Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2008 Feb 29;74(9):2619–2626. doi: 10.1128/AEM.02905-07

Targeted Inactivation of Francisella tularensis Genes by Group II Introns▿

Stephen A Rodriguez 1, Jieh-Juen Yu 1, Greg Davis 2, Bernard P Arulanandam 1, Karl E Klose 1,*
PMCID: PMC2394887  PMID: 18310413

Abstract

Studies of the molecular mechanisms of pathogenesis of Francisella tularensis, the causative agent of tularemia, have been hampered by a lack of genetic techniques for rapid targeted gene disruption in the most virulent subspecies. Here we describe efficient targeted gene disruption in F. tularensis utilizing mobile group II introns (targetrons) specifically optimized for F. tularensis. Utilizing a targetron targeted to blaB, which encodes ampicillin resistance, we showed that the system works at high efficiency in three different subspecies: F. tularensis subsp. tularensis, F. tularensis subsp. holarctica, and “F. tularensis subsp. novicida.” A targetron was also utilized to inactivate F. tularensis subsp. holarctica iglC, a gene required for virulence. The iglC gene is located within the Francisella pathogenicity island (FPI), which has been duplicated in the most virulent subspecies. Importantly, the iglC targetron targeted both copies simultaneously, resulting in a strain mutated in both iglC genes in a single step. This system will help illuminate the contributions of specific genes, and especially those within the FPI, to the pathogenesis of this poorly studied organism.


Francisella tularensis is a highly infectious bacterium that causes tularemia, a zoonotic disease (11). Interest in this pathogen has been heightened due to its potential use as a biological weapon and the lack of a safe and effective vaccine approved for human use. The subspecies of F. tularensis differ in virulence in humans. F. tularensis subsp. tularensis is the most virulent of the subspecies (39) and has been associated historically with bioweapons development (30). F. tularensis subsp. holarctica maintains high virulence in humans, but infections by this organism are reported to be less severe (40). An attenuated form of F. tularensis subsp. holarctica, the “live vaccine strain” (LVS) (10), is used frequently as a laboratory model for the more virulent F. tularensis strains. Finally, “F. tularensis subsp. novicida” is generally the least virulent to humans. All three subspecies are closely related at the genomic level, with the less virulent F. tularensis subsp. novicida showing less genomic decay than the virulent F. tularensis subsp. holarctica and F. tularensis subsp. tularensis (34, 36).

F. tularensis is able to survive and replicate within macrophages, an ability that has been linked to its virulence (1, 5, 13). A cluster of genes that constitute the Francisella pathogenicity island (FPI) are required for intramacrophage survival and growth, including the iglC gene (15, 16, 23, 32, 38). Transcription of the FPI genes is regulated by MglA (7, 24), a global regulatory factor that associates with RNA polymerase (8). The entire FPI is duplicated within the genomes of the virulent F. tularensis subsp. tularensis and F. tularensis subsp. holarctica strains, unlike the case for F. tularensis subsp. novicida strains, which have a single FPI (22).

Most studies utilizing targeted gene knockouts have been performed with F. tularensis subsp. novicida, due to ease of genetic manipulation, more established genetic tools, and the presence of a single FPI (1-4, 23, 25). For example, for unknown reasons, F. tularensis subsp. novicida can take up and integrate linear DNA into its genome, an ability that appears to be lacking in F. tularensis subsp. tularensis and F. tularensis subsp. holarctica. A technique for targeted mutagenesis within F. tularensis subsp. holarctica and F. tularensis subsp. tularensis has been developed, based on conjugation or transformation with a nonreplicative plasmid followed by sacB counterselection (15). However, this technique is time-consuming and relatively inefficient; moreover, targeted mutagenesis of the duplicated FPI genes requires twice the effort. The cumbersome nature of biosafety containment required for the more virulent subspecies has added another hurdle to the development of efficient mutagenesis techniques for F. tularensis subsp. tularensis and F. tularensis subsp. holarctica strains. Thus, to date, there are only a few examples of successful targeted mutagenesis in F. tularensis subsp. tularensis (15, 41).

Group II introns have been exploited for targeted gene disruption in various bacteria. The Lactococcus lactis LtrB (LtrBLl) intron has been developed into a “targetron” that can be retargeted to inactivate specific genes of interest (14, 20, 31, 33, 42, 43). This system involves homing of a ribonucleoprotein complex (RNP) that consists of the group II intron RNA molecule (LtrBLl) and the associated LtrA protein. Base pairing between exon binding site 1 (EBS1), EBS2, and δ of the RNA molecule with intron binding site 1 (IBS1), IBS2, and δ′ within the target gene confers specificity upon the subsequent integration event (Fig. 1). Thus, the intron can be targeted to specific genes by replacing EBS1 and EBS2 with sequences complementary to the insertion site within the gene of interest.

FIG. 1.

FIG. 1.

(A) Targetron plasmid. Plasmid pKEK1140 was constructed to adapt the TargeTron system to F. tularensis; the elements indicated are described in the text. (B) LtrBLl intron structure. The secondary structure of the LtrBLl targetron transcript is shown, with the EBS1 and EBS2 loops and δ site indicated. (The primary transcript also contains IBS1, IBS2, and δ′ sites identical to those found within the target gene; the intron excises from these prior to insertion into the target site within the chromosome.) (C) F. tularensis group II intron insertion sites. Shown are the targetron target sites within the blaB (102|103a) and iglC (427|428a) genes. The EBS1, EBS2, and δ elements within the respective targetrons are designed to base pair with the corresponding complementary sequences within the blaB and iglC genes, as indicated by hatch marks. The open triangles show the insertion site of the group II intron, while the elements recognized by the targetron RNP at −23, −20, and +5 with respect to the insertion site are depicted.

LtrBLl and LtrA are expressed from a donor plasmid, from which the LtrBLl intron splices out of its flanking 5′ and 3′ exons and forms an RNA lariat that associates with LtrA (20, 26, 29). The LtrA protein facilitates formation of the intron's catalytic structure and recognition of the target gene. LtrBLl reverse splices into the insertion site, while LtrA reverse transcribes the intron RNA sequence, synthesizing an antisense copy of the RNA. Because the ltrA gene is not encoded within the inserted sequence, the resultant insertion mutation is stably maintained in the absence of LtrA.

