Reversal of ultraviolet radiation-induced immune suppression by recombinant interleukin-12: suppression of cytokine production

D A Schmitt; J P Walterscheid; S E Ullrich

doi:10.1046/j.1365-2567.2000.00084.x

. 2000 Sep;101(1):90–96. doi: 10.1046/j.1365-2567.2000.00084.x

Reversal of ultraviolet radiation-induced immune suppression by recombinant interleukin-12: suppression of cytokine production

D A Schmitt ¹, J P Walterscheid ¹, S E Ullrich ¹

PMCID: PMC2327062 PMID: 11012758

Abstract

Exposure to ultraviolet (UV) radiation, a complete carcinogen, suppresses the immune response. Data from a number of laboratories have indicated that one consequence of UV exposure is suppressed T helper type 1 (Th1) cell function with normal Th2 cell activation, resulting in a shift to a Th2-like phenotype. The reversal of UV-induced immune suppression and tolerance induction by recombinant interleukin-12 (rIL-12) supports this observation. The focus of this study was to determine the mechanism(s) by which rIL-12 reverses UV-induced immune suppression. Two possibilities were considered: up-regulation of interferon-γ (IFN-γ) secretion by rIL-12 and suppression of UV-induced cytokine secretion by rIL-12. To our surprise we found that the ability of rIL-12 to overcome UV-induced immune suppression was independent of its ability to up-regulate IFN-γ secretion. Rather, rIL-12 suppressed the production of cytokines that are known to be important in UV-induced immune suppression. Injecting UV-irradiated mice with rIL-12, or adding rIL-12 to UV-irradiated keratinocyte cultures suppressed IL-10 secretion, in part by affecting the transcription of the IL-10 gene. Furthermore, we found that rIL-12 suppressed UV-induced tumour necrosis factor-α (TNF-α) production. Because IL-10 is involved in the UV-induced suppression of delayed-type hypersensitivity and TNF-α in the UV-induced suppression of contact allergy, these findings provide a mechanism to explain how rIL-12 overcomes UV-induced immune suppression in these related but different immune reactions. In addition, they suggest a novel mechanism by which rIL-12 alters immune reactivity, direct suppression of cytokine secretion induced by UV radiation.

Introduction

The primary cause of skin cancer, the most prevalent form of human neoplasia, is ultraviolet (UV) radiation found in sunlight. In addition to skin cancer induction, UV exposure has a number of deleterious effects on the health and well-being of exposed individuals. These include premature ageing of the skin, activation of latent viruses, such as herpes simplex, resulting in viral recrudescence and the induction of local and/or systemic immune suppression (reviewed in ref. 1).

The immune suppressive effects of UV radiation contribute to skin cancer induction by suppressing the cell-mediated immune reactions that normally serve to keep the developing skin cancers in check. Classic studies with laboratory mice,² renal transplant patients³ and, more recently, with biopsy-proven skin cancer patients⁴ have indicated that UV-induced immune suppression is a major risk factor for skin cancer induction. Because of the association between cancer induction and immune suppression, our studies have focused on determining the mechanism(s) by which exposure to UV radiation induces systemic immune suppression. A number of cytokines and biological response modifiers have been shown to be involved, including prostaglandin E₂, histamine, cis-urocanic acid, tumour necrosis factor-α (TNF-α) and interleukin-10 (IL-10).⁵ The interplay between these various UV-induced cytokines is complex and not completely understood but it does appear that a cytokine cascade is activated that ultimately affects systemic antigen-presenting cell function in such a way as to suppresses inflammatory T helper type 1 (Th1) cell-driven immune reactions.⁶^–⁸

Because UV exposure induces the production of Th2-associated cytokines such as IL-4 and IL-10,⁶ and because UV radiation interferes with antigen presentation to Th1 cells⁸^–¹⁰ we hypothesized that UV radiation may be shifting the immune response to a Th2-type immune response. The hypothesis was further supported by data demonstrating that recombinant IL-12 (rIL-12) could overcome UV-induced immune suppression, the activation of suppressor T cells and tolerance induction.¹¹^–¹³ The focus of the present paper was to determine the mechanism(s) involved in the reversal of UV-induced immune suppression by rIL-12. In particular, the following question was examined: Is the ability of IL-12 to overcome UV-induced immune suppression dependent upon interferon-γ (IFN-γ), or its ability to suppress the production of immunoregulatory cytokines such as IL-10 and TNF-α?

Materials and methods

Antibodies, cell lines and reagents

The spontaneously transformed keratinocyte cell line Pam 212 was obtained from Dr Stuart Yuspa (National Cancer Institute, Bethesda, MD) and grown in complete minimum essential medium (MEM) as described previously.¹⁴ Dr Stanley Wolf (Genetics Institute Inc., Cambridge, MA) provided us with rIL-12. The contact allergen oxazolone (4-ethoxymethylene-2-phenyloxazolin-5-one) was purchased from Sigma Chemical Co. (St. Louis, MO). The hybridoma secreting anti-IFN-γ (R4-6A2, rat immunoglobulin G1 [IgG1]) was purchased from the American Type Culture Collection (Rockville, MD) and grown in complete RPMI-1640 medium and antibody purified from culture supernatant as described previously.⁶ The biological activity of this antibody preparation was determined by measuring its ability to block the production of IFN-γ in the serum of IL-12-treated mice. Briefly, mice were injected with the anti-IFN-γ antibody or a control antibody (rat IgG, Sigma). Four hours later, the mice were injected intraperitoneally (i.p.) with rIL-12. The mice received a second injection of the antibody at 24 hr, and the mice were bled at 32, 48, and 72 hr. Serum IFN-γ levels were determined by enzyme-linked immunosorbent assay (ELISA). All monoclonal antibodies (mAbs) and recombinant cytokines injected into mice were diluted in endotoxin-free media and judged to be free of endotoxin by the Limulus amoebocyte lysate assay (Cape Cod Associates, Woods Hole, MA).

Animals

Specific pathogen-free female C3H/HeNCr (MTV^–) mice (8–12-week-old) were purchased from the National Cancer Institute Frederick Cancer Research Center Animal Production Area (Frederick, MD). Animals were maintained in facilities approved by the Association for Assessment and Accreditation of Laboratory Animal Care International in accordance with current U.S. Department of Agriculture, Department of Health and Human Services, and National Institutes of Health regulations and standards. The Institutional Animal Care and Use Committee approved all animal procedures. Within each experiment, all mice were matched for age and sex. The mice received National Institutes of Health-31 open formula mouse chow and sterile water ad libitum. Ambient light was controlled to provide regular cycles of 12 hr of light and 12 hr of darkness.

Radiation source

A bank of six FS-40 sunlamps (Westinghouse, Bloomfield, NJ) was used to treat mice with UV radiation. These lamps emit a continuous spectrum from 270 to 390 nm, with peak emission at 313 nm. Approximately 65% of the radiation emitted by these lamps is within the UVB range (280–320 nm). The irradiance of the source averaged 10 J/m²/s, as measured by an IL-700 radiometer using an SEE 240 UV detector equipped with an A127 quartz diffuser (International Light Inc., Newburyport, MA). Because of shielding by the cage lids, the incident dose received by the animals was approximately 4·5 J/m²/s. The total dose of UV received by the mice was 15 kJ/m². Before irradiation, the dorsal hair of the mice was removed with electric clippers.

In vitro UV irradiation of keratinocytes

Pam 212 cells were cultured in 100-mm tissue culture dishes, and these dishes were irradiated with UV radiation as described previously.¹⁴ Immediately after irradiation, the cells were washed and complete medium, with or without rIL-12, was added to the cells. The cells were incubated for 24 hr, the supernatants were harvested and concentrated 10-fold using a Centriprep microconcentrator (Amicon, Beverly, MA). The amount of IL-10 present in the supernatants of UV-irradiated Pam 212 cells was determined by ELISA.

Effect of rIL-12 on UV-induced suppression of contact hypersensitivity

Contact hypersensitivity (CHS) was used to measure the effect of UV on the immune response, as described previously.¹¹ Anti-IFN-γ was administered i.p. to mice 24 hr before and 24 hr after UV radiation. The specific ear swelling was determined by subtracting the response found in negative control mice, that were not sensitized but were challenged, from that found in positive control animals, that were sensitized and challenged. There were at least five mice per group; the data are expressed as specific ear swelling ± SD. Statistical differences between the controls and experimental groups were determined by use of a two-tailed Student's t-test, with a probability of < 0·05 considered significant.

Effect of rIL-12 on UV-induced epidermal IL-10 secretion

Mice were exposed to a 15-kJ/m² dose of UV radiation, and 4 hr later were injected with rIL-12 (1 µg/mouse). The dorsal skin of mice was removed 24, 48, and 72 hr after irradiation and frozen in OCT medium. Thin sections were prepared and mounted onto microscope slides. Immunohistochemistry for IL-10 was performed as described previously¹⁵ using anti-IL-10 antibody (JES-2A5.11).

ELISA to detect cytokine levels

ELISA detected cytokine levels in the serum or supernatant fluids. The capture antibodies, biotinylated detecting antibodies and recombinant cytokines were purchased from PharMingen (San Diego, CA) and were used according to the manufacturer's instructions in a ‘sandwich ELISA’ as described previously.⁶ Generally, the limit of detection for IL-10, IFN-γ and TNF-α was 15–25 pg/ml. Statistical differences between experimental groups were determined by use of the two-tailed Student's t-test, with a probability of < 0·05 considered significant.

Production of IL-10 promoter/luciferase reporter construct

Genomic DNA was prepared from the livers of normal C3H mice. Specific primers for the 5′ and 3′ ends of the mouse IL-10 promoter were designed from the published sequence (Genebank accession #M84340). The forward primer, which binds to the −1539 to −1513 region, was 5′ GGTCCATGCTAGCTGGGTCTTGAGCC. The reverse primer was 5′ ACGCGTAAGCTTGTGGCTTTGGTAGTGCAAGAGC (Life Technologies, Grand Island, NY). A 1576-base pair (bp) fragment was generated using 10 ng of the C3H mouse DNA as template in a 20-cycle polymerase chain reaction (PCR). The PCR product was then ligated into a pGL3 vector. The vectors were transformed into JM109 Escherichia coli cells and propagated. The complete construct was found by choosing random colonies on LB-ampicillin plates, performing a PCR with the original promoter primers, and sequencing the final product to verify that the construct contains the mouse IL-10 promoter.

Dual luciferase assay

A dual luciferase assay was used to measure UV-induced activity of the IL-10 promoter (Promega Corp., Madison, WI). Briefly, Pam 212 cells were plated at a concentration of 5 × 10⁴ cells/well in 24-well tissue culture plates and incubated overnight at 37° in 5% CO₂. Plasmids containing the IL-10 promoter or the empty pGL3 vector control were mixed with a plasmid containing the Renilla luciferase gene under the control of the cytomegalovirus (CMV) promoter in a lipophilic substrate and incubated together at 37° for 15 min. Two hundred microlitres of the IL-10–Renilla mixture or control plasmid–Renilla mixture was added to the Pam 212 cells in triplicate wells. The plates were then incubated at 37°. After 1 hr, the cells were washed and overlaid with 1 ml of complete Dulbecco's MEM (DMEM) and then incubated at 37°. After 24 hr, the cell monolayers were washed, resuspended in phosphate-buffered saline (PBS), and irradiated with UV radiation. The plates were then washed, resuspended in complete DMEM with or without rIL-12 and incubated for 36 hr at 37°. At the end of the incubation, the cells were lysed, and firefly luciferase activity was determined using a luminometer. Immediately following the luciferase measurement the reaction was quenched, the substrate for the Renilla luciferase was added and a second reading was taken. The Renilla luciferase reading was used as a control to determine transfection efficiency. The luminescence from the IL-10 constructs was compared to the luminescence obtained with the empty vector and expressed as fold increase.

Results

Neutralization of rIL-12-induced IFN-γ secretion in vivo

IFN-γ is involved in reversing UV-induced immune suppression.¹⁶ Since rIL-12 is a potent inducer of IFN-γ, we investigated the possibility that rIL-12 overcame immune suppression due to its effects on IFN-γ. We elected to use monoclonal anti-IFN-γ to neutralize rIL-12-induced IFN-γ. The efficacy of this procedure in neutralizing rIL-12-induced IFN-γ production is shown in Fig. 1. Recombinant IL-12 induced serum IFN-γ production. Injecting monoclonal anti-IFN-γ into the IL-12-treated mice eliminated IFN-γ. Isotype-matched control antibody had no effect on rIL-12-induced IFN-γ. These results demonstrate that the monoclonal anti-IFN-γ antibody was biologically active in vivo and did abolish rIL-12-induced IFN-γ production.

Inhibition of rIL-12-induced IFN-γ production. Recombinant IL-12-treated (1 µg/mouse) normal mice were injected with 0·75 µg of anti-IFN-γ mAb immediately following and 24 hr after IL-12 injection. Serum samples from individual mice were collected 48 hr after IL-12 injection. The data represent the mean ± SD from a group of five mice. Each serum sample was tested in triplicate. *P < 0·01 compared to the IL-12-only control.

Is the ability of rIL-12 to overcome UV-induced immune suppression IFN-γ-dependent?

These data are shown in Table 1. Compared to the negative control, sensitization with oxazolone induced significant ear swelling. Treatment of the positive control mice with rIL-12 or monoclonal anti-IFN-γ had no effect on CHS. As shown previously, UV exposure suppressed CHS. Monoclonal anti-IFN-γ had no effect on UV-induced immune suppression. As expected, treating these mice with rIL-12 overcame the induction of immune suppression. Because, no immune suppression was noted in mice exposed to UV radiation, treated with rIL-12 and injected with monoclonal anti-IFN-γ, we conclude that the rIL-12-induced reversal of UV-induced immune suppression was independent of IFN-γ.

Table 1.

Reversal of UV-induced suppression of CHS by IL-12 is independent of IFN-γ production

Treatment^*	rIL-12^†	Anti-IFN-γ^‡	Δ Ear swelling^§	Specific swelling^¶	% Suppression^**	P^††
Negative control	–	–	3 ± 0·5	–	–	–
Positive control	–	–	9 ± 1·2	6	–	–
Positive control	+	–	8 ± 2·3	5	20	0·217
Positive control	+	+	8 ± 1·5	5	20	0·314
UV	–	–	3 ± 0·8	0	100	0·001
UV	+	–	8 ± 1·3	5	20	0·356
UV	–	+	3 ± 0·6	0	100	0·001
UV	+	+	9 ± 2·2	6	0	0·899

Open in a new tab

Mice were exposed to UV (15 kJ/m²) and then injected with rIL-12 and/or monoclonal anti-IFN-γ. They were sensitized with oxazolone 5 days later at a distant, non-irradiated site and CHS was measured 6 days post sensitization. Negative control refers to mice that were not sensitized but were challenged; positive control refers to mice that were sensitized and challenged.

^†

1 µg/mouse ip. 4 hr after UV exposure.

^‡

0·75 µg/mouse, 24 hr before and 24 hr after UV exposure.

^§

mm × 10⁻² ± SD.

^¶

Δ ear swelling of the experimental groups minus the background swelling found in the Negative Control.

^**

% immune suppression = (1–[specific ear swelling of the UV-irradiated mice/specific swelling of the positive control] × 100).

^††

P-values determined by two-tailed Student's t-test versus the positive control.

Effect of rIL-12 on IL-10 production

Next, we tested the hypothesis that rIL-12 affected the UV-induced secretion of immune regulatory cytokines. We used UV-induced IL-10 production by Pam 212 cells as a model system to test the effect of rIL-12 on IL-10 secretion. As demonstrated previously, exposing Pam 212 cells to 200 J/m² of UV radiation induced IL-10 secretion.¹⁴ Addition of rIL-12 to the cultures immediately after UV-irradiation suppressed the secretion of IL-10 in a dose-dependent fashion (Fig. 2).

Recombinant IL-12 suppresses UV-induced keratinocyte-derived IL-10 secretion. Pam 212 keratinocytes were exposed to 200 J/m² of UV radiation. Immediately following irradiation rIL-12 was added. Twenty-four hours later the supernatants were harvested and ELISA was used to measure IL-10 secretion. The data represent the mean ± SD from triplicate cultures.

We decided to confirm these results by examining the effect rIL-12 had on epidermal IL-10 production in vivo. Using immunohistochemistry, we measured the IL-10 present in the skin of UV-irradiated mice (Fig. 3). Figure 3(a) shows background staining with the secondary antibody alone (UV + rat IgG). When these skin samples were stained with rat anti-mouse IL-10, epidermal IL-10 production was clearly demonstrated (Fig. 3b). The secretion of IL-10 by the epidermal cells was completely abrogated when the irradiated mice were injected with 1 µg of rIL-12 (Fig. 3c). The findings presented in Figs 2 and 3 indicate that blocking UV-induced IL-10 production provides one mechanism to explain rIL-12 reversal of UV-induced immune suppression.

Suppression of UV-induced epidermal IL-10 secretion by rIL-12. Mice were exposed to 15 kJ/m² of UV radiation and 4 hr later, injected with rIL-12 (1 µg/mouse). The skins of the mice were harvested 24 hr after irradiation and frozen sections were prepared. (a) UV stained with rat IgG; (b) UV stained with anti-IL-10; (c) UV + IL-12 stained with anti-IL-10.

Effect of rIL-12 on UV-induced IL-10 gene transcription

Because the production of many cytokines is regulated at the level of transcription, we next wanted to determine if rIL-12 affected the transcription of the IL-10 gene. An IL-10 promoter construct was prepared and transfected onto Pam 212 keratinocytes. The Pam 212 cells were then exposed to UV radiation (200 J/m²) and immediately incubated with rIL-12. Minimal luciferase activity was found in non-irradiated Pam 212 cells, regardless of whether rIL-12 was present or not (Fig. 4). UV-irradiation of the transfected cells caused approximately a 10-fold increase in promoter activity (P < 0·05). This activity was completely blocked by rIL-12 treatment. These data indicate that the mechanism by which rIL-12 blocks IL-10 production is transcriptional regulation of the IL-10 gene.

Effect of rIL-12 on UV-induced transcription of the IL-10 gene. The IL-10 promoter construct was transfected into Pam 212 cells and 24 hr later these cells were exposed to 200 J/m² of UV radiation. Immediately after irradiation rIL-12 was added to the cells. After 36 hr of irradiation, the cells were lysed and luciferase activity was determined. The data represent the mean ± SD from triplicate cultures. *P < 0·05 compared to the response generated with control non-irradiated cells (NR) cultured in medium.

Effect of IL-12 on UV-induced TNF-α production

Previous findings from our laboratory and others indicated that IL-10 is the cytokine involved in the UV-induced suppression of delayed type hypersensitivity (DTH). UV-induced TNF-α, on the other hand, suppresses CHS.¹⁷^,¹⁸ Because injecting rIL-12 into UV-irradiated mice reverses the suppression of both DTH and CHS,¹¹^–¹³ we next determined whether rIL-12 inhibits the production of UV-induced TNF-α. As shown in Fig. 5, little to no TNF-α was found in the serum of normal mice. Exposure to UV radiation caused a dramatic increase in serum TNF-α secretion, with peak production occurring 48 hr post irradiation. Treatment of the UV-irradiated mice with rIL-12 (1 µg/mouse 4 hr after UV exposure) completely eradicated TNF-α production. At 48 hr, the serum TNF-α levels observed in normal non-irradiated mice and those seen in mice exposed to UV and injected with rIL-12 were not statistically different. These results illustrate that rIL-12 reverses UV-induced suppression of CHS by blocking TNF-α secretion in vivo.

Effect of rIL-12 on UV-induced serum TNF-α levels. TNF-α levels were examined in the serum of nonirradiated mice (□), UV-irradiated mice (♦), or UV-irradiated mice treated with IL-12 (○) harvested 24, 48 and 72 hr after irradiation by ELISA. Each point represents the mean ± SD from a group of three mice. *P < 0·01compared to the serum TNF-α levels observed in the non-irradiated control mice.

Discussion

Previously, we reported that IL-12 could reverse UV-induced systemic immune suppression.¹¹ In the series of experiments presented here we focused on the mechanism by which IL-12 overcomes UV-induced immune suppression. We concentrated on two possible mechanisms by which IL-12 could overcome immune suppression, up-regulation of IFN-γ production and IL-12-induced suppression of cytokine secretion. Because of the recent report of Reeve et al. indicating a critical role for IFN-γ in reversing UV-induced immune suppression,¹⁶ we suspected IL-12-induced up-regulation of IFN-γ production as the most probable mechanism. Our data, however, did not support up-regulation of IFN-γ secretion by IL-12 as the likely mechanism. This result concurs with other examples in the literature demonstrating the IFN-γ-independent effects of IL-12.¹⁹^–²²

Although there are many examples in the literature of IL-10 suppressing the secretion of IL-12,²³ examples of IL-12 suppressing IL-10 production are less numerous. Most of the examples come from experiments in which the effect of IL-12 on T-cell activation/differentiation was studied. For the most part, IL-12-induced suppression of IL-10 and/or IL-4 secretion appears to be secondary to the effect IL-12 has on suppressing the activation/differentiation of Th2 cells.²⁴^–²⁶ The data presented here indicate a different mechanism for IL-12-induced suppression of cytokine production. Rather than suppressing the activation/differentiation of Th2 cells, in our experiments IL-12 is directly suppressing the secretion of keratinocyte-derived IL-10. Moreover, our data indicate that IL-12 suppresses UV-induced keratinocyte-derived IL-10 secretion at the level of transcription. Because of the critical role UV-induced IL-10 plays in suppressing DTH,¹⁴ these findings provide a mechanism for the reversal of immune suppression in our previous studies.¹¹ Whether IL-12 suppresses the secretion of other UV-induced immune regulatory factors produced by non-T cells, such as prostaglandin E₂ by keratinocytes²⁷ or histamine and/or IL-4 by dermal mast cells,²⁸ remains to be seen.

Although UV-induced IL-10 appears to be critically involved in the UV-induced suppression of DTH, it is also clear that UV-induced TNF-α plays a critical role in the suppression of CHS.¹⁷^,¹⁸ Because rIL-12 treatment reverses UV-induced suppression of DTH and CHS we tested the ability of rIL-12 to suppress TNF-α secretion. UV-induced serum TNF-α production is totally abrogated by rIL-12. In a preliminary experiment, rIL-12 also inhibited serum IL-10 production in mice measured 72 hr after UV irradiation (data not shown). These findings not only explain our previous data but they also provide insight into the mechanism by which rIL-12 reverses UV-induced tolerance induction.¹³ Data published by Niizeki and Streilein²⁹ indicate different but essential roles for IL-10 and TNF-α in UV-induced immune suppression of CHS and tolerance induction. Experiments using antibody depletion indicate that UV-induced TNF-α contributes to the induction of immune suppression in UV-irradiated mice but not to tolerance induction. UV-induced IL-10 on the other hand appears to be involved in tolerance induction but not in suppression of CHS in the UV-irradiated animal. Because, as shown here, rIL-12 suppresses both the UV-induced induction of TNF-α and IL-10, we suggest the global suppression of UV-induced cytokine secretion by rIL-12 provides a mechanism explaining its reversal of both UV-induced immune suppression and UV-induced tolerance induction.

The findings reported here, especially rIL-12-induced suppression of IL-10 secretion may have implications beyond simply understanding the mechanisms through which rIL-12 reverses UV-induced immune suppression. Although originally described as a Th2 cell-derived cytokine, it is now clear that IL-10 is produced by a wide variety of cells. In addition to T cells and keratinocytes, mast cells, B lymphomas, Epstein–Barr virus-transformed B cells, activated B cells, monocytes and macrophages secrete IL-10. One well-known role of IL-10 on the immune response is to induce clonal anergy.²³ It is entirely possible that the ability of rIL-12 to break tolerance may go beyond its ability to drive the activation/differentiation of T cells and may reflect suppression of IL-10 production by non-T-cell sources.

In summary, we provide data to suggest that the reversal of UV-induced immune suppression by rIL-12 occurs independently of its ability to up-regulate IFN-γ but rather reflects suppression of cytokine secretion. Unlike other documented cases of rIL-12 suppressing the secretion of IL-10, the effects shown here do not appear to be secondary to the ability of rIL-12 to suppress Th1 cell differentiation. Rather, we find that treating UV-irradiated keratinocytes with rIL-12 suppresses, at the level of transcription, the ability of the irradiated cells to secrete IL-10. Similarly, we find that rIL-12 suppresses UV-induced serum TNF-α secretion. We suggest that the mechanism by which rIL-12 restores immunity, and reverses tolerance induction in an UV-irradiated animal reflect its ability to directly suppress cytokine secretion.

Acknowledgments

We thank Craig McClain and Todd Giese for their help with the cytokine ELISA assays performed here. This work was supported by Grants CA 75575 from the National Cancer Institute and ES 07327 from the National Institute of Environmental Health Sciences. The animal facilities at the M. D. Anderson Cancer Center are supported in part by Core Grant CA 16672 from the National Cancer Institute.

Glossary

Abbreviations

CHS: contact hypersensitivity
DTH: delayed-type hypersensitivity
r: recombinant

References

1.Ullrich SE. The effects of ultraviolet radiation on the immune response. In: Kydonieus AF, Wille JJ, editors. Biochemical Modulation of Skin Reactions: Transdermals, Topicals, Cosmetics. New York: CRC Press LLC; 2000. pp. 281–300. [Google Scholar]
2.Kripke ML. Antigenicity of murine skin tumors induced by UV light. J Natl Cancer Inst. 1974;53:1333–6. doi: 10.1093/jnci/53.5.1333. [DOI] [PubMed] [Google Scholar]
3.Penn I. Depressed immunity and skin cancer. Immunol Today. 1984;5:291–3. doi: 10.1016/0167-5699(84)90152-X. [DOI] [PubMed] [Google Scholar]
4.Yoshikawa T, Rae V, Bruins-Slot W, et al. Susceptibility to effects of UVB radiation on induction of contact hypersensitivity as a risk factor for skin cancer in humans. J Invest Dermatol. 1990;95:530–6. doi: 10.1111/1523-1747.ep12504877. [DOI] [PubMed] [Google Scholar]
5.Ullrich SE. The role of epidermal cytokines in the generation of cutaneous immune reactions and ultraviolet radiation induced immune suppression. Photochem Photobiol. 1995;62:389–401. doi: 10.1111/j.1751-1097.1995.tb02359.x. [DOI] [PubMed] [Google Scholar]
6.Shreedhar V, Giese T, Sung VW, et al. A cytokine cascade including prostaglandin E2, interleukin-4, and interleukin-10 is responsible for UV-induced systemic immune suppression. J Immunol. 1998;160:3783–9. [PubMed] [Google Scholar]
7.Brown EL, Rivas JM, Ullrich SE, et al. Modulation of immunity to Borrelia burgdorferi by ultraviolet irradiation: differential effect on Th1 and Th2 type immune responses. Eur J Immunol. 1995;25:3017–22. doi: 10.1002/eji.1830251105. [DOI] [PubMed] [Google Scholar]
8.Ullrich SE. Mechanism involved in the systemic suppression of antigen-presenting cell function by UV irradiation: keratinocyte-derived IL-10 modulates antigen-presenting cell function of splenic adherent cells. J Immunol. 1994;152:3410–16. [PubMed] [Google Scholar]
9.Simon JC, Cruz PC, Bergstresser PR, et al. Low dose ultraviolet B-irradiated Langerhans cells preferentially activate CD4+ cells of the T helper 2 subset. J Immunol. 1990;145:2087–91. [PubMed] [Google Scholar]
10.Simon JC, Tigelaar RE, Bergstresser PR, et al. Ultraviolet B radiation converts Langerhans cells from immunogenic to tolerogenic antigen-presenting cells: induction of specific clonal anergy in CD4+ T helper 1 cells. J Immunol. 1991;146:485–91. [PubMed] [Google Scholar]
11.Schmitt DA, Owen-Schaub L, Ullrich SE. Effect of IL-12 on immune suppression and suppressor cell induction by ultraviolet radiation. J Immunol. 1995;154:5114–20. [PubMed] [Google Scholar]
12.Müller G, Salonga J, Germann T, et al. IL-12 as mediator and adjuvant for the induction of contact sensitivity in vivo. J Immunol. 1995;155:4661–8. [PubMed] [Google Scholar]
13.Schwarz A, Grabbe S, Aragane Y, et al. Interleukin-12 prevents ultraviolet B-induced local immunosuppression and overcomes UVB-induced tolerance. J Invest Dermatol. 1996;106:1187–91. doi: 10.1111/1523-1747.ep12347944. [DOI] [PubMed] [Google Scholar]
14.Rivas JM, Ullrich SE. Systemic suppression of DTH by supernatants from UV-irradiated keratinocytes: an essential role for interleukin 10. J Immunol. 1992;149:3865–71. [PubMed] [Google Scholar]
15.Moodycliffe AM, Bucana CD, Kripke ML, et al. Differential effects of a monoclonal antibody to cis-urocanic acid on the suppression of delayed and contact hypersensitivity following ultraviolet irradiation. J Immunol. 1996;157:2891–9. [PubMed] [Google Scholar]
16.Reeve VE, Bosnic M, Nishimura N. Interferon-gamma is involved in photoimmunoprotection by UVA (320–400 nm) radiation in mice. J Invest Dermatol. 1999;112:945–50. doi: 10.1046/j.1523-1747.1999.00594.x. 10.1046/j.1523-1747.1999.00594.x. [DOI] [PubMed] [Google Scholar]
17.Rivas JM, Ullrich SE. The role of IL-4, IL-10, and TNF-α in the immune suppression induced by ultraviolet radiation. J Leukoc Biol. 1994;56:769–75. doi: 10.1002/jlb.56.6.769. [DOI] [PubMed] [Google Scholar]
18.Beissert S, Hosoi J, Kühn R, et al. Impaired immunosuppressive response to ultraviolet radiation in interleukin-10-deficient mice. J Invest Dermatol. 1996;107:553–7. doi: 10.1111/1523-1747.ep12582809. [DOI] [PubMed] [Google Scholar]
19.Seder RA, Gazzinelli R, Sher A, et al. Interleukin 12 acts directly on CD4+ cells to enhance priming for interferon γ production and diminishes interleukin 4 inhibition of such priming. Proc Natl Acad Sci USA. 1993;90:10188–92. doi: 10.1073/pnas.90.21.10188. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.McKnight AJ, Zimmer GJ, Fogelman I, et al. Effects of IL-12 on helper cell-dependent immune responses in vivo. J Immunol. 1994;152:2172–9. [PubMed] [Google Scholar]
21.Wang Z-E, Zheng S, Corry DB, et al. Interferon-γ-independent effects of interleukin 12 administered during acute or established infection due to Leishmania major. Proc Natl Acad Sci USA. 1994;91:12932–6. doi: 10.1073/pnas.91.26.12932. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.DiIulio NA, Xu H, Fairchild RL. Diversion of CD4 (+) T cell development from regulatory T helper to effector T helper cells alters the contact hypersensitivity response. Eur J Immunol. 1996;26:2606–12. doi: 10.1002/eji.1830261111. [DOI] [PubMed] [Google Scholar]
23.Moore KW, O'garra A, de Waal Malefyt R, et al. Interleukin-10. Annu Rev Immunol. 1993;11:165–90. doi: 10.1146/annurev.iy.11.040193.001121. [DOI] [PubMed] [Google Scholar]
24.DeKruyff RH, Fang Y, Wolf SF, et al. IL-12 inhibits IL-4 synthesis in keyhole limpet hemocyanin-primed CD4+ T cells through an effect on antigen-presenting cells. J Immunol. 1995;154:2578–87. [PubMed] [Google Scholar]
25.Marshall JD, Secrist H, DeKruyff RH, et al. IL-12 inhibits the production of IL-4 and IL-10 in allergen specific human CD4+ T lymphocytes. J Immunol. 1995;155:111–17. [PubMed] [Google Scholar]
26.Matsuo R, Kobayashi M, Herndon DN, et al. Interleukin-12 protects thermally injured mice from herpes simplex virus type 1 infection. J Leuko Biol. 1996;59:623–30. doi: 10.1002/jlb.59.5.623. [DOI] [PubMed] [Google Scholar]
27.Pentland AP, Mahoney M, Jacobs SC, et al. Enhanced prostaglandin synthesis after ultraviolet injury is mediated by endogenous histamine stimulation: a mechanism for irradiation erythema. J Clin Invest. 1990;86:566–74. doi: 10.1172/JCI114746. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Hart PH, Grimbaldeston MA, Swift GJ, et al. Dermal mast cells determine susceptibility to Ultraviolet B-induced systemic suppression of contact hypersensitivity responses in mice. J Exp Med. 1998;187:2045–53. doi: 10.1084/jem.187.12.2045. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Niizeki H, Streilein JW. Hapten-specific tolerance induced by acute, low-dose ultraviolet B radiation of skin is mediated via interleukin-10. J Invest Dermatol. 1997;109:25–30. doi: 10.1111/1523-1747.ep12276415. [DOI] [PubMed] [Google Scholar]

[b1] 1.Ullrich SE. The effects of ultraviolet radiation on the immune response. In: Kydonieus AF, Wille JJ, editors. Biochemical Modulation of Skin Reactions: Transdermals, Topicals, Cosmetics. New York: CRC Press LLC; 2000. pp. 281–300. [Google Scholar]

[b2] 2.Kripke ML. Antigenicity of murine skin tumors induced by UV light. J Natl Cancer Inst. 1974;53:1333–6. doi: 10.1093/jnci/53.5.1333. [DOI] [PubMed] [Google Scholar]

[b3] 3.Penn I. Depressed immunity and skin cancer. Immunol Today. 1984;5:291–3. doi: 10.1016/0167-5699(84)90152-X. [DOI] [PubMed] [Google Scholar]

[b4] 4.Yoshikawa T, Rae V, Bruins-Slot W, et al. Susceptibility to effects of UVB radiation on induction of contact hypersensitivity as a risk factor for skin cancer in humans. J Invest Dermatol. 1990;95:530–6. doi: 10.1111/1523-1747.ep12504877. [DOI] [PubMed] [Google Scholar]

[b5] 5.Ullrich SE. The role of epidermal cytokines in the generation of cutaneous immune reactions and ultraviolet radiation induced immune suppression. Photochem Photobiol. 1995;62:389–401. doi: 10.1111/j.1751-1097.1995.tb02359.x. [DOI] [PubMed] [Google Scholar]

[b6] 6.Shreedhar V, Giese T, Sung VW, et al. A cytokine cascade including prostaglandin E2, interleukin-4, and interleukin-10 is responsible for UV-induced systemic immune suppression. J Immunol. 1998;160:3783–9. [PubMed] [Google Scholar]

[b7] 7.Brown EL, Rivas JM, Ullrich SE, et al. Modulation of immunity to Borrelia burgdorferi by ultraviolet irradiation: differential effect on Th1 and Th2 type immune responses. Eur J Immunol. 1995;25:3017–22. doi: 10.1002/eji.1830251105. [DOI] [PubMed] [Google Scholar]

[b8] 8.Ullrich SE. Mechanism involved in the systemic suppression of antigen-presenting cell function by UV irradiation: keratinocyte-derived IL-10 modulates antigen-presenting cell function of splenic adherent cells. J Immunol. 1994;152:3410–16. [PubMed] [Google Scholar]

[b9] 9.Simon JC, Cruz PC, Bergstresser PR, et al. Low dose ultraviolet B-irradiated Langerhans cells preferentially activate CD4+ cells of the T helper 2 subset. J Immunol. 1990;145:2087–91. [PubMed] [Google Scholar]

[b10] 10.Simon JC, Tigelaar RE, Bergstresser PR, et al. Ultraviolet B radiation converts Langerhans cells from immunogenic to tolerogenic antigen-presenting cells: induction of specific clonal anergy in CD4+ T helper 1 cells. J Immunol. 1991;146:485–91. [PubMed] [Google Scholar]

[b11] 11.Schmitt DA, Owen-Schaub L, Ullrich SE. Effect of IL-12 on immune suppression and suppressor cell induction by ultraviolet radiation. J Immunol. 1995;154:5114–20. [PubMed] [Google Scholar]

[b12] 12.Müller G, Salonga J, Germann T, et al. IL-12 as mediator and adjuvant for the induction of contact sensitivity in vivo. J Immunol. 1995;155:4661–8. [PubMed] [Google Scholar]

[b13] 13.Schwarz A, Grabbe S, Aragane Y, et al. Interleukin-12 prevents ultraviolet B-induced local immunosuppression and overcomes UVB-induced tolerance. J Invest Dermatol. 1996;106:1187–91. doi: 10.1111/1523-1747.ep12347944. [DOI] [PubMed] [Google Scholar]

[b14] 14.Rivas JM, Ullrich SE. Systemic suppression of DTH by supernatants from UV-irradiated keratinocytes: an essential role for interleukin 10. J Immunol. 1992;149:3865–71. [PubMed] [Google Scholar]

[b15] 15.Moodycliffe AM, Bucana CD, Kripke ML, et al. Differential effects of a monoclonal antibody to cis-urocanic acid on the suppression of delayed and contact hypersensitivity following ultraviolet irradiation. J Immunol. 1996;157:2891–9. [PubMed] [Google Scholar]

[b16] 16.Reeve VE, Bosnic M, Nishimura N. Interferon-gamma is involved in photoimmunoprotection by UVA (320–400 nm) radiation in mice. J Invest Dermatol. 1999;112:945–50. doi: 10.1046/j.1523-1747.1999.00594.x. 10.1046/j.1523-1747.1999.00594.x. [DOI] [PubMed] [Google Scholar]

[b17] 17.Rivas JM, Ullrich SE. The role of IL-4, IL-10, and TNF-α in the immune suppression induced by ultraviolet radiation. J Leukoc Biol. 1994;56:769–75. doi: 10.1002/jlb.56.6.769. [DOI] [PubMed] [Google Scholar]

[b18] 18.Beissert S, Hosoi J, Kühn R, et al. Impaired immunosuppressive response to ultraviolet radiation in interleukin-10-deficient mice. J Invest Dermatol. 1996;107:553–7. doi: 10.1111/1523-1747.ep12582809. [DOI] [PubMed] [Google Scholar]

[b19] 19.Seder RA, Gazzinelli R, Sher A, et al. Interleukin 12 acts directly on CD4+ cells to enhance priming for interferon γ production and diminishes interleukin 4 inhibition of such priming. Proc Natl Acad Sci USA. 1993;90:10188–92. doi: 10.1073/pnas.90.21.10188. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b20] 20.McKnight AJ, Zimmer GJ, Fogelman I, et al. Effects of IL-12 on helper cell-dependent immune responses in vivo. J Immunol. 1994;152:2172–9. [PubMed] [Google Scholar]

[b21] 21.Wang Z-E, Zheng S, Corry DB, et al. Interferon-γ-independent effects of interleukin 12 administered during acute or established infection due to Leishmania major. Proc Natl Acad Sci USA. 1994;91:12932–6. doi: 10.1073/pnas.91.26.12932. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b22] 22.DiIulio NA, Xu H, Fairchild RL. Diversion of CD4 (+) T cell development from regulatory T helper to effector T helper cells alters the contact hypersensitivity response. Eur J Immunol. 1996;26:2606–12. doi: 10.1002/eji.1830261111. [DOI] [PubMed] [Google Scholar]

[b23] 23.Moore KW, O'garra A, de Waal Malefyt R, et al. Interleukin-10. Annu Rev Immunol. 1993;11:165–90. doi: 10.1146/annurev.iy.11.040193.001121. [DOI] [PubMed] [Google Scholar]

[b24] 24.DeKruyff RH, Fang Y, Wolf SF, et al. IL-12 inhibits IL-4 synthesis in keyhole limpet hemocyanin-primed CD4+ T cells through an effect on antigen-presenting cells. J Immunol. 1995;154:2578–87. [PubMed] [Google Scholar]

[b25] 25.Marshall JD, Secrist H, DeKruyff RH, et al. IL-12 inhibits the production of IL-4 and IL-10 in allergen specific human CD4+ T lymphocytes. J Immunol. 1995;155:111–17. [PubMed] [Google Scholar]

[b26] 26.Matsuo R, Kobayashi M, Herndon DN, et al. Interleukin-12 protects thermally injured mice from herpes simplex virus type 1 infection. J Leuko Biol. 1996;59:623–30. doi: 10.1002/jlb.59.5.623. [DOI] [PubMed] [Google Scholar]

[b27] 27.Pentland AP, Mahoney M, Jacobs SC, et al. Enhanced prostaglandin synthesis after ultraviolet injury is mediated by endogenous histamine stimulation: a mechanism for irradiation erythema. J Clin Invest. 1990;86:566–74. doi: 10.1172/JCI114746. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b28] 28.Hart PH, Grimbaldeston MA, Swift GJ, et al. Dermal mast cells determine susceptibility to Ultraviolet B-induced systemic suppression of contact hypersensitivity responses in mice. J Exp Med. 1998;187:2045–53. doi: 10.1084/jem.187.12.2045. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b29] 29.Niizeki H, Streilein JW. Hapten-specific tolerance induced by acute, low-dose ultraviolet B radiation of skin is mediated via interleukin-10. J Invest Dermatol. 1997;109:25–30. doi: 10.1111/1523-1747.ep12276415. [DOI] [PubMed] [Google Scholar]

PERMALINK

Reversal of ultraviolet radiation-induced immune suppression by recombinant interleukin-12: suppression of cytokine production

D A Schmitt

J P Walterscheid

S E Ullrich

Abstract

Introduction