enzyme Sau3A I (Promega) and then separated through 8 % non denaturating polyacrylamide gels (in TBE) in order to detect putative cleaved amplified polymorphic sites (CAPS). PCR products of nad1 intron B/C were electrophoresed through 2 % agarose gel.

The number of observed mitotypes per population (nh) and the total mtDNA diversity per population (H; equivalent to the expected heterozygosity, HE, for diploid data; [87]) were estimated. Population differentiation was estimated using two fixation indices, GST and NST, using PERMUT [88]. The first statistics is calculated based solely on mitotype frequencies, whereas the second one takes into account the genetic relatedness among mitotypes. Thus, if the estimated NST value is higher than the GST value, it indicates that closely related mitotypes tend to cluster in the same area, supporting the presence of a formal phylogeographic structure.

Geographic population structure was assessed using a spatial analysis of molecular variance SAMOVA 1.0 [89,90]. A matrix of pairwise distances between populations was first constructed using mitotype frequencies, as well as a matrix of pairwise geographic distances between populations. The method implemented in SAMOVA employs a simulated annealing procedure and uses allele frequency data along with geographic coordinates of the sampled populations to identify population groups maximizing genetic differentiation. We determined the most likely number of K groups by repeatedly running SAMOVA with variable numbers of groups and by choosing the number resulting in a maximum FCT value [90]. The configuration with the largest FCT value among the 100 tested was retained as the best grouping of populations.

Authors' contributions

KN was responsible for study design and sampling collection, preparing DNA samples and participated in data analysis and manuscript writing. SS was responsible for PCR assays and DNA sequencing, and participated in data analysis and manuscript writing. JBe was responsible for marker discovery, participated in data analysis, manuscript writing and co-funding of the study. FT contributed to manuscrit review and to co-funding of the study. JBo participated in scaling PCR assays, data analysis, manuscript writing, and co-funding of the study. All authors read and approved the final manuscript.

Acknowledgments

Acknowledgements

We are grateful to A. Alexandrov (Forest Research Institute, Bulgarian Academy of Sciences), A. Esqudero (ESCET, Universidad Rey Juan Carlos, Spain), B. Raevsky (Forest research Institute of the Karelian Research Center), C. Baldwin (Northern Forest Research Station, Roslin, Midlothian, UK) and M. Topack (Ministry of Forestry, Turkey) for providing seed collections. We also thank I. Naydenova (Univ. du Québec Abitibi-Témiscamingue) for help with DNA isolation, M. Deslauriers and E. Pouliot (Canadian Forest Service) for help in designing the new markers reported in this study, and J. Godbout and J.P. Jaramillo-Correa (Univ. Laval) for assistance with analyses. We also acknowledge constructive comments made by the reviewers, which particularly helped improve the discussion. This research was financially supported by grants to F. Tremblay from the Natural Sciences and Engineering Research Council of Canada (NSERC), to J. Beaulieu from the Canadian Forest Service, and to J. Bousquet from NSERC and the Canada Research Chair in Forest and Environmental Genomics.

Contributor Information

Krassimir Naydenov, Email: Krassimir.Naydenov@uqat.ca.

Sauphie Senneville, Email: sennevil@rsvs.ulaval.ca.

Jean Beaulieu, Email: Jean.Beaulieu2@nrcan.gc.ca.

Francine Tremblay, Email: Francine.Tremblay@uqat.ca.

Jean Bousquet, Email: bousquet@rsvs.ulaval.ca.

References

  1. Webb T, Bartlein PJ. Global changes during the last 3 million years: climatic controls and biotic responses. Annu Rev Ecol Syst. 1992;23:141–173. [Google Scholar]
  2. Hewitt GM. Some genetic consequences of ice ages, and their role in divergence and speciation. Biol J Linn Soc Lond. 1996;58:247–276. doi: 10.1006/bijl.1996.0035. [DOI] [Google Scholar]
  3. Taberlet P, Fumagalli L, Wust-Saucy AG, Cosson JF. Comparative phylogeography and postglacial colonization routes in Europe. Mol Ecol. 1998;7:453–464. doi: 10.1046/j.1365-294x.1998.00289.x. [DOI] [PubMed] [Google Scholar]
  4. Dumolin-Lapègue S, Demesure B, Fineschi S, Le Corre V, Petit RJ. Phylogeographic structure of white oaks throughout the European continent. Genetics. 1997;146:1475–1487. doi: 10.1093/genetics/146.4.1475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Sinclair WT, Morman JD, Ennos RA. The postglacial history of Scots pine (Pinus sylvestris L.) in western Europe: evidence from mitochondrial DNA variation. Mol Ecol. 1999;8:83–88. doi: 10.1046/j.1365-294X.1999.00527.x. [DOI] [Google Scholar]
  6. Soranzo N, Alia R, Provan J, Powell W. Patterns of variation at a mitochondrial sequence-tagged-site locus provides new insights into the postglacial history of European Pinus sylvestris populations. Mol Ecol. 2000;9:1205–1211. doi: 10.1046/j.1365-294x.2000.00994.x. [DOI] [PubMed] [Google Scholar]
  7. Gugerli F, Sperisen C, Büchler U, Magni F, Geburek T, Jeandroz S, Senn J. Haplotype variation in a mitochondrial tandem repeat of Norway spruce (Picea abies) populations suggests a serious founder effect during postglacial re-colonization of the western Alps. Mol Ecol. 2001;10:1255–1263. doi: 10.1046/j.1365-294X.2001.01279.x. [DOI] [PubMed] [Google Scholar]
  8. Petit RJ, Brewer S, Bordács S, Burg K, Cheddadi R, Coart E, Cottrell J, Csaikl UM, van Dam B, Deans JD, Espinel S, Fineschi S, Finkeldey R, Glaz I, Goicoechea PG, Jensen JS, König AO, Lowe AJ, Madsen SF, Mátyás G, Munro RC, Popescu F, Slade D, Tabbener H, de Vries SGM, Ziegenhagen B, de Beaulieu JL, Kremer A. Identification of refugia and post-glacial colonisation routes of European white oaks based on chloroplast DNA and fossil pollen evidence. For Ecol Manage. 2002;156:49–74. doi: 10.1016/S0378-1127(01)00634-X. [DOI] [Google Scholar]
  9. Burban C, Petit RJ. Phylogeography of maritime pine inferred with organelle markers having constrasted inheritance. Mol Ecol. 2003;12:1487–1495. doi: 10.1046/j.1365-294X.2003.01817.x. [DOI] [PubMed] [Google Scholar]
  10. Palmé AE, Su Q, Rautenberg A, Manni F, Lascoux M. Postglacial recolonization and cpDNA variation in silver birch, Betula pendula. Mol Ecol. 2003;12:201–212. doi: 10.1046/j.1365-294X.2003.01724.x. [DOI] [PubMed] [Google Scholar]
  11. Heuertz M, Fineschi S, Anzidei M, Pastorelli R, Salvini D, Paule L, Frascaria-Lacoste N, Hardy OJ, Vekemans X, Vendramin GG. Chloroplast DNA variation and postglacial recolonization of common ash (Fraxinus excelsior L.) in Europe. Mol Ecol. 2004;13:3437–3452. doi: 10.1111/j.1365-294X.2004.02333.x. [DOI] [PubMed] [Google Scholar]
  12. Huntley B, Birks HJB. An Atlas of Past and Present Pollen Maps for Europe: 0–13 000 years Ago. Cambridge (UK): Cambridge University Press; 1983. [Google Scholar]
  13. Bennett KD, Tzedakis PC, Willis KJ. Quaternary refugia of north European trees. J Biogeogr. 1991;18:103–115. doi: 10.2307/2845248. [DOI] [Google Scholar]
  14. Willis KJ. The vegetational history of the Balkans. Quaternary Sci Rev. 1994;13:769–788. doi: 10.1016/0277-3791(94)90104-X. [DOI] [Google Scholar]
  15. Brewer S, Cheddadi R, de Beaulieu JL, Reille M, Data contributors. The spread of deciduous Quercus throughout Europe since the last glacial period. For Ecol Manage. 2002;156:27–48. doi: 10.1016/S0378-1127(01)00646-6. [DOI] [Google Scholar]
  16. Petit RJ, Aguinagalde I, de Beaulieu JL, Bittkau C, Brewer S, Cheddadi R, Ennos R, Fineschi S, Grivet D, Lascoux M, Mohanty A, Müller-Starck G, Demesure-Musch B, Palmé A, Martin JP, Rendell S, Vendramin GG. Glacial refugia: hotspots but not melting pots of genetic diversity. Science. 2003;300:1563–1565. doi: 10.1126/science.1083264. [DOI] [PubMed] [Google Scholar]
  17. Emerson BC, Hewitt GM. Phylogeography. Curr Biol. 2005;15:R367–R371. doi: 10.1016/j.cub.2005.05.016. [DOI] [PubMed] [Google Scholar]
  18. Tremblay NO, Schoen DJ. Molecular phylogeography of Dryas integrifolia: glacial refugia and postglacial recolonization. Mol Ecol. 1999;8:1187–1198. doi: 10.1046/j.1365-294x.1999.00680.x. [DOI] [PubMed] [Google Scholar]
  19. Jaramillo-Correa JP, Beaulieu J, Bousquet J. Variation in mitochondrial DNA reveals multiple distant glacial refugia in black spruce (Picea mariana), a transcontinental North American conifer. Mol Ecol. 2004;13:2735–2747. doi: 10.1111/j.1365-294X.2004.02258.x. [DOI] [PubMed] [Google Scholar]
  20. Godbout J, Jaramillo-Correa JP, Beaulieu J, Bousquet J. A mitochondrial DNA minisatellite reveals the postglacial history of jack pine (Pinus banksiana), a broad-range North American conifer. Mol Ecol. 2005;14:3497–3512. doi: 10.1111/j.1365-294X.2005.02674.x. [DOI] [PubMed] [Google Scholar]
  21. Hewitt GM. Post-glacial re-colonization of European biota. Biol J Linn Soc Lond. 1999;68:87–112. doi: 10.1006/bijl.1999.0332. [DOI] [Google Scholar]
  22. Stewart JR, Lister AM. Cryptic northern refugia and the origins of the modern biota. Trends Ecol Evol. 2001;16:608–613. doi: 10.1016/S0169-5347(01)02338-2. [DOI] [Google Scholar]
  23. Taberlet P, Cheddadi R. Quaternary refugia and persistence of biodiversity. Science. 2002;297:2009–2010. doi: 10.1126/science.297.5589.2009. [DOI] [PubMed] [Google Scholar]
  24. Willis KJ, van Andel TH. Trees or no trees? The Environments of central and eastern Europe during the last glaciation. Quaternary Sci Rev. 2004;23:2369–2387. doi: 10.1016/j.quascirev.2004.06.002. [DOI] [Google Scholar]
  25. Magri D, Vendramin GG, Comps B, Dupanloup I, Geburek T, Gömöry D, Latalowa M, Litt T, Paule L, Roure JM, Tantau I, van der Knaap WO, Petit RJ, de Beaulieu JL. A new scenario for the Quaternary history of European beech populations : palaeobotanical evidence and genetic consequences. New Phytol. 2006;171:199–221. doi: 10.1111/j.1469-8137.2006.01740.x. [DOI] [PubMed] [Google Scholar]
  26. Baker RG. Pollen sequence from the late Quaternary sediments in Yellowstone Park. Science. 1970;168:1449–1450. doi: 10.1126/science.168.3938.1449. [DOI] [PubMed] [Google Scholar]
  27. Mehringer PJ, Jr, Arno SF, Petersen KL. Postglacial history of lost trail pass bog, Bitteroot Mountains, Montana. Arct Antarc Alp Res. 1977;9:345–368. doi: 10.2307/1550528. [DOI] [Google Scholar]
  28. Rowe KC, Heske EJ, Brown PK, Paige KN. Surviving the ice: Northern refugia and postglacial colonization. Proc Natl Acad Sci USA. 2004;101:10355–10359. doi: 10.1073/pnas.0401338101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Anderson LL, Hu FS, Nelson DM, Petit RJ, Paige KN. Ice-age endurance: DNA evidence of a white spruce refugium in Alaska. Proc Natl Acad Sci USA. 2006;103:12447–12450. doi: 10.1073/pnas.0605310103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Cheddadi R, Vendramin GG, Litt T, François L, Kageyama M, Lorentz S, Laurent JM, de Beaulieu JL, Sadori L, Jost A, Lunt D. Imprints of glacial refugia in the modern genetic diversity of Pinus sylvestris. Glob Ecol Biogeogr. 2006;15:271–282. [Google Scholar]
  31. Farjon A. Pines Drawings and descriptions of the genus Pinus. Leiden: Brill and Backhuys Publishers; 1984. [Google Scholar]
  32. Vidakovic M. Conifers : morphology and variation. Zagreb: Graficki Zavod Hrvatske; 1991. [Google Scholar]
  33. Svoboda P. Forest trees and their communities. Prague: Statni zemedelske nakladatelstvi; 1953. [Google Scholar]
  34. Gaussen H, Heywood VH, Chater AO. Pinus L. In: Tutin TG, Heywood VH, Burges NA, Valentine DH, Walters SM, Webb DA, editor. Flora Europaea 1. Cambridge (UK): Cambridge University Press; 1964. pp. 32–35. [Google Scholar]
  35. Pravdin LF. Scots Pine Variation, intraspecific taxonomy and selection. Jerusalem: Israel Program for Scientific Translations; 1969. [Google Scholar]
  36. Krüssmann G. Handbuch der Nadelgehölze. 2. Berlin: Parey P; 1983. [Google Scholar]
  37. Giertych M, Oleksyn J. Studies on genetic variation in Scots pine (Pinus sylvestris L.) coordinated by IUFRO. Silvae Genet. 1992;41:133–143. [Google Scholar]
  38. Sukacev VN. Dendrologija s osnovami lesnoi geobotaniki. Moskow: Nauka; 1938. [Google Scholar]
  39. Tobolski JJ, Hanover JW. Genetic variation in the monoterpenes of Scotch pine. Forest Sci. 1971;17:293–299. [Google Scholar]
  40. Forrest GI. Genotypic variation among native Scots Pine populations in Scotland based on monoterpene analysis. Forestry. 1980;53:101–128. doi: 10.1093/forestry/53.2.101. [DOI] [Google Scholar]
  41. Gullberg U, Yazdani R, Rudin D. Genetic differentiation between adjacent populations of Pinus sylvestris. Silva Fenn. 1982;16:205–214. [Google Scholar]
  42. Gullberg U, Yazdani R, Rudin D, Ryman N. Allozyme variation in Scots pine (Pinus sylvestris L.) in Sweden. Silvae Genet. 1985;34:193–201. [Google Scholar]
  43. Kinloch BB, Westfall RD, Forrest GI. Caledonian Scots pine: origins and genetic structure. New Phytol. 1986;104:703–729. doi: 10.1111/j.1469-8137.1986.tb00671.x. [DOI] [PubMed] [Google Scholar]
  44. Yazdani R, Nilsson JE. Cortical monoterpene variation in natural populations of Pinus sylvestris in Sweden. Scand J Forest Res. 1986;1:85–93. [Google Scholar]
  45. Lebreton P, Laracine-Pittet C, Bayet C, Lauranson J. Variation in polyphenol and taxonomy of Scots pine (Pinus sylvestris) Ann For Sci. 1990;47:117–130. doi: 10.1051/forest:19900203. [DOI] [Google Scholar]
  46. Dong J, Wagner DB. Taxonomic and population differentiation of mitochondrial diversity in Pinus banksiana and Pinus contorta. Theor Appl Genet. 1993;86:573–578. doi: 10.1007/BF00838711. [DOI] [PubMed] [Google Scholar]
  47. Jaramillo-Correa JP, Bousquet J, Beaulieu J, Isabel N, Perron M, Bouillé M. Cross-species amplification of mitochondrial DNA sequence-tagged-site markers in conifers: the nature of polymorphism and variation within and among species in Picea. Theor Appl Genet. 2003;106:1353–1367. doi: 10.1007/s00122-002-1174-z. [DOI] [PubMed] [Google Scholar]
  48. Wolfe KH, Li WH, Sharp PM. Rates of nucleotide subsitution vary greatly among plant mitochondrial, chloroplast, and nuclear DNAs. Proc Natl Acad Sci USA. 1987;84:9054–9058. doi: 10.1073/pnas.84.24.9054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Laroche J, Li P, Maggia L, Bousquet J. Molecular evolution of angiosperm mitochondrial introns and exons. Proc Natl Acad Sci USA. 1997;94:5722–5727. doi: 10.1073/pnas.94.11.5722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Gros-Louis M-C, Bousquet J, Pâques LE, Isabel N. Species-diagnostic markers in Larix spp. based on RAPDs and nuclear, cpDNA, and mtDNA gene sequences, and their phylogenetic implications. Tree Genet Genomes. 2005;1:50–63. doi: 10.1007/s11295-005-0007-z. [DOI] [Google Scholar]
  51. Sinclair WT, Morman JD, Ennos RA. Multiple origins for Scots pine (Pinus sylvestris L.) in Scotland: evidence from mitochondrial DNA variation. Heredity. 1998;80:233–240. doi: 10.1046/j.1365-2540.1998.00287.x. [DOI] [Google Scholar]
  52. Sperisen C, Büchler U, Gugerli F, Mátyás G, Geburek T, Vendramin GG. Tandem repeats in plant mitochondrial genomes: application to the analysis of population differentiation in the conifer Norway spruce. Mol Ecol. 2001;10:257–263. doi: 10.1046/j.1365-294X.2001.01180.x. [DOI] [PubMed] [Google Scholar]
  53. Bastien D, Favre JM, Collignon AM, Sperisen C, Jeandroz S. Characterization of a mosaic minisatellite locus in the mitochondrial DNA of Norway spruce (Picea abies (L.) Karst.) Theor Appl Genet. 2003;107:574–580. doi: 10.1007/s00122-003-1284-2. [DOI] [PubMed] [Google Scholar]
  54. Petit RJ, Duminil J, Fineschi S, Hampe A, Salvini D, Vendramin GG. Comparative organization of chloroplast, mitochondrial and nuclear diversity in plant populations. Mol Ecol. 2005;14:689–701. doi: 10.1111/j.1365-294X.2004.02410.x. [DOI] [PubMed] [Google Scholar]
  55. Muona O, Harju A. Effective population sizes, genetic variability, and mating system in natural stands and seed orchards of Pinus sylvestris. Silvae Genet. 1989;38:221–228. [Google Scholar]
  56. Wang X-R, Szmidt AE, Lindgren D. Allozyme differentiation among populations of Pinus sylvestris (L.) from Sweden and China. Hereditas. 1991;114:219–226. [Google Scholar]
  57. Szmidt AE, Wang XR. Molecular systematics and genetic differentiation of Pinus sylvestris (L.) and P. densiflora (Sieb. et Zucc.) Theor Appl Genet. 1993;86:159–165. doi: 10.1007/BF00222074. [DOI] [PubMed] [Google Scholar]
  58. Goncharenko GG, Silin AE, Padutov VE. Allozyme variation in natural populations of Eurasian pines. III. Population structure, diversity, differentiation and gene flow in central and isolated populations of Pinus sylvestris L. in Eastern Europe and Siberia. Silvae Genet. 1994;43:119–132. [Google Scholar]
  59. Prus-Glowacki W, Bernard E. Allozyme variation in populations of Pinus sylvestris L. from a 1912 provenance trial in Pulawy (Poland) Silvae Genet. 1994;43:132–138. [Google Scholar]
  60. Prus-Glowacki W, Stephan BR. Genetic variation of Pinus sylvestris from Spain in relation to other European populations. Silvae Genet. 1994;43:7–14. [Google Scholar]
  61. Szweykowski J, Prus-Glowacki W, Hrynkiewicz J. The genetic structure of Scots pine (Pinus sylvestris L.) population from the top of Szczeliniec Wielki Moutain, Central Sudetes. Acta Soc Bot Pol. 1994;63:315–324. [Google Scholar]
  62. Naydenov KD, Tremblay FM, Alexandrov A, Fenton NJ. Structure of Pinus sylvestris L. populations in Bulgaria revealed by chloroplast microsatellites and terpenes analysis: Provenance tests. Biochem Syst Ecol. 2005;33:1226–1245. doi: 10.1016/j.bse.2005.07.011. [DOI] [Google Scholar]
  63. Jaramillo-Correa JP, Beaulieu J, Ledig FT, Bousquet J. Decoupled mitochondrial and chloroplast DNA population structure reveals Holocene collapse and population isolation in a threatened Mexican-endemic conifer. Mol Ecol. 2006;15:2787–2800. doi: 10.1111/j.1365-294X.2006.02974.x. [DOI] [PubMed] [Google Scholar]
  64. Agúndez D, Degen B, von Wuehlisch G, Alía R. Multilocus analysis of Pinus halepensis Mill. from Spain: genetic diversity and clinal variation. Silvae Genet. 1999;48:173–178. [Google Scholar]
  65. Carrión JS, Navarro C, Navarro J, Munuera M. The distribution of cluster pine (Pinus pinaster) in Spain as derived from palaeoecological data: relationships with phytosociological classification. Holocene. 2000;10:243–252. doi: 10.1191/095968300676937462. [DOI] [Google Scholar]
  66. Dobrinov I. Genetic and Selection of Forest Tree. Sofia: Zemizdat; 1983. [Google Scholar]
  67. Shaw KL. Conflict between nuclear and mitochondrial DNA phylogenies of a recent species radiation: What mtDNA reveals and conceals about modes of speciation in Hawaiian crickets. Proc Natl Acad Sci USA. 2002;99:16122–16127. doi: 10.1073/pnas.242585899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Ran JH, Wei XX, Wang XQ. Molecular phylogeny and biogeography of Picea (Pinaceae): Implications for phylogeographical studies using cytoplasmic haplotypes. Mol Phylogenet Evol. 2006;41:405–419. doi: 10.1016/j.ympev.2006.05.039. [DOI] [PubMed] [Google Scholar]
  69. Eastwood WJ, Roberts N, Lamb HF, Tibby JC. Holocene environmental change in southwest Turkey: a palaeoecological record of lake and catchment-related changes. Quaternary Sci Rev. 1999;18:671–695. doi: 10.1016/S0277-3791(98)00104-8. [DOI] [Google Scholar]
  70. Nikolov N, Helmisaari H. Silvics of the circumpolar boreal forest tree species. In: Shugart HH, Leemans R, Bonan GB, editor. A Systems Analysis of the Global Forest. Cambridge (UK): Cambridge University Press; 1992. pp. 13–85. [Google Scholar]
  71. Ibrahim KM, Nichols RA, Hewitt GM. Spatial patterns of genetic variation generated by different forma of dispersal during range expansion. Heredity. 1996;77:282–291. doi: 10.1038/sj.hdy.6880320. [DOI] [Google Scholar]
  72. Seddon JM, Santucci F, Reeve NJ, Hewitt GM. DNA footprints of European hedgehogs, Erinaceus europaeus and E. concolor: Pleistocene refugia, postglacial expansion and colonization routes. Mol Ecol. 2001;10:2187–2198. doi: 10.1046/j.0962-1083.2001.01357.x. [DOI] [PubMed] [Google Scholar]
  73. van Zeist W, Bottema S. Late Quaternary vegetation of the Near East. In: Verlag LR, Reihe A, editor. Beihefte zum Tubinger Atlas des vorderen orients. Wiesbaden: Naturwissenshaften; 1991. pp. 1–156. [Google Scholar]
  74. Roberts N, Wright HE. Vegetational, lake level, and climatic history of the Near East and Southwest Asia. In: Wright HE, Kutzbach JE, Webb T, Ruddiman WF, Street-Perrott FA, Bartlein PJ, editor. Global climates since the last glacial maximum. Minneapolis: University of Minnesota Press; 1993. pp. 194–220. [Google Scholar]
  75. Michaux JR, Libois R, Paradis E, Filippucci M-G. Phylogeographic history of the yellownecked fieldmouse (Apodemus flavicollis) in Europe and in the Near and Middle East. Mol Phylogenet Evol. 2004;32:788–798. doi: 10.1016/j.ympev.2004.02.018. [DOI] [PubMed] [Google Scholar]
  76. Cooper SJ, Ibrahim KM, Hewitt GM. Postglacial expansion and genome subdivision in the European grasshopper Chorthippus parallelus. Mol Ecol. 1995;4:49–60. doi: 10.1111/j.1365-294x.1995.tb00191.x. [DOI] [PubMed] [Google Scholar]
  77. Demesure B, Comps B, Petit RJ. Chloroplast DNA phylogeography of the common beech (Fagus sylvatica L.) in Europe. Evolution. 1996;50:2515–2520. doi: 10.2307/2410719. [DOI] [PubMed] [Google Scholar]
  78. Giesecke T, Bennett KD. The Holocene spread of Picea abies (L.) Karst. in Fennoscandia and adjacent areas. J Biogeogr. 2004;31:1523–1548. doi: 10.1111/j.1365-2699.2004.01095.x. [DOI] [Google Scholar]
  79. Abbott RJ, Brochmann C. History and evolution of the arctic flora: in the footsteps of Eric Hultén. Mol Ecol. 2003;12:299–313. doi: 10.1046/j.1365-294X.2003.01731.x. [DOI] [PubMed] [Google Scholar]
  80. Glebov FZ. Relations of Forest and Bog in the Taiga Belt. Novosibirsk: Nauka; 1988. [Google Scholar]
  81. Chernova GM, Mikhailov NN, Denisenko VP, Kozyreva MG. Some questions of paleogeography of Holocene of South Eastern Altai. Izvestia of All-Union Geographical Society. 1991;2:140–146. [Google Scholar]
  82. Kremenetski CV, Lui KB, MacDonald GM. The late Quaternary dynamics of pines in northern Asia. In: Richardson DM, editor. Ecology and Biogeography of Pinus. Cambridge (UK): Cambridge University Press; 1998. pp. 95–106. [Google Scholar]
  83. Willis KJ, Bennett KD, Birks HJB. The late Quaternary dynamics of pines in Europe. In: Richardson DM, editor. Ecology and Biogeography of Pinus. Cambridge (UK): Cambridge University Press; 1998. pp. 107–121. [Google Scholar]
  84. Moritz C. Defining 'Evolutionary Significant Units' for conservation. Trends Ecol Evol. 1994;9:373–375. doi: 10.1016/0169-5347(94)90057-4. [DOI] [PubMed] [Google Scholar]
  85. Moritz C. Strategies to protect biological diversity and the evolutionary process that sustain it. Syst Biol. 2002;51:238–254. doi: 10.1080/10635150252899752. [DOI] [PubMed] [Google Scholar]
  86. Clement M, Posada D, Crandall K. TCS: a computer program to estimate gene genealogies. Mol Ecol. 2000;9:1657–1660. doi: 10.1046/j.1365-294x.2000.01020.x. [DOI] [PubMed] [Google Scholar]
  87. Weir BS. Genetic Data Analysis II. Sunderland: Sinauer Associates; 1996. [Google Scholar]
  88. Pons O, Petit RJ. Measuring and testing genetic differentiation with ordered versus unordered alleles. Genetics. 1996;144:1237–1245. doi: 10.1093/genetics/144.3.1237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. SAMOVA 1.0: A program to define by a simulated annealing approach the genetic structure of populations http://cmpg.unibe.ch/software/samova/ [DOI] [PubMed]
  90. Dupanloup I, Schneider S, Excoffier L. A simulated annealing approach to define the genetic structure of populations. Mol Ecol. 2002;11:2571–2581. doi: 10.1046/j.1365-294X.2002.01650.x. [DOI] [PubMed] [Google Scholar]
  91. Jeandroz S, Bastien D, Chandelier A, Du Jardin P, Favre JM. A set of primers for amplification of mitochondrial DNA in Picea abies and other conifer species. Mol Ecol Notes. 2002;2:389–391. doi: 10.1046/j.1471-8286.2002.00271.x. [DOI] [Google Scholar]
  92. Soranzo N, Provan J, Powell W. An example of microsatellite length variation in the mitochondrial genome of conifers. Genome. 1999;42:158–161. doi: 10.1139/gen-42-1-158. [DOI] [PubMed] [Google Scholar]
  93. Wu J, Krutovskii KV, Strauss SH. Abundant mitochondrial genome diversity, population differentiation and convergent evolution in pines. Genetics. 1998;150:1605–1614. doi: 10.1093/genetics/150.4.1605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  94. Duff RJ, Nickrent DL. Phylogenetic relationships of land plants using mitochondrial small-subunit rDNA sequences. Am J Bot. 1999;86:372–386. doi: 10.2307/2656759. [DOI] [PubMed] [Google Scholar]
  95. Demesure B, Sodzi N, Petit RJ. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol Ecol. 1995;4:129–131. doi: 10.1111/j.1365-294x.1995.tb00201.x. [DOI] [PubMed] [Google Scholar]

Articles from BMC Evolutionary Biology are provided here courtesy of BMC

RESOURCES