In the present study, we have adapted the TargeTron group II intron mutagenesis system for F. tularensis. We demonstrate that this optimized targetron system works at high efficiency in F. tularensis subsp. tularensis, F. tularensis subsp. holarctica, and F. tularensis subsp. novicida. Moreover, the intron is capable of inactivating two identical genes simultaneously within the same strain in the absence of selection, which will facilitate the study of the duplicated FPI genes in the more virulent subspecies.

MATERIALS AND METHODS

Bacterial strains and media.

The bacterial strains used in this study are listed in Table 1. Francisella tularensis strains were grown on TSAP medium (tryptic soybean agar powder [40 g/liter] with 0.1% cysteine, 25 μg/ml ferrous sulfate, 25 μg/ml sodium pyruvate, and 25 μg/ml sodium metasulfite). Escherichia coli strain DH5α was grown on Luria-Bertani (LB) medium. The concentrations of 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-Gal), kanamycin (Kan), and ampicillin (Amp), when used, were 40 μg ml−1, 50 μg ml−1, and 1 mg ml−1, respectively.

TABLE 1.

Bacterial strains used in this study

Subspecies or species and strain Genotype Source or reference
F. tularensis subsp. novicida
    U112 Wild type ATCC 15482
    KKF322 U112 blaB::ltrBLl This study
    KKF24 U112 ΔiglC::ermC 23
F. tularensis subsp. holarctica
    LVS Live vaccine strain ATCC 29684
    KKL4 LVS blaB::ltrBLl This study
    KKL1 LVS iglC1::ltrBLliglC2::ltrBLl This study
F. tularensis subsp. tularensis
    Schu4 Wild type CDC
    KKT1 Schu4 blaB::ltrBLl This study
E. coli DH5α F−deoR endA1 hsdR17 supE44 thi-1 recA1 gyrA96 relA1 Δ(argF-lacZYA)U196 (φ80dlacZΔM15) 17

Construction of the targetron plasmid.

The oligonucleotides used in this study are listed in Table 2. The Francisella plasmid pKK214 (21) was PCR amplified with primers pKK214EcoRIinverse and pKK214EcoNotI, and then the PCR product was digested with EcoRI and religated to form pKEK648. This step removed the cat gene from pKK214 and introduced a NotI restriction site. Next, pKEK648 was PCR amplified with primers TetUpXhoI and TetDown, digested with XhoI and NotI, and ligated to an FpKanr fragment, which was PCR amplified from pKEK898 (25) using primers pET15BUpSalI and FpKanUpNotI and digested with SalI and NotI. This step resulted in the formation of pKEK996, which replaced the tetracycline resistance gene in pKEK648 with Kan resistance driven by an F. tularensis promoter. An XhoI restriction site present within the aminoglycoside 3′-phosphotransferase (Kanr) gene in pKEK996 was removed by site-directed mutagenesis with primers KannoXhoIF and KannoXhoIR (Stratagene QuikChange), resulting in pKEK995. The groEL promoter (12) was PCR amplified from F. tularensis subsp. holarctica LVS chromosomal DNA using primers groELpDownBglIINotI and groELpUpEcoRIXhoI, digested with EcoRI and NotI, and ligated to pKEK995 digested similarly, resulting in pKEK1041. This step introduced the F. tularensis promoter that drives expression of the group II intron.

TABLE 2.

Oligonucleotides used in this study

Oligonucleotide Sequence (5′→3′)
TetUpXhoI GCGAATTCCTCGAGGCCGAGGATGACGATGAGCGC
TetDown CCAGCAGCCGCACGCGGCGCATG
pET15BUpSalI GGAATTCGTCGACTGCATTAGGAAGCAGCCCAGTAGT
FpKanUpNotI GCGAATTCGCGGCCGCTTCCTTTCGGGCTTTGTTAGCAGC
KannoXhoIF TGTTGGAATTTAATCGCGGCCTGGAGCAAGACGTTTCCCGTTGAAT
KannoXhoIR ATTCAACGGGAAACGTCGTGCTCCAGGCCGCGATTAAATTCCAACA
groELpDownBglIIXhoI GCAGATCTCTCGAGTGAAAAATAAACTTAATTATTATA
groELpUpEcoRIXhoI GCGAATTCCTCGAGAATGGACGAATGTTCATAACAATC
IntronXhoIF CCCCTCGAGAATACGCAAACCGCCTCTCCCCG
IntronSpeIR GGACTAGTATGCCCCGCGCCCACCG
RepAM1201F GGTCATTAATGCCACACATAATACAACTACAAGAGTAC
RepAM1201R GTACTCTTGTAGTTGTATTATGTGTGGCATTAATGACC
pKK214EcoNotI GCGAATTCGCGGCCGCATGCGCCGCGTGCGGCTGCTGG
pKK214EcoRIinverse GCGAATTCCTGCAGCCCGGGGGATCC
blaB102|103a-IBS AAAACTCGAGATAATTATCCTTAGATGCCAATTTTGTGCGCCCAGATAGGGTG
blaB102|103a-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCAATTTTTCTAACTTACCTTTCTTTGT
blaB102|103a-EBS2 TGAACGCAAGTTTCTAATTTCGATTGCATCTCGATAGAGGAAAGTGTCT
blaB214|215a-IBS AAAACTCGAGATAATTATCCTTATATCACAATCTAGTGCGCCCAGATAGGGTG
blaB214|215a-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCAATCTAAATAACTTACCTTTCTTTGT
blaB214|215a-EBS2 TGAACGCAAGTTTCTAATTTCGGTTTGATATCGATAGAGGAAAGTGTCT
iglC427|428a-IBS AAAACTCGAGATAATTATCCTTACTAAACTAGATAGTGCGCCCAGATAGGGTG
iglC427|428a-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCTAGATAGATAACTTACCTTTCTTTGT
iglC427|428a-EBS2 TGAACGCAAGTTTCTAATTTCGGTTTTTAGTCGATAGAGGAAAGTGTCT
iglC150|151s-IBS AAAACTCGAGATAATTATCCTTAAAACTCGATAAAGTGCGCCCAGATAGGGTG
iglC150|151s-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCGATAAAAATAACTTACCTTTCTTTGT
iglC150|151s-EBS2 TGAACGCAAGTTTCTAATTTCGATTAGTTTTCGATAGAGGAAAGTGTCT
iglC64|65s-IBS AAAACTCGAGATAATTATCCTTATTCATCTGAGAAGTGCGCCCAGATAGGGTG
iglC64|65s-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCTGAGAACTTAACTTACCTTTCTTTGT
iglC64|65s-EBS2 TGAACGCAAGTTTCTAATTTCGGTTATGAATCGATAGAGGAAAGTGTCT
blaBNcoIF GGCCATGGAACGTCTATTAGTTACAACTTTATC
blaBXmaIR GCGCCCGGGTGCAGATCAATCATTCTTATTATC
blaBNdeIR CCCGGGCATATGTTTATAAGTGTTAGTCAGATCATTAG
EBSUniversal CGAAATTAGAAACTTGCGTTCAGTAAAC
iglCNcoIF GGCCATGGAAATGATTATGAGTGAGATGATAACAAG
iglCNdeIR CCCGGGCATATGTGCAGCTGCAATATATCCTATTTTAG
FTL_0105R CCAACAGCTGCACCAACAAGTAACC
FTL_1152R ACTTTAGATCCTATAGTACCCCCTAAGGCTGAA
IntronRfrBsrG1 GCCATTTCCCAACGCGTCGCCACGTAATAAATATCT
IntronFatBsrG1 TGTACAATCTGTAGGAGAACCTATGGGAACGAAACG

The group II intron, LtrBLl, and associated intron-encoded protein LtrA coding sequences were PCR amplified from pACD4-C (Sigma-Aldrich) using primers IntronXhoIF and IntronSpeIR. The resulting PCR fragment was digested with XhoI and SpeI and ligated to pKEK1041 digested similarly, resulting in pKEK1058. Finally, the temperature-sensitive M120I mutation (28) was introduced into the F. tularensis ori (oriFt) repA gene in pKEK1058 via site-directed mutagenesis (Stratagene QuikChange) using primers RepAM1201F and RepAM120IR, resulting in pKEK1140 (Fig. 1).

Targeted mutagenesis in F. tularensis.

To target a specific F. tularensis gene for group II intron insertion, the ltrBLl intron in pKEK1140 was retargeted by replacing lacZ′, which is located between the XhoI and BsrGI sites, with a 350-bp PCR product. The PCR product retargeted LtrBLl by changing the nucleotide sequence of EBS1, EBS2, and the delta (δ) site to facilitate base pairing with IBS1, IBS2, and δ′ in the targeted gene (Fig. 1). The specific insertion sites chosen and the primers utilized for the retargeted PCR product were derived via the Sigma-Aldrich computer-based TargeTron algorithm. The algorithm identifies potential insertion sites within DNA sequences and assigns a score and e value for the probability of successful insertion into the sense (s) or antisense (a) DNA target strand. For each gene of interest, at least two potential insertion sites were chosen for targeting. The retargeted PCR products were generated in a splicing-by-overlap-extension PCR (18, 19) using primers (EBS1d, EBS2, and IBS) designed by the algorithm, along with the EBS universal primer and Intron PCR Template (Sigma-Aldrich, TA0100). An XhoI restriction site was substituted for the HindIII restriction site when synthesizing the IBS primers, for compatibility with the pKEK1140 vector. The PCR was carried out according to the manufacturer's instructions (Sigma-Aldrich). The resultant PCR products were digested with XhoI and BsrGI and ligated into pKEK1140 that was digested similarly.

Construction of F. tularensis targetron insertion mutants.

F. tularensis strains were transformed with the targetron vectors via electroporation. Briefly, mid-log-phase F. tularensis cultures, grown in TSAP, were washed twice and resuspended in 0.5 M sucrose and then electroporated with 1 μg of targetron plasmid (600 Ω, 25 μF, 2.5 kV; Bio-Rad Gene Pulser II). Electroporated cells were inoculated into TSAP, incubated at 30°C 1 h, and then plated onto TSAP-Kan and incubated at 30°C. In some instances, we also utilized cryotransformation to introduce the targetron plasmid into F. tularensis; this procedure has been described previously (24). Intron insertions were identified by PCRs with chromosomal DNA isolated from transformant colonies, using combinations of gene-specific and intron-specific primers. Intron insertions were verified by DNA sequencing. Frequently the 915-bp intron insertion could be detected within a mixed population of wild-type and mutant cells; in these instances pure populations of the mutant strains were obtained by additional plate streaking and PCR screens. Insertion mutants were cured of the targetron plasmid by growth on TSAP at 37°C. Loss of the plasmid was detected by lack of growth on TSAP-Kan.

Southern hybridization.

Southern hybridization was performed utilizing ECL detection systems (GE Healthcare) according to the manufacturer's instructions. A 400-bp intron-specific probe that was PCR amplified with oligonucleotides IntronSpeIR and IntronXhoIF (Table 2) was used for Southern blotting.

Western immunoblotting.

Whole-cell extracts of F. tularensis subsp. holarctica LVS strains were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to Western immunoblotting utilizing mouse monoclonal anti-IglD antibodies (a kind gift of F. Nano); detection was performed with the ECL detection kit (GE Healthcare).

Intramacrophage survival assay.

Wild-type or mutant F. tularensis strains were used to infect the J774.1 macrophage cell line (ATCC) at a multiplicity of infection of ∼10:1. Wells were seeded with ∼105 J774 cells, and bacterial inocula ranged from 1.56 × 106 to 5.8 × 106. After 1 h of incubation at 37°C, gentamicin (50 μg/ml) was added to the medium to eliminate extracellular organisms. The macrophage cells were lysed with 0.2% deoxycholate at 24 h postinfection, the lysate was plated on TSAP and incubated at 37°C, and CFU were enumerated.

Nucleotide sequence accession number.

The GenBank accession number for pKEK1140 is EU499313.

RESULTS

Development of a targetron for targeted gene inactivation in F. tularensis.

The TargeTron gene knockout system (Sigma-Aldrich) was optimized for use in F. tularensis (see Materials and Methods) (Fig. 1A). The targetron vector, pKEK1140, contains the following optimized attributes: (i) a plasmid origin for replication in F. tularensis (oriFt); (ii) a plasmid origin for replication in E. coli, to facilitate cloning (p15A ori); (iii) an antibiotic resistance gene (Kanr) optimized for expression in F. tularensis and permitted for use in select agent F. tularensis strains; (iv) the RNP (ltrBLl and LtrA) driven by the F. tularensis groEL promoter for optimized expression; (v) a lacZ′ “stuffer” within ltrBLl to facilitate cloning via blue-white screening; and (vi) a temperature-sensitive oriFt to facilitate curing of the plasmid following mutagenesis.

The basic principle (Fig. 1B and C) of this system is that base pairing between the two loops (EBS1 and EBS2) and δ site within the LtrBLl RNA structure and the target DNA sequence dictate the subsequent insertion event. Thus, changing (i.e., retargeting) the sequences of EBS1 and EBS2 to allow base pairing to the target site within the gene (IBS1 and IBS2) facilitates insertion of the intron into this specific sequence. Sequence elements that flank the IBS1 and IBS2 sites within the targeted gene are also recognized by the RNP complex. The TargeTron computer algorithm identifies potential insertion sites within any DNA sequence (33). For each F. tularensis gene targeted for inactivation, the TargeTron algorithm (Sigma-Aldrich) was used to identify potential insertion sites and to design primers necessary to retarget the LtrBLl intron. A PCR product that encompasses EBS1, EBS2, and δ in ltrBLl is amplified with specific primers utilizing splicing-by-overlap PCR. The PCR fragment is cloned between the XhoI and BsrGI sites in pKEK1140 to replace lacZα and retarget the group II intron. Blue-white screening on X-Gal medium expedited the identification of correct clones, which were verified by sequencing.

Efficiency of the targetron in three different subspecies of F. tularensis.

F. tularensis strains express a β-lactamase, encoded by blaB, which confers Ampr (6, 23, 27). To test the efficiency of the targetron system in three F. tularensis subspecies (F. tularensis subsp. tularensis, F. tularensis subsp. holarctica [LVS], and F. tularensis subsp. novicida), we utilized blaB as a target. The TargeTron algorithm identified nine potential insertion sites within blaB. We chose two targets, located between nucleotides 102 and 103 (102|103a) and between nucleotides 214 and 215 (214|215a). The RNP recognizes these targets on the antisense strand, and thus these targets are given the designation “a.” These target sites were chosen based on the score and e value derived from the algorithm (for 102|103a, score = 6.53 and e value = 0.313; for 214|215a, score = 8.48 and e value = 0.076). Both blaB target sites were identical in the genomes of F. tularensis subsp. tularensis, F. tularensis subsp. novicida, and F. tularensis subsp. holarctica (LVS), which allowed us to compare the efficiencies of targetron insertion across F. tularensis subspecies.

The two targetron plasmids targeting positions 102|103 (pKEK1181) and 214|215 (pKEK1180) in blaB were initially transformed into F. tularensis subsp. novicida. Primary transformants were screened for the Amps phenotype on TSAP supplemented with 1 mg/ml Amp. No Amps transformants (0/100) of the targetron target 214|215 were identified; however, 2/100 transformants of the targetron targeting 102|103 were Amps. Utilizing gene-specific and insertion-specific sets of primers (Fig. 2), PCR screens detected the group II intron insertion mutation of 915 bp in blaB in the Amps F. tularensis subsp. novicida colonies. Sequencing confirmed the insertion mutation at target 102|103, demonstrating that the targetron system is functional in F. tularensis subsp. novicida.

FIG. 2.

FIG. 2.

PCR analysis of F. tularensis blaB::ltrBLl mutants. Using combinations of gene-specific primers (primers a and b) and an intron-specific primer (primer c), PCR analysis was performed on genomic DNA from F. tularensis subspecies novicida strains U112 (wild type [WT]) (lanes 2 and 4) and KKF322 (lanes 3 and 5), F. tularensis subsp. holarctica strains LVS (WT) (lanes 6 and 8) and KKL4 (lanes 7 and 9), and F. tularensis subsp. tularensis strains Schu4 (WT) (lanes 10 and 12) and KKT1 (lanes 11 and 13). Primers (Table 2): a, blaBNcoIF; b, blaBXmaIR; and c, EBSUniversal.

To test the efficiency of this system across Francisella tularensis subspecies, we utilized the 102|103 blaB targetron in F. tularensis subsp. tularensis, F. tularensis subsp. holarctica (LVS), and F. tularensis subsp. novicida. The same conditions were used in all three subspecies to transform pKEK1181 into the strains and evaluate targetron insertion in blaB, which allowed us to determine the relative efficiency of this system in the various subspecies. Ten primary transformants of each subspecies were screened by PCR with an intron-specific and gene-specific primer pair, to confirm the presence of the targetron insertion in blaB (Fig. 3). The blaB targetron inserted at high efficiency in all three subspecies (10/10 positive for F. tularensis subsp. tularensis, 9/10 positive for F. tularensis subsp. holarctica LVS, and 9/10 positive for F. tularensis subsp. novicida). These same primary transformants did not consistently give an Amps phenotype in the presence of 1 mg/ml Amp and showed evidence of both wild-type and mutant blaB genes with blaB-specific primers, indicating mixed populations of mutant and wild-type cells in the primary transformants. Pure populations of blaB targetron mutants in each subspecies were easily obtained by subsequent plate streaking of the primary transformants for isolated colonies, followed by PCR screening. Amps colonies of each subspecies were analyzed by PCR to confirm that this phenotype correlated with ltrBLl insertion into blaB (Fig. 2).

FIG. 3.

FIG. 3.

PCR analysis of F. tularensis blaB targetron primary transformants. Using a blaB-specific primer and an intron-specific primer, PCR analysis was performed on genomic DNA from 10 primary transformants of F. tularensis subsp. tularensis (Ftt) (A), F. tularensis subsp. holarctica LVS (Fth) (B), and F. tularensis subsp. novicida (Ftn) (C) transformed with pKEK1181. Lane 1, 1-kbp ladder; lane 2, wild-type (WT) control (A, strain U112; B, strain LVS; C, strain Schu4); lanes 3 to 12, primary transformant colonies 1 to 10. Primers: blaBXmaIR and EBSUniversal (A and C) and blaBNdeIR and EBSUniversal (B) (Table 2).

Because the experiments reported above were performed at 30°C due to the temperature-sensitive targetron ori, we wished to determine whether the relative efficiency of blaB inactivation would be altered at 37°C. For these experiments, the 102|103 blaB targetron lacked the temperature-sensitive oriFt, enabling its use at 37°C. We found that performing the transformation and incubation at 37°C rather than 30°C had no apparent effect on the high efficiency of targetron insertion in any of the subspecies (data not shown).

For the blaB::ltrBLl insertion mutants in each subspecies, Southern hybridization analysis showed that a single intron insertion existed in the genome of each strain (Fig. 4) (an expected fragment of 2.9 kbp was detected for each strain). Thus, the blaB targetron proved to be an efficient means for targeted gene inactivation in the multiple subspecies of F. tularensis.

FIG. 4.

FIG. 4.

Southern blot analysis of F. tularensis targetron insertion mutants, showing NdeI digests of chromosomal DNA from F. tularensis subsp. novicida (Ftn) U112 (wild type [WT]) and KKF322 (blaB::ltrBLl) (A) and from F. tularensis subsp. holarctica (Fth) LVS (WT), KKL4 (blaB::ltrBLl), and KKL1 (iglC1::ltrBLl iglC2::ltrBLl) and F. tularensis subsp. tularensis (Ftt) Schu4 (WT) and KKT1 (blaB::ltrBLl) (B), utilizing an intron-specific probe (see Materials and Methods).

Simultaneous inactivation of duplicated FPI genes in F. tularensis.

The FPI is duplicated within F. tularensis subsp. holarctica and F. tularensis subsp. tularensis, necessitating stepwise inactivation of each copy of any specific FPI gene in order to study its function. The lack of efficient targeted mutagenesis tools combined with the duplication of the FPI genes has hampered efforts to study FPI genes in the virulent F. tularensis subsp. tularensis and F. tularensis subsp. holarctica strains; to date there has been only one report of an F. tularensis subsp. tularensis strain with both copies of the iglC gene inactivated (41). Because group II introns can insert and inactivate multiple genomic copies of their specific target sequence (35), we suspected that the targetron system would be useful in inactivating FPI genes. We constructed three targetron vectors targeted to three sites in iglC (64|65s, 150|151s, and 427|428a). All three sites are identical in the three different F. tularensis subspecies and had favorable scores and e values derived from the TargeTron algorithm (for 64|65s, score = 6.76 and e value = 0.274; for 150|151s, score = 7.97 and e value = 0.111; and for 427|428a, score = 6.09 and e value = 0.404).

F. tularensis subsp. holarctica strain LVS was transformed with the three iglC targetron plasmids at 30°C. Kanr colonies were screened by PCR, utilizing an intron-specific (EBS universal primer) and gene-specific (iglCNdeIF for 64|65 and 150|151 targets and iglCNcoIR for 427|428 target) primers to identify colonies in which the targetron insertion in iglC had occurred. Extensive screening of LVS transformed with targetron plasmids targeting 64|65 and 150|151 revealed no evidence of targetron insertion in iglC. However, the first five LVS colonies (100%) transformed with the targetron plasmid targeting 427|428 gave a positive PCR for insertion in iglC (Fig. 5).

FIG. 5.

FIG. 5.

PCR analysis of the F. tularensis subsp. holarctica (LVS) iglC1::ltrBLl iglC2::ltrBLl mutant. Using combinations of gene-specific primers (primers a and b), an intron-specific primer (primer c), and FPI-I- and FPI-II-specific primers (primers d and e) (A), PCR analysis was performed on genomic DNA from F. tularensis subspecies holarctica strains LVS (wild type [WT]) (lanes 2, 4, 6, 8, and 10) and KKL1 (lanes 3, 5, 7, 9, and 11) (B). Primers (Table 2): a, iglCNcoIF; b, iglCNdeIR; c, iglC427 428a-EBS2; d, FTL_0105R; e, FTL_1152R.

We further purified a single positive colony with evidence of an iglC::ltrBLl insertion and performed additional PCR analyses to determine whether both copies of iglC were inactivated by intron insertion in this strain. The two copies of the FPI (FPI-I and FPI-II) can be distinguished by PCR utilizing primers specific for the DNA flanking each FPI. Utilizing FPI-I- and FPI-II-specific primers together with an intron-specific primer, the PCR analysis revealed that the targetron inserted into both copies of iglC (Fig. 5). Additional evidence of insertion in both iglC genes was obtained by PCR amplification of each locus with FPI-I- and FPI-II-specific primers coupled with a primer that anneals downstream of the insertion site and then sequencing each iglC gene (Fig. 5). These experiments confirmed that iglC1 and iglC2 had been inactivated by simultaneous insertion of the intron in both genes.

The iglC1::ltrBLl iglC2::ltrBLl LVS mutant KKL1 was cured of the targetron plasmid by plate streaking and incubation at 37°C. Southern blot analysis confirmed that two intron insertions are present in the genome of this strain (Fig. 4B) (expected fragments of 14.5 kbp and 12.3 kbp were detected). IglC is known to be required for F. tularensis intramacrophage growth, and an LVS strain with only one copy of the iglC gene mutated replicates within macrophages similarly to the wild-type LVS strain (15). The iglC1::ltrBLl iglC2::ltrBLl LVS mutant was defective for intramacrophage growth within the J774 cell line (Fig. 6A). The iglD gene is immediately downstream of iglC, and IglD has also been shown to be necessary for intramacrophage growth (37). Western immunoblot analysis of whole-cell lysates from the iglC1::ltrBLl iglC2::ltrBLl LVS and parent strains with anti-IglD antibodies revealed that the targetron insertions in iglC cause reduced expression of IglD (Fig. 6B), indicating a polar effect of this targetron insertion. All of these data demonstrate that the iglC targetron vector facilitated insertional inactivation of both copies of iglC, indicating that the targetron system will facilitate the study of the duplicated FPI genes in the more virulent F. tularensis subspecies.

FIG. 6.

FIG. 6.

Intramacrophage growth of the F. tularensis subsp. holarctica (LVS) iglC1::ltrBLl iglC2::ltrBLl mutant. (A) The F. tularensis subsp. holarctica LVS wild-type and KKL1 (iglC1::ltrBLl iglC2::ltrBLl) strains were inoculated at a multiplicity of infection of ∼10:1 into J774 cells, and intracellular bacteria were enumerated at 3 and 24 h. The assay was performed in triplicate. (B) Western immunoblotting was performed on whole-cell lysates of F. tularensis subsp. holarctica LVS wild-type and KKL1 (iglC1::ltrBLl iglC2::ltrBLl) strains with mouse monoclonal anti-IglD antisera. Error bars indicate standard deviations.

DISCUSSION

F. tularensis is a potentially dangerous pathogen for humans, and yet very little is known about how it causes disease. The reasons for our lack of understanding are partly historical, since until recently there were very few researchers studying this organism. However, another reason is that the more virulent subspecies of F. tularensis (F. tularensis subsp. tularensis and F. tularensis subsp. holarctica) have proven to be more resistant to genetic modification than the less virulent F. tularensis subsp. novicida. While there are easy and efficient means for targeted mutagenesis in F. tularensis subsp. novicida (23, 25), these same techniques fail to work with F. tularensis subsp. tularensis and F. tularensis subsp. holarctica for unknown reasons. For example, F. tularensis subsp. novicida is readily transformed by linear DNA and integrates it into its genome, but this technique fails to work in F. tularensis subsp. tularensis and F. tularensis subsp. holarctica. The single technique that has been successfully employed to construct targeted mutations in F. tularensis subsp. tularensis and F. tularensis subsp. holarctica (15, 41) is a relatively inefficient and time-consuming process. This technique is frequently used to generate targeted mutations in a number of different bacteria, and it involves conjugation or transformation with a nonreplicative plasmid, selection for a plasmid cointegrant, and subsequent counterselection to achieve a second recombination and loss of the plasmid. We describe here a new system for targeted mutagenesis in F. tularensis that utilizes a retargeted group II intron for gene inactivation.

The targetron system has been optimized for use in F. tularensis, and we have demonstrated that it is functional in three different subspecies: F. tularensis subsp. tularensis, F. tularensis subsp. holarctica, and F. tularensis subsp. novicida. One of the advantages of group II introns is that, once expressed, the RNP is relatively host factor independent (9). Additionally, high levels of DNA transformation are not necessary, as they are for efficient homologous recombination procedures, because a single targetron plasmid can express multiple copies of the group II intron. Thus, the critical adaptation to making this system functional in F. tularensis was to ensure the expression of the targetron in F. tularensis. Importantly, the retargeted introns show high specificity for their target sequences and are unmarked (i.e., do not contain any antibiotic resistance gene), allowing for the constructed F. tularensis strains to be further genetically manipulated. The targetrons insert at high efficiency, so very little screening was required to identify the unmarked insertion mutation in iglC. The efficiency of insertion, at least with the blaB targetron, was equivalent for the more virulent F. tularensis subsp. tularensis and F. tularensis subsp. holarctica strains and the less virulent F. tularensis subsp. novicida strain. To our knowledge, this is the first genetic technique developed for F. tularensis that shows this pattern, since previous targeted knockout techniques have all shown lower efficiency in the more virulent subspecies.

We chose at least two different target sequences within each gene inactivated which were identified by the TargeTron computer algorithm (Sigma-Aldrich). This algorithm evaluates potential insertion sites within a given gene based on recognition preferences of the group II RNP complex, and it provides scores and e values that are based on known group II insertion sites. For the two genes we targeted in this report, we were able to create a targetron vector that inserted at relatively high efficiency. However, we also created targetron vectors for each gene that inserted at lower efficiencies. A comparison of the successful target sites allowed us to refine target site selection within F. tularensis (Fig. 1C). Potential targeted regions that consisted of a T, G, A, and T at positions −23, −21, −20, and +5, respectively, were successfully mutated. Additionally, the targetron can insert in a sense or antisense orientation relative to the coding sequence, and our successful insertions were all antisense. Using these general rules, we have also successfully utilized targetrons to inactivate the pilE4 and uvrA genes in LVS and the mglA gene in Schu4 (data not shown).

One of the greatest potential advantages of the group II introns is their ability to inactivate all target sites within their host. This capacity typically would have little relevance in haploid bacteria, but in the more virulent F. tularensis subsp. tularensis and F. tularensis subsp. holarctica strains, the FPI is found in two identical copies within the genome. Traditional techniques of gene inactivation targeting the duplicated FPI genes would be cumbersome and time-consuming. We demonstrate here that the targetron targeted to the FPI iglC gene inserted in both copies of this gene simultaneously in F. tularensis subsp. holarctica, resulting in an iglC1 iglC2 mutant in a single step. The targetron system will be helpful in constructing additional mutations in the duplicated FPI genes to elucidate the function of these critical virulence factors.

The potential drawback of group II intron insertion, as with most insertional mutagenesis techniques (e.g., transposons), is the possibility of polar effects on downstream gene expression within operons. The inserted group II intron sequence encodes stop codons in all six potential coding frames, and the intron transcript also readily forms a secondary structure. Both of these situations can lead to a decrease in expression of downstream genes, and we have shown that the iglC targetron insertions in F. tularensis subsp. holarctica LVS cause a decrease in expression of the downstream gene product IglD. Thus, this technique will not circumvent the more “traditional” means of creating in-frame deletions to obtain nonpolar mutations but rather provides a novel means of obtaining targeted polar insertion mutations. The polar nature of targetron insertions could be used to advantage in knocking out the expression of an entire operon by a single insertion in the first gene of the operon. Additionally, newer-generation targetrons that contain various inserted elements within the group II intron have been developed; it should be possible to insert an F. tularensis promoter into the intron sequence to enhance expression of downstream genes. Finally, insertions in monocistronic operons or in the terminal genes within operons will not be affected by polarity issues. The relative ease and efficiency of targetron insertions in three different F. tularensis subspecies should make this a valuable new tool for targeted mutagenesis of F. tularensis.

Acknowledgments

This study was supported by NIH grant PO1 AI57986 to K.E.K. and NIH grant GM060655 to S.A.R.

Footnotes

▿

Published ahead of print on 29 February 2008.

REFERENCES

  • 1.Anthony, L. S. D., R. D. Burke, and F. E. Nano. 1991. Growth of Francisella spp. in rodent macrophages. Infect. Immun. 59:3291-3296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Anthony, L. S., S. C. Cowley, K. E. Mdluli, and F. E. Nano. 1994. Isolation of a Francisella tularensis mutant that is sensitive to serum and oxidative killing and is avirulent in mice: correlation with the loss of MinD homologue expression. FEMS Microbiol. Lett. 124:157-165. [DOI] [PubMed] [Google Scholar]
  • 3.Anthony, L. S., M. Z. Gu, S. C. Cowley, W. W. Leung, and F. E. Nano. 1991. Transformation and allelic replacement in Francisella spp. J. Gen. Microbiol. 137:2697-2703. [DOI] [PubMed] [Google Scholar]
  • 4.Baron, G. S., S. V. Myltseva, and F. E. Nano. 1995. Electroporation of Francisella tularensis. Methods Mol. Biol. 47:149-154. [DOI] [PubMed] [Google Scholar]
  • 5.Bhatnagar, N., E. Getachew, S. Straley, J. Williams, M. Meltzer, and A. Fortier. 1994. Reduced virulence of rifampicin-resistant mutants of Francisella tularensis. J. Infect. Dis. 170:841-847. [DOI] [PubMed] [Google Scholar]
  • 6.Bina, X. R., C. Wang, M. A. Miller, and J. E. Bina. 2006. The Bla2 β-lactamase from the live-vaccine strain of Francisella tularensis encodes a functional protein that is only active against penicillin-class β-lactam antibiotics. Arch. Microbiol. 186:219-228. [DOI] [PubMed] [Google Scholar]
  • 7.Brotcke, A., D. S. Weiss, C. C. Kim, P. Chain, S. Malfatti, E. Garcia, and D. M. Monack. 2006. Identification of MglA-regulated genes reveals novel virulence factors in Francisella tularensis. Infect. Immun. 74:6642-6655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Charity, J. C., M. M. Costante-Hamm, E. L. Balon, D. H. Boyd, E. J. Rubin, and S. L. Dove. 2007. Twin RNA polymerase-associated proteins control virulence gene expression in Francisella tularensis. PLoS Pathog. 3:770-779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cousineau, B., D. Smith, S. Lawrence-Cavanagh, J. E. Mueller, J. Yang, D. Mills, D. Manias, G. Dunny, A. M. Lambowitz, and M. Belfort. 1998. Retrohoming of a bacterial group II intron: mobility via complete reverse splicing, independent of homologous DNA recombination. Cell 94:451-462. [DOI] [PubMed] [Google Scholar]
  • 10.Eigelsbach, H. T., and C. M. Downs. 1961. Prophylactic effectiveness of live and killed tularemia vaccines. I. Production of vaccine and evaluation in the white mouse and guinea pig. J. Immunol. 87:415-425. [PubMed] [Google Scholar]
  • 11.Ellis, J., P. C. Oyston, M. Green, and R. W. Titball. 2002. Tularemia. Clin. Microbiol. Rev. 15:631-646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ericsson, M., I. Golovliov, G. Sandstrom, A. Tarnvik, and A. Sjostedt. 1997. Characterization of the nucleotide sequence of the groE operon encoding heat shock proteins chaperone-60 and -10 of Francisella tularensis and determination of the T-cell response to the proteins in individuals vaccinated with F. tularensis. Infect. Immun. 65:1824-1829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fortier, A. H., S. J. Green, T. Polsinelli, T. R. Jones, R. M. Crawford, D. A. Leiby, K. L. Elkins, M. S. Meltzer, and C. A. Nacy. 1994. Life and death of an intracellular pathogen: Francisella tularensis and the macrophage. Immunol. Ser. 60:349-361. [PubMed] [Google Scholar]
  • 14.Frazier, C. L., J. San Filippo, A. M. Lambowitz, and D. A. Mills. 2003. Genetic manipulation of Lactococcus lactis by using targeted group II introns: generation of stable insertions without selection. Appl. Environ. Microbiol. 69:1121-1128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Golovliov, I., A. Sjostedt, A. Mokrievich, and V. Pavlov. 2003. A method for allelic replacement in Francisella tularensis. FEMS Microbiol. Lett. 222:273-280. [DOI] [PubMed] [Google Scholar]
  • 16.Gray, C. G., S. C. Cowley, K. K. Cheung, and F. E. Nano. 2002. The identification of five genetic loci of Francisella novicida associated with intracellular growth. FEMS Microbiol. Lett. 215:53-56. [DOI] [PubMed] [Google Scholar]
  • 17.Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:577-580. [DOI] [PubMed] [Google Scholar]
  • 18.Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59. [DOI] [PubMed] [Google Scholar]
  • 19.Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-68. [DOI] [PubMed] [Google Scholar]
  • 20.Karberg, M., H. Guo, J. Zhong, R. Coon, J. Perutka, and A. M. Lambowitz. 2001. Group II introns as controllable gene targeting vectors for genetic manipulation of bacteria. Nat. Biotechnol. 19:1162-1167. [DOI] [PubMed] [Google Scholar]
  • 21.Kuoppa, K., A. Forsberg, and A. Norqvist. 2001. Construction of a reporter plasmid for screening in vivo promoter activity in Francisella tularensis. FEMS Microbiol. Lett. 205:77-81. [DOI] [PubMed] [Google Scholar]
  • 22.Larsson, P., P. C. Oyston, P. Chain, M. C. Chu, M. Duffield, H. H. Fuxelius, E. Garcia, G. Halltorp, D. Johansson, K. E. Isherwood, P. D. Karp, E. Larsson, Y. Liu, S. Michell, J. Prior, R. Prior, S. Malfatti, A. Sjostedt, K. Svensson, N. Thompson, L. Vergez, J. K. Wagg, B. W. Wren, L. E. Lindler, S. G. Andersson, M. Forsman, and R. W. Titball. 2005. The complete genome sequence of Francisella tularensis, the causative agent of tularemia. Nat. Genet. 37:153-159. [DOI] [PubMed] [Google Scholar]
  • 23.Lauriano, C. M., J. R. Barker, F. E. Nano, B. P. Arulanandam, and K. E. Klose. 2003. Allelic exchange in Francisella tularensis using PCR products. FEMS Microbiol. Lett. 229:195-202. [DOI] [PubMed] [Google Scholar]
  • 24.Lauriano, C. M., J. R. Barker, S. S. Yoon, F. E. Nano, B. P. Arulanandam, D. J. Hassett, and K. E. Klose. 2004. MglA regulates transcription of virulence factors necessary for Francisella tularensis intraamoebae and intramacrophage survival. Proc. Natl. Acad. Sci. USA 101:4246-4249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Liu, J., X. Zogaj, J. R. Barker, and K. E. Klose. 2007. Construction of targeted insertion mutations in Francisella tularensis subsp. novicida. BioTechniques 43:487-492. [DOI] [PubMed] [Google Scholar]
  • 26.Long, M. B., J. P. Jones III, B. A. Sullenger, and J. Byun. 2003. Ribozyme-mediated revision of RNA and DNA. J. Clin. Investig. 112:312-318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.LoVullo, E. D., L. A. Sherrill, L. L. Perez, and M. S. Pavelka, Jr. 2006. Genetic tools for highly pathogenic Francisella tularensis subsp. tularensis. Microbiology 152:3425-3435. [DOI] [PubMed] [Google Scholar]
  • 28.Maier, T. M., A. Havig, M. Casey, F. E. Nano, D. W. Frank, and T. C. Zahrt. 2004. Construction and characterization of a highly efficient Francisella shuttle plasmid. Appl. Environ. Microbiol. 70:7511-7519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Martinez-Abarca, F., and N. Toro. 2000. Group II introns in the bacterial world. Mol. Microbiol. 38:917-926. [DOI] [PubMed] [Google Scholar]
  • 30.McLendon, M. K., M. A. Apicella, and L. A. Allen. 2006. Francisella tularensis: taxonomy, genetics, and immunopathogenesis of a potential agent of biowarfare. Annu. Rev. Microbiol. 60:167-185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Mohr, G., D. Smith, M. Belfort, and A. M. Lambowitz. 2000. Rules for DNA target-site recognition by a lactococcal group II intron enable retargeting of the intron to specific DNA sequences. Genes Dev. 14:559-573. [PMC free article] [PubMed] [Google Scholar]
  • 32.Nano, F. E., N. Zhang, S. C. Cowley, K. E. Klose, K. K. Cheung, M. J. Roberts, J. S. Ludu, G. W. Letendre, A. I. Meierovics, G. Stephens, and K. L. Elkins. 2004. A Francisella tularensis pathogenicity island required for intramacrophage growth. J. Bacteriol. 186:6430-6436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Perutka, J., W. Wang, D. Goerlitz, and A. M. Lambowitz. 2004. Use of computer-designed group II introns to disrupt Escherichia coli DExH/D-box protein and DNA helicase genes. J. Mol. Biol. 336:421-439. [DOI] [PubMed] [Google Scholar]
  • 34.Petrosino, J. F., Q. Xiang, S. E. Karpathy, H. Jiang, S. Yerrapragada, Y. Liu, J. Gioia, L. Hemphill, A. Gonzalez, T. M. Raghavan, A. Uzman, G. E. Fox, S. Highlander, M. Reichard, R. J. Morton, K. D. Clinkenbeard, and G. M. Weinstock. 2006. Chromosome rearrangement and diversification of Francisella tularensis revealed by the type B (OSU18) genome sequence. J. Bacteriol. 188:6977-6985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rawsthorne, H., K. N. Turner, and D. A. Mills. 2006. Multicopy integration of heterologous genes, using the lactococcal group II intron targeted to bacterial insertion sequences. Appl. Environ. Microbiol. 72:6088-6093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Rohmer, L., C. Fong, S. Abmayr, M. Wasnick, T. J. Larson Freeman, M. Radey, T. Guina, K. Svensson, H. S. Hayden, M. Jacobs, L. A. Gallagher, C. Manoil, R. K. Ernst, B. Drees, D. Buckley, E. Haugen, D. Bovee, Y. Zhou, J. Chang, R. Levy, R. Lim, W. Gillett, D. Guenthener, A. Kang, S. A. Shaffer, G. Taylor, J. Chen, B. Gallis, D. A. D'Argenio, M. Forsman, M. V. Olson, D. R. Goodlett, R. Kaul, S. I. Miller, and M. J. Brittnacher. 2007. Comparison of Francisella tularensis genomes reveals evolutionary events associated with the emergence of human pathogenic strains. Genome Biol. 8:R102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Santic, M., M. Molmeret, J. R. Barker, K. E. Klose, A. Dekanic, M. Doric, and Y. Abu Kwaik. 2007. A Francisella tularensis pathogenicity island protein essential for bacterial proliferation within the host cell cytosol. Cell. Microbiol. 9:2391-2403. [DOI] [PubMed] [Google Scholar]
  • 38.Santic, M., M. Molmeret, K. E. Klose, S. Jones, and Y. A. Kwaik. 2005. The Francisella tularensis pathogenicity island protein IglC and its regulator MglA are essential for modulating phagosome biogenesis and subsequent bacterial escape into the cytoplasm. Cell. Microbiol. 7:969-979. [DOI] [PubMed] [Google Scholar]
  • 39.Saslaw, S., and H. N. Carlisle. 1961. Studies with tularemia vaccines in volunteers. IV. Brucella agglutinins in vaccinated and nonvaccinated volunteers challenged with Pasteurella tularensis. Am. J. Med. Sci. 242:166-172. [DOI] [PubMed] [Google Scholar]
  • 40.Sjostedt, A. 2003. Virulence determinants and protective antigens of Francisella tularensis. Curr. Opin. Microbiol. 6:66-71. [DOI] [PubMed] [Google Scholar]
  • 41.Twine, S., M. Bystrom, W. Chen, M. Forsman, I. Golovliov, A. Johansson, J. Kelly, H. Lindgren, K. Svensson, C. Zingmark, W. Conlan, and A. Sjostedt. 2005. A mutant of Francisella tularensis strain SCHU S4 lacking the ability to express a 58-kilodalton protein is attenuated for virulence and is an effective live vaccine. Infect. Immun. 73:8345-8352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Yao, J., and A. M. Lambowitz. 2007. Gene targeting in gram-negative bacteria by use of a mobile group II intron (“targetron”) expressed from a broad-host-range vector. Appl. Environ Microbiol. 73:2735-2743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Yao, J., J. Zhong, Y. Fang, E. Geisinger, R. P. Novick, and A. M. Lambowitz. 2006. Use of targetrons to disrupt essential and nonessential genes in Staphylococcus aureus reveals temperature sensitivity of Ll. LtrB group II intron splicing. RNA 12:1271-1281. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES