Skip to main content
PMC home page
The Journal of Physiology logoLink to The Journal of Physiology
. 2002 Jul 15;542(Pt 2):369–382. doi: 10.1113/jphysiol.2002.018382

Molecular identification of Kvα subunits that contribute to the oxygen-sensitive K+ current of chemoreceptor cells of the rabbit carotid body

Diego Sanchez 1, Jose R López-López 1, M Teresa Pérez-García 1, Gloria Sanz-Alfayate 1, Ana Obeso 1, Maria D Ganfornina 1, Constancio Gonzalez 1
PMCID: PMC2290426  PMID: 12122138

Abstract

Rabbit carotid body (CB) chemoreceptor cells possess a fast-inactivating K+ current that is specifically inhibited by hypoxia. We have studied the expression of Kvα subunits, which might be responsible for this current. RT-PCR experiments identified the expression of Kv1.4, Kv3.4, Kv4.1 and Kv4.3 mRNAs in the rabbit CB. There was no expression of Kv3.3 or Kv4.2 transcripts. Immunocytochemistry with antibodies to tyrosine hydroxylase (anti-TH) and to specific Kv subunits revealed the expression of Kv3.4 and Kv4.3 in chemoreceptor cells, while Kv1.4 was only found in nerve fibres. Kv4.1 mRNA was also found in chemoreceptor cells following in situ hybridization combined with anti-TH antibody labelling. Kv4.1 and Kv4.3 appeared to be present in all chemoreceptor cells, but Kv3.4 was only expressed in a population of them. Electrophysiological experiments applying specific toxins or antibodies demonstrated that both Kv3.4 and Kv4.3 participate in the oxygen-sensitive K+ current of chemoreceptor cells. However, toxin application experiments confirmed a larger contribution of members of the Kv4 subfamily. [Ca2+]i measurements under hypoxic conditions and immunocytochemistry experiments in dispersed CB cells demonstrated the expression of Kv3.4 and Kv4.3 in oxygen-sensitive cells; the presence of Kv3.4 in the chemoreceptor cell membrane was not required for the response to low PO2. In summary, three Kv subunits (Kv3.4, Kv4.1 and Kv4.3) may be involved in the fast-inactivating outward K+ current of rabbit CB chemoreceptor cells. The homogeneous distribution of the Kv4 subunits in chemoreceptor cells, along with their electrophysiological properties, suggest that Kv4.1, Kv4.3, or their heteromultimers, are the molecular correlate of the oxygen-sensitive K+ channel.

Carotid bodies (CBs) are arterial chemoreceptors whose role in O2 chemoreception has been studied for a long time. A decrease of O2 in the chemoreceptor cell environment diminishes the activity of K+ channels, which in turn generates a depolarization-mediated neurotransmission event that elicits the appropriate ventilatory response (Gonzalez et al. 1994). The association between K+ channels and O2 sensing was first reported in the rabbit CB as a specific decrease in a particular component of the K+ current evoked by depolarizing pulses (López-Barneo et al. 1988). Further studies identified a fast-inactivating voltage-dependent and calcium-independent K+ channel that is inhibited specifically by a drop in the environmental PO2 (Ganfornina & López-Barneo, 1992a), and defined the kinetic modifications of the channel molecule that were induced by hypoxic conditions (Ganfornina & López-Barneo, 1992b). However, in spite of the extensive knowledge of the electrophysiological and pharmacological properties of the oxygen-sensitive K+ channel of rabbit CB chemoreceptor cells, little is known about its molecular identity. Oxygen-sensitive K+ channels have been described in other cell types, and in some cases their subunit composition has been elucidated (Pérez-García & López-López, 2000; López-Barneo et al. 2001; Patel & Honore, 2001)

K+ channels comprise primarily a tetrameric arrangement of structural subunits, each one being a separate polypeptide, and all of which are members of a large and diverse protein family (reviewed by Coetzee et al. 1999). In the Kv subfamily, these subunits are formed by six transmembrane-helix polypeptides that possess a particular voltage-sensitive transmembrane domain. Recent studies using adenoviral infections with dominant-negative forms of Kv1 and Kv4 subunits suggest that the latter are the fast-inactivating K+ channels that underlie the oxygen-sensing capabilities of rabbit chemoreceptor cells (Pérez-García et al. 2000). However, that study did not identify the members of the Kv4 subfamily present in chemoreceptor cells, and did not assess the possible contribution of other Kv subunits to the transient outward K+ current of these cells. So far, six different Kv subunits have been reported to be able to form fast-inactivating K+ channels when individually expressed in heterologous expression systems. These are the Kv1.4, Kv3.3, Kv3.4, Kv4.1, Kv4.2 and Kv4.3 subunits (Barry & Nerbonne, 1996; Coetzee et al. 1999; Rudy & McBain, 2001). The molecular identification of the fast-inactivating subunits that contribute to the oxygen-sensitive K+ channels of CB chemoreceptor cells will indeed lead us to subsequently work out the molecular interactions occurring between the event of O2 detection and the conformational changes regulating the passage of K+ through the channel. Thus, the aim of the present work was to catalogue the molecular species of fast-inactivating K+ channel α subunits present in rabbit CB chemoreceptor cells.

Only the sequences of rabbit Kv3.3 and 4.3 were available at the time we started this work. We thus cloned and sequenced fragments of the remaining fast-inactivating Kv subunits, and designed oligonucleotides to test the presence of their transcripts in rabbit CB cells. Using a combination of histochemistry, molecular biology, Ca2+ imaging and electrophysiological techniques, we looked for the presence of these specific Kv subunits in the rabbit CB cells. Here we report the identification of three fast-inactivating Kv subunits, namely the Kv3.4, Kv4.1 and a splice variant of Kv4.3 (Kv4.3-l) specifically localized in chemoreceptor cells. We also show that Kv3.4 is heterogeneously distributed in oxygen-sensitive CB cells, and that its presence is not necessary for a chemoreceptor cell to respond to low PO2 with a rise in [Ca2+]i.

METHODS

Dissociation and short-term culture of CB cells

Adult New Zealand rabbits (1.5-2 kg) were anaesthetized intravenously with sodium pentobarbital (40 mg kg−1). A tracheostomy procedure was performed, after which the carotid artery bifurcations were dissected out and the animals were killed by intracardiac injection of sodium pentobarbital. All measures were taken to ensure that the animals did not suffer distress at any time. The protocols were approved by the Institutional Animal Care and Use Committee of the University of Valladolid. The CBs were dispersed enzymatically with a modification of a previously described method (Pérez-García et al. 1992). Briefly, they were incubated at 37 °C for 15 min in 2 ml of a collagenase solution (nominally calcium- and magnesium-free Tyrode solution containing 2.5 mg ml−1 collagenase and 6 mg ml−1 albumin), washed, and additionally incubated for 30 min in 2 ml of a trypsin solution (1 mg ml−1 trypsin and 6 mg ml−1 albumin in nominally calcium- and magnesium-free Tyrode solution). At the end of the second incubation, 2 ml of growth medium (Dulbecco's modified Eagle's medium-F12 with 5 % fetal bovine serum, 2 mm glutamine, 100 U ml−1 penicillin, 100 μg ml−1 streptomycin, 40 μg ml−1 gentamicin and 10 μM cytosine arabinoside) was added, and the CBs were disrupted by passing them repeatedly through the tip of a fire-polished Pasteur pipette. The medium containing isolated cells was centrifuged (800 g) and the pellet resuspended in growth medium. The dispersed cells were plated onto poly-l-lysine-coated coverslips with 2 ml of growth medium, and maintained in culture at 37 °C.

Electrophysiological methods

Ionic currents were recorded at room temperature (20-25 °C) using the whole-cell configuration of the patch-clamp technique. Whole-cell current recordings and data acquisition from CB chemoreceptor cells were made as described previously (López-López et al. 1997). The coverslips with the attached cells were placed at the bottom of a small recording chamber (0.2 ml) on the stage of an inverted microscope and perfused by gravity with the bath solution. This solution was connected to ground via a 3 m KCl agar bridge and a Ag-AgCl electrode. Patch pipettes were made from borosilicate glass (1.5 mm o.d.; Clark Electromedical Instruments), double-pulled (Narishige PP-83) and heat-polished (Narishige MF-83) to resistances that ranged from 1.5 to 3 MΩ when filled with the internal solution. For the recording of K+ currents, the composition of the bath solution was (mm): 141 NaCl, 4.7 KCl, 1.2 MgCl2, 1.8 CaCl2, 10 glucose, 10 Hepes, (pH 7.4 with NaOH) and the pipette was filled with a solution containing (mm): 125 KCl, 4 MgCl2, 10 Hepes, 10 EGTA, 5 MgATP; pH 7.2 with KOH. Unless otherwise indicated, K+ currents were recorded by imposing 300 ms depolarizing voltage steps to +40 mV from a holding potential of −80 mV, applied every 15 s.

Whole-cell currents were recorded using an Axopatch 200 patch-clamp amplifier, filtered at 2 kHz (-3dB, four-pole Bessel filter), and sampled at 10 kHz. When leak-subtraction was performed, an online P/4 protocol was used. Recordings were digitized with a Digidata 1200 A/D interface, driven by CLAMPEX 8 software (Axon Instruments, CA, USA) in a Pentium clone computer.

Hypoxia was achieved by bubbling the reservoir that fed the perfusion chamber with 100 % N2, obtaining a final PO2 level in the perfusion chamber below 10 mmHg. O2 levels were measured with small, needle PO2 electrodes (Diamond General Development, MI, USA) that were placed in the vicinity of the cells.

The Kv3.4-specific toxin BDS-I was obtained from Alomone Laboratories, and the Kv4-specific toxin heteropodatoxin (HpTx-2) was kindly provided by NPS Pharmaceuticals (Salt Lake City, UT, USA). Both drugs were prepared according to the manufacturer's instructions. Toxins were applied over a stagnant bath solution, and recovery was achieved by restoring normal flow.

For the antibody-blocking experiments, electrodes were dipped into a filtered antibody-free pipette solution and then back-filled with the pipette solution containing the antibody of interest at a concentration of 0.2 μg ml−1. In order to eliminate artefacts due to changes in the seal conditions during these experiments, we monitored the electrode access resistance (Ra), the membrane resistance (Rm) and the membrane capacitance for each depolarizing pulse. A 10 ms hyperpolarizing prepulse from −80 to −100 mV was applied, without whole-cell capacitance and Ra compensation, 100 ms prior to the depolarizing step to +40 mV (see Fig. 6). The current response to the hyperpolarizing prepulse was used to calculate Ra and Rm by applying the membrane test algorithms of the pCLAMP program (Axon Instruments). Cells that did not show stable values of Ra during the experiment were not used in the analysis.

Figure 6.

Figure 6

Open in a new tab

Immunological blockade of fast-inactivating K+ currents in rabbit CB chemoreceptor cells

A-C, representative recordings of outward currents of chemoreceptor cells obtained with pulses to +40 mV, before (thick traces) and after (thin traces) 10 min of dialysis of antibodies raised against Kv1.4 (A), Kv3.4 (B) and Kv4.3 (C) subunits. The left upper panels show seal conditions of the control recordings for each trace (see Methods for details about the voltage protocol). D, plot of average (mean ± s.e.m.) effects of antibodies measuring I/I0 at 10 min of recording. Only the anti-Kv3.4 and Kv4.3 antibodies produced a significant reduction in this parameter.

Electrophysiological data analyses were performed with the CLAMPFIT subroutine of the pCLAMP software and with ORIGIN 4.0 software (Microcal). Pooled data are expressed as mean ± s.e.m. Statistical comparisons between groups of data were carried out with Student's two-tailed t test for paired or unpaired data, and values of P < 0.05 were considered statistically different.

Ca2+ imaging

Chemoreceptor cells were incubated with 10 μM fura-2 AM (Molecular Probes) diluted in Tyrode solution with 0.1 % Pluronic F-127 (Molecular Probes) at 20 °C for 60 min. After fura-2 loading, the culture coverslips were mounted in a perfusion chamber placed on the stage of a Nikon Diaphot 300 inverted microscope, and the cells were superfused with a solution containing (mm): 116 NaCl, 5 KCl, 1.1 MgCl2, 2 CaCl2, 25 NaCO3H, 10 glucose, 10 Hepes, (pH 7.4 bubbled with 5 % CO2-20 % O2-75 % N2). The temperature of the preparation was kept at 37 °C. Dual-wavelength measurements of fura-2 fluorescence were performed, using the two-way wavelength illumination system DX-1000 (Solamere Technology Group). A 100 W Hg lamp was used as light source (Optiquip). Light was focussed and collected through a Nikon Fluor 40/1.30 objective. The wavelength for dye excitation was alternated between 340 and 380 nm, and fluorescence emission at 540 nm was collected with a SensiCam digital Camera (PCO CCD imaging). A 4 × 4 binning was applied to achieve ratio images of 320 × 256 pixels (12 bits pixel−1) at 0.5 Hz. The illumination system and the camera were driven by Axon Imaging Workbench 4.0 (Axon Instruments) running in a Pentium computer. [Ca2+]i was computed offline through the ratio images obtained form the background-subtracted F340 and F380 images and calibration parameters measured in selected experiments (after perfusing the cells for 30 min with zero Ca2+ + 10 mm EGTA, or with 2 mm calcium-containing solutions in the presence of 50 μM ionomycin). In all of the experiments, hypoxia and 35 mm KCl were used as stimuli. At the end of the experiment, the presence of tyrosine hydroxylase (TH), Kv3.4 or Kv4.3 in the cells was assessed by immunofluorescence, as described below.

RT-PCR methods

Total RNA was extracted from rabbit CBs and other tissues using Trizol (Gibco-BRL). Reverse transcription was carried out using MuLV reverse transcriptase (PE Biosystems) at 42 °C for 60 min. PCR experiments were performed in a thermal cycler (GeneAmp 9700 Perkin Elmer) using thin-walled plastic tubes (PE Biosystems).

The degenerate PCR primers used for the amplification and cloning of fragments of rabbit Kv1.4, Kv3.4, Kv4.1, Kv4.2 and TH were designed from GenBank sequences of these mammalian genes, using CODEHOP (Rose et al. 1998) from the web (http://blocks.fhcrc.org/blocks/codehop.html). The PCR-amplified novel rabbit gene fragments were subcloned into pCR-II using TOPO-TA cloning (Invitrogen), and sequenced on an ABI Prism 377 automated DNA sequencer using Taq FS DNA polymerase. The sequences of the novel rabbit sequences were deposited in GenBank (see Table 1). Unique primers for TH and Kv-subunit amplification were designed using the Primer 3 website (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3-www.cgi). Primers for amplifying rabbit Kv4.3-l were designed from the GenBank sequence (Acc. no. AF198445). Primers for amplifying rabbit Kv3.3 were designed from the rabbit sequence provided by Dr Rae (Rae & Shepard, 2000).

Table 1.

mRNA primer sequences

mRNA Primer sequences Product length (bp) Ace. no./reference
Rb Kv1.4 Left: CACCGACAGAGCGGCTTTCC 536 AF493544
Right: CCTCATCCTCACGAAACTTGAGC
Rb Kv3.3 Left: GAAGCTGCCCAAGAAGAAGA 483 Rae & Shepard, 2000
Right: GCATAGTCGGTGAGGAGGAA
Rb Kv3.4 Left: GCCCATCCTGACCTACATCG 443 AF493545
Right: CGATGGGGATGCTCTTGAAG
Rb Kv4.1 Left: TTGCTGCACTGCCTAGAGAA 300 AF493548
Right: CTTGGCATTGAGGCTTGAG
Rb Kv4.2 Left: TCGGCTGTTAGATAGCGGTG 301 AF493547
Right: GTTTTGAAACCCAGCACCAC
Rb Kv4.3-1 Left: GGGTTGTCCTATCTTGTGGATG 350 AF198445
Right: TTTGGTCTCAGTCCGTCGTC
Rb ribosomal protein L 18 Left: ATTCGCCACAACAAGGACAG 287 R86515
Right: AGGAGCACACCTTCAGCTTG
Rb TH Left: AATTCGATTCCGACCTGGAT 398 AF493546
Right: GATGTACTGGGTGCACTGGA
Open in a new tab

TH, tyrosine hydroxylase.

Control genes used for RT-PCR were TH and the rabbit ribosomal protein L18 (Acc. no. R86515). Annealing temperature (AT) was 56 °C for Kv4.2 and Kv4.3, and 58 °C for Kv1.4, Kv3.3, Kv3.4, Kv4.1, TH and L18 amplifications. Primer sequences for RT-PCR are shown in Table 1. RT-PCR conditions were 30 s at 95 °C (15 s at 95 °C, 20 s at AT, 60 s at 27 °C) × 35, and finally 10 min at 72 °C. A negative control amplification without RT was performed using TH primers to test genomic contamination of the CB RNA sample. Moreover, primers for several rabbit channel genes (Kv4.1, 4.2, and 4.3) were designed to encompass at least one intron present in the orthologous mouse and human genes. The specificity of the RT-PCR products was determined by sequencing (for Kv4.3-l), or by band size comparisons to PCR amplifications from the corresponding plasmid.

Immunocytochemistry methods

CB sections.

Two adult rabbits were anaesthetized with sodium pentobarbital (40 mg kg−1) and fixed by intracardiac perfusion of 4 % paraformaldehyde (PF) in phosphate buffer, pH 7.5. CBs were dissected and post-fixed for 2 h in the same fixative. After washing in PBS, the carotid bodies were dehydrated, embedded in paraffin, sectioned at 8 μm and then mounted on glass slides. The sections were deparaffinized in xylene, rehydrated in a series of ethanol solutions of decreasing strength, and washed in PBS containing 0.1 % Triton X-100 (PBTx). The sections were incubated for 30 min in blocking solution (PBTx, 10 mg ml−1 bovine serum albumin (BSA), 2 % normal goat serum (NGS)). Primary antibodies used in this study were: rabbit IgG polyclonal anti-Kv1.4, 3.4, 4.2 and 4.3 (Alomone labs); mouse monoclonal anti-Kv1.4 (Upstate Biotechnologies); mouse monoclonal anti-TH (Abcam); rabbit IgG polyclonal anti-glial fibrillary acid protein (GFAP; Sigma); and mouse monoclonal anti-neurofilament (Developmental Studies Hybridoma Bank). The primary antibodies were used at the concentrations recommended by the manufacturer. All incubations were performed at 20–25 °C unless noted otherwise. The sections were incubated with the primary antibody for 16–20 h, washed with PBTx, blocked again, and incubated with HRP-conjugated goat anti-rabbit (or anti-mouse) IgG antibodies (Jackson Immunoresearch) diluted to 1:200 in blocking solution, for 2 h. Following washes in PBTx, HRP labelling was developed with 0.2 mg ml−1 3, 3′-diaminobenzidine and 0.003 % H2O2. The sections were then dehydrated in a series of ethanol solutions of increasing strength, cleared in xylene and then mounted in Eukitt.

Immunofluorescence in CB cells.

CB cells plated onto glass coverslips were fixed with 2 % PF for 15 min at 20 °C, washed in PBTx, and blocked with PBTx-10 mg ml−1 BSA-2 % NGS for 10 min. Primary antibodies for the anti-Kv subunits, and other control antibodies, were diluted in blocking solution and incubated with the cells for 30 min. After washes in PBTx, cells were incubated with secondary antibodies for 30 min. The fluorescently labelled secondary antibodies used were: Alexa 488/597-conjugated goat anti-rabbit/mouse secondary antibodies (Molecular Probes), and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse (Jackson Immunoresearch). After being washed in PBS, the coverslips were mounted with Vectashield H-1000 (Vector Labs), and the cells were examined with the appropriate filters for immunofluorescence.

The anti-Kv antibodies were incubated in control experiments with the corresponding Kv peptide (10 μg −1ml) for 2 h before being added to the sections. In addition, control labelling of secondary antibodies was carried out to discard non-specific labelling.

In situ hybridization methods

Digoxigenin (DIG)-11-UTP-labelled RNA probes were synthesized according to the protocols for non-radioactively labelled riboprobes for in situ hybridization published by Roche Biochemicals (http://www.roche-applied-science.com/prod-inf/manuals/ InSitu/ InSi-toc.htm). We used the cDNA clones containing fragments of the rabbit TH and Kv4.1 genes as templates, and reagents from Promega. CB cells cultured on poly-l-lysine-coated coverslips were washed in PBS and fixed at room temperature for 30 min in 4 % formaldehyde, 5 % glacial acetic acid and 0.9 % NaCl. Following washes in PBS, the coverslips were incubated in hybridization solution (50 % deionized formamide, 4 × saline sodium citrate (SSC), 20 mm NaH2PO4, pH 7.4, 250 μg ml−1 yeast tRNA, 500 μg ml−1 boiled salmon sperm DNA, 0.1 % Tween-20, 1 × Denhardt's solution, 10 % dextran sulphate) at 57 °C, followed by incubation at 57 °C for 16 h in hybridization solution containing the DIG-labelled RNA probe at 1 μg ml−1. The cells were washed in a solution containing 50 % deionized formamide, 4 × SSC and 0.1 % Tween-20, and then in PBS containing 0.1 % Tween 20 (PBTw). We used an alkaline-phosphatase-conjugated anti-DIG antibody (1:1000 in PBTw-5 % NGS) to detect the DIG-labelled RNA and the colour reaction was achieved with nitro blue tetrazolium-bromochloroindolyl phosphate (NBT-BCIP, Roche). Following in situ hybridization, the cells were subjected to FITC immunofluorescence with the anti-TH antibody, and mounted in Vectashield H-1000. The hybridization protocol described here was developed from those reported by Ganfornina et al. (1995) and Buckler et al. (2000).

Immunocytochemistry and in situ hybridization results were examined with the aid of a Zeiss Axioscop microscope. Images were digitized with a CoolSnap CCD camera (Photometrics), and processed with Adobe Photoshop.

RESULTS

Expression of fast-inactivating K+ channels in rabbit CB

We tested the presence of each Kv transcript in the CB and other rabbit tissues using RT-PCR and unique primers designed from rabbit sequences. Figure 1 shows the results of these amplifications. The amplification of control transcripts, such as the ubiquitous ribosomal protein L18, and the chemoreceptor cell-specific enzyme TH yielded the expected bands (see Table 1) in these tissues. The negative control lane (-) shows amplification without the template. The rest of the ethidium bromide gels shows the amplification of each Kv transcript in the adult CB and frontal cortex (Cx). These results demonstrate the transcription of Kv1.4, 3.4, 4.1 and 4.3 in rabbit CB. The Kv4.3 gene presents two alternative splice variants that differ in the presence (or absence) of an exon that codes for a 19-amino-acid peptide inserted in the C-terminal part of the protein (Ohya et al. 1997). Using specific primers, we were able to demonstrate the transcription of the long form of Kv4.3 in rabbit CB (Fig. 1), while the two splice variants were detected in the Cx (not shown). No Kv3.3 or 4.2 transcripts were detected in the CB.

Figure 1.

Figure 1

Open in a new tab

Transcript detection of Kv subunits by RT-PCR in the rabbit carotid body (CB)

Control amplifications show the detection of an ubiquitous transcript (the ribosomal protein L18), and the enzyme tyrosine hydroxylase (TH) present in the CB. The frontal cortex (Cx) was included as positive control. Negative control lanes (-) refer to amplification in the absence of the template. Amplifications were generally performed with 2 mm Mg2+. l-Mg2+ indicates where amplification has been performed with 1 mm Mg2+.

Differential distribution of fast-inactivating K+ channels in rabbit CB

The presence of several Kv transcripts in the rabbit CB does not demonstrate their distribution in the individual cell types present in the organ. As we were interested in demonstrating the presence of particular Kv subunits in chemoreceptor cells, we analysed the cellular distribution of these channel subunits using immunocytochemistry and in situ hybridization.

The antibodies anti-Kv1.4,anti-Kv 3.4, anti-Kv4.2 and anti-Kv4.3 are available commercially (see Methods). However, these antibodies were raised against rat channel peptides. Although the peptides used to raise the sera were conserved in rabbit channel proteins, we tested for species cross-reaction by performing immunohistochemistry on cryostat sections of rabbit hippocampus and cortex. These experiments (not shown) revealed that the resulting labelling in rabbit tissue is similar to that shown in rat tissues (Veh et al. 1995; Cooper et al. 1998; Serodio & Rudy, 1998), and demonstrated the cross-reaction in rabbit.

We then assayed the expression of Kv in rabbit CB using HRP-immunocytochemistry in paraffin sections. These results are shown in Fig. 2. The control antibodies, anti-TH and anti-GFAP, labelled the CB chemoreceptor and sustentacular cells, respectively (Abramovici et al. 1991; Wang et al. 1991; Chou et al. 1998). Both cell types are located in the CB glomeruli (arrows in Fig. 2A and B). The anti-neurofilament antibody revealed the autonomic nerve fibres that innervate chemoreceptor cells (arrowheads in Fig. 2C). The negative control antibody labelling (Fig. 2D) showed the background staining produced by the secondary antibody. Kv1.4 was expressed in nerve terminals (arrowheads in Fig. 2E), while the anti-Kv3.4 and anti-Kv4.3 antibody labelling demonstrated the presence of these subunits in cells of the CB glomeruli (arrows in Fig. 2F and G). The anti-Kv4.2 antibody failed to exhibit any specific labelling (Fig. 2H), confirming the absence of this Kv subunit in CB cells.

Figure 2.

Figure 2

Open in a new tab

HRP immunocytochemistry in paraffin sections of rabbit CB

A-C, labelling with control antibodies that detect the chemoreceptor-cell-specific enzyme TH (A, arrows), the sustentacular-cell-specific glial fibrillary acidic protein (GFAP; B, arrows), and the neurofilament protein (NF) present in nerve terminals (C, arrowheads). D, negative control labelling with HRP-conjugated secondary antibody. E-H, immunolocalization of Kv subunits. Nerve terminals express Kv1.4 (arrowheads in E). CB glomeruli appear labelled with anti-Kv3.4 and anti-Kv4.3 antibodies (arrows in F, G). Kv4.2 is not expressed in rabbit CB (H).

These results illustrate the presence of specific Kv subunits in CB glomeruli, but do not prove that they are expressed by chemoreceptor cells. We thus performed double-immunocytochemistry in cultured rabbit CB cells with each of the anti-Kv antibodies, and the anti-TH antibody as a marker for chemoreceptor cells. Figure 3 shows the results of these experiments. Kv3.4 was clearly present in chemoreceptor cells (arrows in Fig. 3A and B), and was also expressed by TH-negative cells (arrowheads in Fig. 3A), some with the morphological appearance of muscle fibres (open arrowhead in Fig. 3A). However, there were TH-positive cells that lacked Kv3.4 labelling (asterisk in Fig. 3B). Kv4.3 was present in TH-positive chemoreceptor cells (arrows in Fig. C and D), and was also seen in a small number of TH-negative cells (not shown in this figure, but see Fig. 7A). Kv1.4 and 4.2 were not expressed in chemoreceptor cells (not shown). We proved the specificity of the anti-Kv antibodies used in these fluorescence labelling experiments using peptide preabsorption, as described in Methods (results not shown).

Figure 3.

Figure 3

Open in a new tab

Immunofluorescence double-labelling of cultured rabbit CB cells

A and B, colocalization of Kv3.4 and TH in chemoreceptor cells (arrows). A number of CB cells are uniquely Kv3.4-positive (arrowheads in A), some with a smooth muscle morphology (open arrowhead in A). Some chemoreceptor cells (asterisk in B) do not express Kv3.4. C and D, colocalization of Kv4.3 and TH in chemoreceptor cells.

Figure 7.

Figure 7

Open in a new tab

Correlations between the expression of Kv3.4, Kv4.3, myosin and TH, and the sensitivity to low PO 2 of dispersed CB cells

All panels show the time course of changes in [Ca2+]i elicited by the sequential application of 35 mm K+ and hypoxia in representative cells exhibiting the immunolabelling pattern depicted in the corresponding pictures. Stimuli application is marked by the horizontal open rectangles. PO2 was measured in all cases throughout the experiment, but is shown only for data presented in F. Cells were double-labelled with antibodies anti-TH and either anti-Kv4.3 (A, D), anti-Kv3.4 (B, E, F) or anti-myosin.

Given the unavailability of anti-Kv4.1 antibodies, we studied its distribution in CB cell types by in situ hybridization. Using a Kv4.1 riboprobe, we checked the presence of the Kv4.1 transcript in cultured rabbit CB cells. We used a TH riboprobe in control experiments, in which the hybridization technique on dissociated CB cells was tested. In these experiments we were able to identify TH-expressing chemoreceptor cells (arrows in Fig. 4A), while other cells appeared to be unlabelled (arrowhead in Fig. 4A). We also demonstrated the identity of chemoreceptor cells by colocalization of the TH protein by immunofluorescence (arrows in Fig. 4B). The Kv4.1 mRNA was detected in a number of CB cells (arrows in Fig. 4C), but was absent in others (arrowheads in Fig. 4C). This result, along with the restricted labelling obtained with the TH riboprobe, made unnecessary the use of sense strand riboprobes as a negative control. Some Kv4.1-positive CB cells (e.g. white arrow in Fig. 4C) presented a clear chemoreceptor cell morphology (Pérez-García et al. 1992). Using the Kv4.1 riboprobe and double immunofluorescence with antibodies against TH and other Kv subunits, we were able to demonstrate the coexpression of Kv4.1 and 4.3 in TH-positive chemoreceptor cells (arrows in Fig. 4D–F). The arrowheads in Fig. 4D point to non-chemoreceptor cells expressing Kv4.1. Likewise, using the anti-Kv3.4 antibody we were able to detect CB chemoreceptor cells that coexpressed this subunit with Kv4.1 (arrows in Fig. 4G–I). However, there were chemoreceptor cells that expressed Kv4.1, but did not express Kv3.4 (examples indicated by arrowheads in Fig. 4G–I).

Figure 4.

Figure 4

Open in a new tab

Pattern of expression of Kv4.1 in the CB, as revealed by in situ hybridization in cultured cells, and colocalization with other Kv subunits

A and B, control experiments showing colocalization of the TH transcript, as revealed by in situ hybridization (A), and protein, as revealed by immunofluorescence (B), in chemoreceptor cells (arrows). C, in situ hybridization of cultured CB cells with Kv4.1 riboprobe. Arrows indicate Kv4.1-positive cells. D-F, colocalization of the Kv4.1 transcript (D), TH protein (E) and the Kv4.3 subunit (F) in CB chemoreceptor cells (examples indicated by arrows). A number of Kv4.1-positive cells are not chemoreceptor cells (arrowheads). G-I, colocalization of Kv4.1 mRNA in a population of CB cells expressing Kv3.4. Chemoreceptor cells (indicated by arrows) expressing Kv4.1 (G) and TH (H), also exhibit Kv3.4 labelling (I). A population of chemoreceptor cells express Kv4.1 (arrowheads in G and H), but do not express Kv3.4 (arrowheads in I).

In summary, rabbit CB chemoreceptor cells express Kv3.4, 4.1 and 4.3. Furthermore, Kv3.4 appears to be expressed heterogeneously in a population of chemoreceptor cells.

Pharmacological demonstration of the contribution of Kv3.4 and Kv4 subunits to the fast-inactivating outward currents of chemoreceptor cells

To test the contribution of particular Kv subunits to the outward currents elicited by depolarizing pulses in CB chemoreceptor cells, we studied the effect on these currents of two toxins that have been reported to block the Kv3.4 and the Kv4 subunits. The sea anemone peptide BDS-I has been reported to block specifically the K+ channels formed by Kv3.4 subunits (Diochot et al. 1998). The blockade of Kv3.4 by BDS-I is complete at concentrations above 1 μM, and can be reverted upon washout of the toxin (Diochot et al. 1998). The application of 2.5 μM BDS-I produced a reversible decrease in the peak current amplitude of the fast-inactivating K+ current of CB chemoreceptor cells (Fig. 5A), averaging a reduction of 21.02 ± 2.8 % in five of the cells studied. The outward current affected by BDS-I showed fast inactivation with a time constant (16.98 ± 3.03 ms) that is within the range described for Kv3.4 in other preparations (Coetzee et al. 1999). The effect of BDS-I was observed in five out of seven cells tested, which agrees with the heterogeneous presence of the Kv3.4 subunit in CB chemoreceptor cells, as discussed earlier.

Figure 5.

Figure 5

Open in a new tab

Effect on outward currents of blockade of Kv3.4 and Kv4 subunits

A, peak current plot of outward currents recorded in CB chemoreceptor cells after application of depolarizing steps to +40 mV every 20 s. The bath application of the BDS-I toxin reversibly decreases the peak current. The upper right panel shows representative recordings made under different experimental conditions, and the subtracted recording of control/toxin currents. The lower right panel shows the plot of the average (mean ± s.e.m.) percent inhibition, and time course (τ) of the subtracted current. B, the upper panel plots the average inhibition of outward currents after bath application of heteropodatoxin (HpTx-2). The lower panel shows representative recordings of chemoreceptor outward currents. In this case, transient outward currents were elicited (under control and toxin application conditions) by depolarizing steps to +40 mV following 10 s prepulses to two different potentials, −80 mV (to obtain the fully primed current) and 0 mV (to inactivate the transient component). The fast-inactivating current was defined as the difference between the currents elicited by the two pulses.

The spider venom toxin HpTx-2 has been reported to block the Kv4.2 subunit (Sanguinetti et al. 1997), but other researchers have suggested that it could also block other members of the Kv4 subfamily (Brahmajothi et al. 1999). When applied to CB chemoreceptor cells, this toxin produced an average 19.51 ± 7.2 % decrease in the outward K+ current (Fig. 5B). Taken together, these results confirm our previous findings proving the existence of Kv3.4 and Kv4 subunits in CB chemoreceptor cells. In addition, the consistent reduction in the fast-inactivating K+ current following the application of HpTx-2, along with the presence of Kv4.1 and Kv4.3, but not Kv4.2, demonstrates that this toxin can also block other members of the Kv4 subfamily.

Immunological blockade of fast-inactivating K+ currents in rabbit CB chemoreceptor cells

To further demonstrate that Kv3.4 and Kv4.3 subunits are the molecular substrate for the fast-inactivating outward currents in CB chemoreceptor cells, we assayed the efficiency of the anti-Kv antibodies used in the immunocytochemical study to block this outward current component. Whole-cell voltage-clamp experiments were performed with anti-Kv1.4, anti-Kv3.4, anti-Kv4.2 or anti-Kv4.3 antibodies delivered to the cell by dialysis through the patch pipette. Fig. 6A shows representative traces obtained from CB chemoreceptor cells with the voltage protocol described in Methods, in the presence of anti-Kv1.4, anti-Kv3.4 or anti-Kv4.3 antibodies. The thick traces of each example were obtained upon breaking into the whole-cell configuration. Within 10 min of recording (thin traces), dialysis of the anti-Kv1.4 antibody did not change the current amplitude. However, the anti-Kv3.4 and anti-Kv4.3 antibodies decreased irreversibly the initial current (Fig. 6A–C). Recordings made in the presence of antibodies for as long as 30 min did not increase significantly the observed inhibition. To estimate the effects of the different antibodies, we measured the peak current amplitude at 10 min of recording (I), plotting the results as I/I0, where I0 is the peak current amplitude at the beginning of the recording. The average effects of the antibodies applied in this study are shown in Fig. 6D. Only the anti-Kv3.4 and anti-4.3 antibodies produced a significant reduction in I/I0, indicating that the Kv3.4 and Kv4.3 subunits form the channels that contribute to the fast-inactivating K+ current in CB chemoreceptor cells. Control cells were recorded either in the absence of antibody in the pipette solution or in the presence of a goat anti-mouse serum, to exclude non-specific effects.

The immunological blockade of K+ channels is a powerful tool with which to assay the role of a particular channel subunit under a variety of physiological conditions. In the context of O2 chemoreception, this approach has been used recently to demonstrate the oxygen-sensitivity of Kv1.2 in PC12 cells (Conforti et al. 2000). The blocking effects of the antibodies used in our study above prompted us to test the effect of hypoxia on the K+ current while a particular Kv subunit is perturbed. Preliminary experiments showed that hypoxia could still decrease the remaining K+ current in a significant manner after blocking Kv-subunit-specific components of the overall current by any antibody addition (results not shown). The lack of an estimation of the affinity of each antibody, along with the absence of an anti-Kv4.1 antibody, currently prevent us from gathering conclusive results about the quantitative participation of each Kv subunit in the chemoreceptor response to low O2.

Relationship of Kv3.4 and Kv4.3 expression and hypoxic activation of CB chemoreceptor cells

The results described so far clearly demonstrate the expression of several fast-inactivating Kv subunits in rabbit CB cells. The possible correlation between their expression and the response of chemoreceptor cells to hypoxia was investigated by measuring [Ca2+]i as an indicator of cell activation (Fig. 7). When dispersed CB cells were subsequently stimulated with high K+ and hypoxia, two clearly different patterns of responses were seen (Fig. 7, left vs. right panels). These patterns correlated with the presence or absence of TH. TH-negative cells (Fig. 7A–C) showed a transient response to high K+ and were not sensitive to hypoxia. Conversely, TH-positive cells (Fig. 7D–F) presented a more sustained response to high K+ and, as expected, were sensitive to hypoxia. Some TH-negative cells were labelled with antibodies anti-Kv4.3 (Fig. 7A), anti-Kv3.4 (Fig. 7B) or anti-myosin (Fig. 7C). The similar response to high K+ in the three cases suggests that the TH-negative cells expressing Kv4.3 or Kv3.4 could be smooth muscle cells. As was shown earlier, TH-positive cells were also labelled with antibodies anti-Kv4.3 (Fig. 7D) and anti-Kv3.4 (Fig. 7E), although there were TH-positive and oxygen-sensitive cells that did not express Kv3.4 channels (Fig. 7F). These results demonstrate the presence of Kv4.3 and Kv3.4 channels in chemoreceptor cells, and suggest that the expression of Kv3.4 is not necessary to confer hypoxic sensitivity.

DISCUSSION

The results presented in this report identify the channel subunits that contribute to the oxygen-sensitive K+ current of rabbit CB chemoreceptor cells. The role of fast-inactivating K+ channels in the hypoxic response displayed by these cells has been demonstrated previously (Ganfornina & López-Barneo, 1991). Although a number of regulatory channel subunits have been reported to modify delayed-rectifier K+ channels to become fast inactivating (Rettig et al. 1994; Heinemann et al. 1996), we first tested the presence of autonomously fast-inactivating K+ channel subunits in CB cells. The use of RT-PCR, immunocytochemistry, in situ hybridization and [Ca2+]i measurements confirmed the expression in chemoreceptor cells of three fast-inactivating Kv subunits: Kv3.4, Kv4.1 and Kv4.3. No Kv3.3 or Kv4.2 transcription was detected in the CB, while the Kv1.4 subunit was present only in nerve terminals in the CB. With the exception of Kv4.1, for which there is no antibody available, we have demonstrated the expression of Kv subunits at both the mRNA and protein levels.

Rabbit chemoreceptor cells express a particular splice variant of Kv4.3 that bears a 19-amino-acid insertion in the C-terminal side of the subunit (Ohya et al. 1997). This so-called ‘long form’ variant (Kv4.3-l) is more abundant in most of the tissues that have been studied, while the short form is prevalent in brain. The study of the two isoforms expressed in heterologous expression systems yielded currents with similar kinetic properties (Dilks et al. 1999; Calmels et al. 2001; Po et al. 2001). The peptide insertion of the long-form variant shows a consensus sequence for protein kinase C phosphorylation, although its functional significance remains to be elucidated.

Three different splice variants showing differences in the C-terminal cytoplasmic tail of the subunit have been reported in mouse Kv3.4 (reviewed by Rudy & McBain, 2001). In addition, a new isoform has been found that lacks the conserved sequence motifs of the N-terminal cytoplasmic domain responsible for the Kv3.4 tetramerization and inactivation kinetics (Vullhorst et al. 2001). Although the primers designed to amplify Kv3.4 in CB chemoreceptor cells could not distinguish the differential expression of particular C-terminal isoforms, our results showing the pharmacological blockade of the fast-inactivating component of the K+ current suggest that CB chemoreceptor cells do not express the N-terminal-specific isoform.

Electrophysiological and pharmacological experiments suggest the expression of inwardly rectifying ERG-like channels in rabbit CB chemoreceptor cells (Overholt et al. 2000). In that study, a role for fast-inactivating ERG-like channels in the regulation of resting membrane potential (RMP) of glomus cells was proposed. The role of these channels in O2 sensing, however, awaits confirmation. Moreover, the kinetic properties of ERG channels can not account for the hypoxic response elicited by the electrophysiological protocols used in our studies.

Similarly, some members of the Kv1 subfamily are known to produce fast-inactivating K+ currents due to their interaction with regulatory β subunits. Our results using subunit-specific toxins suggest that, in agreement with our previous report using transgenic expression of dominant-negative channels (Pérez-García et al. 2000), it is unlikely that Kv1 subunits are contributing to the fast-inactivating current of CB chemoreceptor cells. The application of BDS-I at the concentration used in our experiments is expected to block fully the current generated by the Kv3.4 subunit (Diochot et al. 1998), which accounts for about 20 % of the total K+ current of CB chemoreceptor cells. Also, the concentration of HpTx-2 and voltage protocol used in our work have been reported to block 20–30 % of the Kv4.2 current (Sanguinetti et al. 1997; Bernard et al. 2000). Since this is the blocking effect obtained in our experiments, the application of a saturating (full blockade) concentration of HpTx-2 and BDS-I should block most, if not all, of the fast-inactivating K+ current of CB chemoreceptor cells.

Although Kv4.1 and 4.3 are also expressed in non-chemosensitive CB cell types, we found that both subunits colocalize in chemoreceptor cells. The coexpression of different Kv4 subunits, either the three known subunits or paired combinations of them, has been reported in a number of cells (Song et al. 1998; Tkatch et al. 2000). Kv4.1 and Kv4.3 coexpression in CB chemoreceptor cells suggests that these subunits could assemble into a heteromultimer, as has been demonstrated for other Kv subunits (reviewed by Coetzee et al. 1999).

An intriguing result obtained in our study is the apparent heterogeneity of expression of the Kv3.4 subunit. Roughly 40 % of the chemoreceptor cells show a high expression of Kv3.4, although low levels of expression that are beneath the detection threshold for the antibodies used cannot be excluded. Thus, our data suggest the existence of a distinct population of chemoreceptor cells harbouring the Kv3.4 subunit. Different populations of CB chemoreceptor cells have been proposed based on the content of dopamine and noradrenaline, and their biosynthetic enzymes (reviewed by Verna, 1997). In addition, some differences in electrical properties such as the magnitude of the calcium-activated K+ current and the fast-inactivating component of the K+ current have been described in rabbit chemoreceptor cells (Pérez-García et al. 1992). Although the significance of this heterogeneity is not clear, our results showing the presence of Kv3.4 in a subset of chemoreceptor cells supports the existence of two different populations of oxygen-sensitive cells in the CB. The presence of Kv3.4 could account for the differences in the magnitude of the fast-inactivating K+ current of chemoreceptor cells (Pérez-García et al. 1992).

The existence of three fast-inactivating Kv subunits contrasts with the electrophysiological results of single-channel recordings (Ganfornina & López-Barneo, 1991, 1992b), which described a single-channel species displaying fast inactivation and O2 sensitivity in rabbit chemoreceptor cells. Although the oxygen-sensitive K+ channel has a conductance compatible with that of the Kv3.4 subunit, its activation threshold and time constant of inactivation resemble better those of the Kv4 subfamily (Coetzee et al. 1999). Moreover, the Kv4.1 and Kv4.3 subunits could assemble into a heteromultimer and form a single Kv4 channel, although in the absence of co-immunoprecipitation experiments we must treat this inference with caution because different Kv subunits could be targeted to different cell compartments, as has been shown in Schwann cells (Mi et al. 1995).

Another point of disagreement raised by the electrophysiological data is the almost complete block of the K+ current by high concentrations of external TEA (Ureña et al. 1989; López-López et al. 1993). It is well established that Kv3 currents are highly sensitive to low concentrations of TEA (Rudy & McBain, 2001), while Kv4 currents are not blocked at high TEA concentrations (Coetzee et al. 1999). According to this, chemoreceptor cells should lack Kv4 subunits, which is certainly not the case based on the results presented in our work and those reported using dominant-negative subunits of Kv4 (Pérez-García et al. 2000). Further experiments are needed to solve these contradictory results, although the expression of regulatory subunits in chemoreceptor cells could modify the sensitivity of Kv4 to TEA (Sesti et al. 2000).

What is the role of Kv3 and Kv4 subunits on the excitability of CB chemoreceptor cells and its modulation by O2? The effect of hypoxia on rabbit CB chemoreceptor cells has been proposed to be mediated by a depolarizing shift in the RMP, which leads to Ca2+ entry and neurotransmitter release (reviewed by Gonzalez et al. 1994). The activation threshold of Kv4 subunits (around −50 mV) makes them good candidates for controlling the RMP. Data suggesting a role for Kv4 channels to fix the RMP in rabbit CB chemoreceptor cells come from the effect of adenoviral infection with a dominant-negative form of Kv4 (Pérez-García et al. 2000). This transgenic strategy induces an effective depolarization in the infected cells, and makes them unresponsive to low PO2. These data, and their physiological implications, are strengthened by the ubiquitous expression of Kv4 subunits in chemoreceptor cells reported in this work.

The expression of Kv3 channel subunits enables excitable cells to achieve fast repolarization of action potentials (reviewed by Rudy & McBain, 2001), which in turn permits the repetitive firing of action potentials at high frequency. CB chemoreceptor cells are known to fire action potentials at a frequency that increases with exposure to low PO2 (López-López et al. 1989). The expression of Kv3.4 could be involved in amplifying the hypoxic signal by increasing the firing frequency upon depolarization by low PO2. However, an effect of hypoxia on this particular Kv subunit is hard to reconcile with the accumulated data and the most accepted model of chemotransduction process in the rabbit CB (Gonzalez et al. 1994). An oxygen-dependent blockade of the Kv3.4 subunit should result in a prolonged spike repolarization, which in turn would decrease firing frequency. Thus, all of the evidence gathered so far suggests that Kv3.4 is not the oxygen-sensitive channel component of the chemoreception cascade. This is supported further by our results showing that the presence of Kv3.4 is not necessary for a chemoreceptor cell to respond to low PO2 with an increase in [Ca2+]i. Instead, we propose that Kv3 subunits would play a modulatory role in chemoreceptor cell excitability. This proposition holds unless ancillary subunits could modify the Kv3 kinetic properties to contribute to setting of the RMP, as has been reported for the MiRP2 subunit in skeletal muscle cells (Abbott et al. 2001).

In summary, the rabbit CB chemoreceptor cells express three Kv subunits (Kv3.4, Kv4.1 and Kv4.3), which underlie the fast-inactivating K+ current that is modified by low PO2. Although the present work does not pinpoint a particular Kv subunit as the sole factor responsible for the hypoxic effect observed in CB, it definitely restricts the number of molecular players to study the specific effect of low PO2 on channel activity. Moreover, several of the discussed features of the expression and electrical properties of the identified subunits, as well as our previous results using dominant-negative mutations of Kv subunits (Pérez-García et al. 2000), suggest that Kv4.1, Kv4.3, or their heteromultimers, may form the oxygen-sensitive K+ channel of rabbit CB chemoreceptor cells. Obviously, we do not imply that Kv4 subunits form per se an O2 sensor. In fact, a large number of K+ channels have been reported to be sensitive to low PO2 (Pérez-García & López-López, 2000; López-Barneo et al. 2001; Patel & Honore, 2001), which makes the existence of a particular oxygen-sensitive structural domain in the Kv subunits rather implausible. Instead, our results suggest that O2 sensitivity requires either the specific expression of the molecular O2 sensor in chemoreceptive cells, or the coincidence of the O2 sensor with an intermediary regulatory subunit whose interaction with the pore-forming subunit mediates the change in excitability. In this regard, several auxiliary subunits, such as β subunits (Chabala et al. 1993), calcium-sensing proteins (An et al. 2000) and MiRP1 (Zhang et al. 2001) have been reported to modify Kv4 electrical properties, and even the sensitivity to O2 of a particular Kv4 subunit (Pérez-García et al. 1999).

The results gathered in the present work definitely opens interesting avenues to explore the molecular mechanisms underlying the increase in the excitability of CB chemoreceptor cells upon a decrease in environmental O2.

Acknowledgments

We would like to thank María Llanos for technical assistance, J. L. Rae for the gift of Kv4.3-l clone and NPS Pharmaceuticals for the HpTx-2 sample. We are also grateful to the DNA Sequencing Facility of the CIB. D.S. was supported by a visiting scholarship from Iberdrola. This work was supported by Spanish DGICYT Grants BFI2001/1713 to C.G., and BFI2001-1691 to J.R.L.L. and a VA001/01 grant from the Junta de Castilla y León to M.T.P.G.

REFERENCES

  1. Abbott GW, Butler MH, Bendahhou S, Dalakas MC, Ptacek LJ, Goldstein SA. MiRP2 forms potassium channels in skeletal muscle with Kv3. 4 and is associated with periodic paralysis. Cell. 2001;104:217–231. doi: 10.1016/s0092-8674(01)00207-0. [DOI] [PubMed] [Google Scholar]
  2. Abramovici A, Pallot DJ, Polak JM. Immunohistochemical approach to the study of the cat carotid body. Acta Anatomica. 1991;140:70–74. doi: 10.1159/000147039. [DOI] [PubMed] [Google Scholar]
  3. An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendoza G, Hinson JW, Mattsson KI, Strassle BW, Trimmer JS, Rhodes KJ. Modulation of A-type potassium channels by a family of calcium sensors. Nature. 2000;403:553–556. doi: 10.1038/35000592. [DOI] [PubMed] [Google Scholar]
  4. Barry DM, Nerbonne JM. Myocardial potassium channels: electrophysiological and molecular diversity. Annual Review of Physiology. 1996;58:363–394. doi: 10.1146/annurev.ph.58.030196.002051. [DOI] [PubMed] [Google Scholar]
  5. Bernard C, Legros C, Ferrat G, Bischoff U, Marquardt A, Pongs O, Darbon H. Solution structure of hpTX2, a toxin from Heteropoda venatoria spider that blocks Kv4. 2 potassium channel. Protein Science. 2000;9:2059–2067. [PMC free article] [PubMed] [Google Scholar]
  6. Brahmajothi MV, Campbell DL, Rasmusson RL, Morales MJ, Trimmer JS, Nerbonne JM, Strauss HC. Distinct transient outward potassium current (Ito). phenotypes and distribution of fast-inactivating potassium channel alpha subunits in ferret left ventricular myocytes. Journal of General Physiology. 1999;113:581–600. doi: 10.1085/jgp.113.4.581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Buckler KJ, Williams BA, Honore E. An oxygen-, acid- and anaesthetic-sensitive TASK-like background potassium channel in rat arterial chemoreceptor cells. Journal of Physiology. 2000;525:135–142. doi: 10.1111/j.1469-7793.2000.00135.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Calmels TP, Faivre JF, Cheval B, Javre JL, Rouanet S, Bril A. hKv4. 3 channel characterization and regulation by calcium channel antagonists. Biochemistry and Biophysical Research Communications. 2001;281:452–460. doi: 10.1006/bbrc.2001.4396. [DOI] [PubMed] [Google Scholar]
  9. Chabala LD, Bakry N, Covarrubias M. Low molecular weight poly(A)+ mRNA species encode factors that modulate gating of a non-Shaker A-type K+ channel. Journal of General Physiology. 1993;102:713–728. doi: 10.1085/jgp.102.4.713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chou CL, Sham JS, Schofield B, Shirahata M. Electrophysiological and immunocytological demonstration of cell-type specific responses to hypoxia in the adult cat carotid body. Brain Research. 1998;789:229–238. doi: 10.1016/s0006-8993(97)01472-8. [DOI] [PubMed] [Google Scholar]
  11. Coetzee WA, Amarillo Y, Chiu J, Chow A, Lau D, McCormack T, Moreno H, Nadal MS, Ozaita A, Pountney D, Saganich M, Vega-Saenz DM, Rudy B. Molecular diversity of K+ channels. Annals of the New York Academy of Sciences. 1999;868:233–285. doi: 10.1111/j.1749-6632.1999.tb11293.x. [DOI] [PubMed] [Google Scholar]
  12. Conforti L, Bodi I, Nisbet JW, Millhorn DE. O2-sensitive K+ channels: role of the Kv1. 2-subunit in mediating the hypoxic response. Journal of Physiology. 2000;524:783–793. doi: 10.1111/j.1469-7793.2000.00783.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cooper EC, Milroy A, Jan YN, Jan LY, Lowenstein DH. Presynaptic localization of Kv1. 4-containing A-type potassium channels near excitatory synapses in the hippocampus. Journal of Neuroscience. 1998;18:965–974. doi: 10.1523/JNEUROSCI.18-03-00965.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dilks D, Ling HP, Cockett M, Sokol P, Numann R. Cloning and expression of the human kv4. 3 potassium channel. Journal of Neurophysiology. 1999;81:1974–1977. doi: 10.1152/jn.1999.81.4.1974. [DOI] [PubMed] [Google Scholar]
  15. Diochot S, Schweitz H, Beress L, Lazdunski M. Sea anemone peptides with a specific blocking activity against the fast inactivating potassium channel Kv3. 4. Journal of Biological Chemistry. 1998;273:6744–6749. doi: 10.1074/jbc.273.12.6744. [DOI] [PubMed] [Google Scholar]
  16. Ganfornina MD, LÓPEZ-barneo J. Single K+ channels in membrane patches of arterial chemoreceptor cells are modulated by O2 tension. Proceedings of the National Academy of Sciences of the USA. 1991;88:2927–2930. doi: 10.1073/pnas.88.7.2927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ganfornina MD, LÓPEZ-barneo J. Potassium channel types in arterial chemoreceptor cells and their selective modulation by oxygen. Journal of General Physiology. 1992a;100:401–426. doi: 10.1085/jgp.100.3.401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ganfornina MD, LÓPEZ-barneo J. Gating of O2-sensitive K+ channels of arterial chemoreceptor cells and kinetic modifications induced by low PO2. Journal of General Physiology. 1992b;100:427–455. doi: 10.1085/jgp.100.3.427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ganfornina MD, Sanchez D, Bastiani MJ. Lazarillo, a new GPI-linked surface lipocalin, is restricted to a subset of neurons in the grasshopper embryo. Development. 1995;121:123–134. doi: 10.1242/dev.121.1.123. [DOI] [PubMed] [Google Scholar]
  20. Gonzalez C, Almaraz L, Obeso A, Rigual R. Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiological Reviews. 1994;74:829–898. doi: 10.1152/physrev.1994.74.4.829. [DOI] [PubMed] [Google Scholar]
  21. Heinemann SH, Rettig J, Graack HR, Pongs O. Functional characterization of Kv channel beta-subunits from rat brain. Journal of Physiology. 1996;493:625–633. doi: 10.1113/jphysiol.1996.sp021409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. LÓPEZ-barneo J, LÓPEZ-lópez JR, Ureña J, Gonzalez C. Chemotransduction in the carotid body: K+ current modulated by PO2 in type I chemoreceptor cells. Science. 1988;241:580–582. doi: 10.1126/science.2456613. [DOI] [PubMed] [Google Scholar]
  23. LÓPEZ-barneo J, Pardal R, Ortega-saenz P. Cellular mechanism of oxygen sensing. Annual Review of Physiology. 2001;63:259–287. doi: 10.1146/annurev.physiol.63.1.259. [DOI] [PubMed] [Google Scholar]
  24. LÓPEZ-lópez JR, De Luis DA, Gonzalez C. Properties of a transient K+ current in chemoreceptor cells of rabbit carotid body. Journal of Physiology. 1993;460:15–32. doi: 10.1113/jphysiol.1993.sp019456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. LÓPEZ-lópez JR, Gonzalez C, PÉREZ-García MT. Properties of ionic currents from isolated adult rat carotid body chemoreceptor cells: effect of hypoxia. Journal of Physiology. 1997;499:429–441. doi: 10.1113/jphysiol.1997.sp021939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. LÓPEZ-lópez JR, Gonzalez C, Ureña J, LÓPEZ-barneo J. Low PO2 selectively inhibits K channel activity in chemoreceptor cells of the mammalian carotid body. Journal of General Physiology. 1989;93:1001–1015. doi: 10.1085/jgp.93.5.1001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mi H, Deerinck TJ, Ellisman MH, Schwarz TL. Differential distribution of closely related potassium channels in rat Schwann cells. Journal of Neuroscience. 1995;15:3761–3774. doi: 10.1523/JNEUROSCI.15-05-03761.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Ohya S, Tanaka M, Oku T, Asai Y, Watanabe M, Giles WR, Imaizumi Y. Molecular cloning and tissue distribution of an alternatively spliced variant of an A-type K+ channel α-subunit, Kv4. 3 in the rat. FEBS Letters. 1997;420:47–53. doi: 10.1016/s0014-5793(97)01483-x. [DOI] [PubMed] [Google Scholar]
  29. Overholt JL, Ficker E, Yang T, Shams H, Bright GR, Prabhakar NR. HERG-Like potassium current regulates the resting membrane potential in glomus cells of the rabbit carotid body. Journal of Neurophysiology. 2000;83:1150–1157. doi: 10.1152/jn.2000.83.3.1150. [DOI] [PubMed] [Google Scholar]
  30. Patel AJ, Honore E. Molecular physiology of oxygen-sensitive potassium channels. European Respiratory Journal. 2001;18:221–227. doi: 10.1183/09031936.01.00204001. [DOI] [PubMed] [Google Scholar]
  31. PÉREZ-García MT, LÓPEZ-LÓPEz JR. Are Kv channels the essence of O2 sensing? Circulation Research. 2000;86:490–491. doi: 10.1161/01.res.86.5.490. [DOI] [PubMed] [Google Scholar]
  32. PÉREZ-García MT, LÓPEZ-LÓPEz JR, Riesco AM, Hoppe UC, Marban E, Gonzalez C, Johns DC. Viral gene transfer of dominant-negative Kv4 construct suppresses an O2- sensitive K+ current in chemoreceptor cells. Journal of Neuroscience. 2000;20:5689–5695. doi: 10.1523/JNEUROSCI.20-15-05689.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. PÉREZ-García MT, Obeso A, LÓPEZ-LÓPEz JR, Herreros B, Gonzalez C. Characterization of cultured chemoreceptor cells dissociated from adult rabbit carotid body. American journal of Physiology. Lung Cellular and Molecular Physiology. 1992;263:C1152–1159. doi: 10.1152/ajpcell.1992.263.6.C1152. [DOI] [PubMed] [Google Scholar]
  34. Po SS, Wu RC, Juang GJ, Kong W, Tomaselli GF. Mechanism of alpha -adrenergic regulation of expressed hKv4. 3 currents. American Journal of Physiology — Heart and Circulatory Physiology. 2001;281:H2518–2527. doi: 10.1152/ajpheart.2001.281.6.H2518. [DOI] [PubMed] [Google Scholar]
  35. Rae JL, Shepard AR. Kv3. 3 potassium channels in lens epithelium and corneal endothelium. Experimental Eye Research. 2000;70:339–348. doi: 10.1006/exer.1999.0796. [DOI] [PubMed] [Google Scholar]
  36. Rettig J, Heinemann SH, Wunder F, Lorra C, Parcej DN, Dolly JO, Pongs O. Inactivation properties of voltage-gated K+ channels altered by presence of beta-subunit. Nature. 1994;369:289–294. doi: 10.1038/369289a0. [DOI] [PubMed] [Google Scholar]
  37. Rose TM, Schultz ER, Henikoff JG, Pietrokovski S, McCallum CM, Henikoff S. Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences. Nucleic Acids Research. 1998;26:1628–1635. doi: 10.1093/nar/26.7.1628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rudy B, McBain CJ. Kv3 channels: voltage-gated K+ channels designed for high-frequency repetitive firing. Trends in Neuroscience. 2001;24:517–526. doi: 10.1016/s0166-2236(00)01892-0. [DOI] [PubMed] [Google Scholar]
  39. Sanguinetti MC, Johnson JH, Hammerland LG, Kelbaugh PR, Volkmann RA, Saccomano NA, Mueller AL. Heteropodatoxins: peptides isolated from spider venom that block Kv4. 2 potassium channels. Molecular Pharmacology. 1997;51:491–498. [PubMed] [Google Scholar]
  40. Serodio P, Rudy B. Differential expression of Kv4 K+ channel subunits mediating subthreshold transient K+ (A-type). currents in rat brain. Journal of Neurophysiology. 1998;79:1081–1091. doi: 10.1152/jn.1998.79.2.1081. [DOI] [PubMed] [Google Scholar]
  41. Sesti F, Tai KK, Goldstein SAN. MinK endows the IKs potassium channel pore with sensitivity to internal tetraethylammonium. Biophysical Journal. 2000;79:1369–1378. doi: 10.1016/S0006-3495(00)76389-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Song WJ, Tkatch T, Baranauskas G, Ichinohe N, Kitai ST, Surmeier DJ. Somatodendritic depolarization-activated potassium currents in rat neostriatal cholinergic interneurons are predominantly of the A type and attributable to coexpression of Kv4. 2 and Kv4.1 subunits. Journal of Neuroscience. 1998;18:3124–3137. doi: 10.1523/JNEUROSCI.18-09-03124.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tkatch T, Baranauskas G, Surmeier DJ. Kv4. 2 mRNA abundance and A-type K+ current amplitude are linearly related in basal ganglia and basal forebrain neurons. Journal of Neuroscience. 2000;20:579–588. doi: 10.1523/JNEUROSCI.20-02-00579.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Ureña J, LÓPEZ-LÓPEz J, Gonzalez C, LÓPEZ-barneo J. Ionic currents in dispersed chemoreceptor cells of the mammalian carotid body. Journal of General Physiology. 1989;93:979–999. doi: 10.1085/jgp.93.5.979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Veh RW, Lichtinghagen R, Sewing S, Wunder F, Grumbach IM, Pongs O. Immunohistochemical localization of five members of the Kv1 channel subunits: contrasting subcellular locations and neuron-specific co-localizations in rat brain. European Journal of Neuroscience. 1995;7:2189–2205. doi: 10.1111/j.1460-9568.1995.tb00641.x. [DOI] [PubMed] [Google Scholar]
  46. Verna A. The mammalian carotid body: morphological data. In: Gonzalez C, editor. The Carotid Body Chemoreceptors. Heidelberg: Springer Verlag; 1997. pp. 1–29. [Google Scholar]
  47. Vullhorst D, Jockusch H, Bartsch JW. The genomic basis of K(V)3. 4 potassium channel mRNA diversity in mice. Gene. 2001;264:29–35. doi: 10.1016/s0378-1119(01)00327-4. [DOI] [PubMed] [Google Scholar]
  48. Wang ZZ, Stensaas LJ, Dinger B, Fidone SJ. Co-existence of tyrosine hydroxylase and dopamine beta-hydroxylase immunoreactivity in glomus cells of the cat carotid body. Journal of the Autonomic Nervous System. 1991;32:259–264. doi: 10.1016/0165-1838(91)90120-r. [DOI] [PubMed] [Google Scholar]
  49. Zhang X, Solaro CR, Lingle CJ. Allosteric regulation of BK channel gating by Ca2+ and Mg2+ through a nonselective, low affinity divalent cation site. Journal of General Physiology. 2001;118:607–636. doi: 10.1085/jgp.118.5.607. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES