Abstract
Background
Inherited bacteria have come to be recognised as important components of arthropod biology. In addition to mutualistic symbioses, a range of other inherited bacteria are known to act either as reproductive parasites or as secondary symbionts. Whilst the incidence of the α-proteobacterium Wolbachia is relatively well established, the current knowledge of other inherited bacteria is much weaker. Here, we tested 136 arthropod species for a range of inherited bacteria known to demonstrate reproductive parasitism, sampling each species more intensively than in past surveys.
Results
The inclusion of inherited bacteria other than Wolbachia increased the number of infections recorded in our sample from 33 to 57, and the proportion of species infected from 22.8% to 32.4%. Thus, whilst Wolbachia remained the dominant inherited bacterium, it alone was responsible for around half of all inherited infections of the bacteria sampled, with members of the Cardinium, Arsenophonus and Spiroplasma ixodetis clades each occurring in 4% to 7% of all species. The observation that infection was sometimes rare within host populations, and that there was variation in presence of symbionts between populations indicates that our survey will itself underscore incidence.
Conclusion
This extensive survey demonstrates that at least a third of arthropod species are infected by a diverse assemblage of maternally inherited bacteria that are likely to strongly influence their hosts' biology, and indicates an urgent need to establish the nature of the interaction between non-Wolbachia bacteria and their hosts.
Background
The last 20 years have witnessed an explosion of interest in reproductive parasites: maternally inherited microbial infections of arthropods that manipulate the reproduction of their host species towards the production or survival of infected female hosts. This interest has come largely from the study of one bacterium, Wolbachia. This bacterium was found to be associated with a variety of different manipulations: forcing asexuality on its host, feminising hosts, inducing incompatibility between infected males and uninfected (or differently infected) females, killing males and, most recently, being required for oogenesis [1-4]. Each of these manipulations has been fascinating in its own right, and is also of ecological and evolutionary importance to the particular host species that is infected, potentially inducing reproductive isolation, driving changes in sexuality, or alteration in reproductive ecology [5-7]. They also engender strong selection against their action, driving some of the fastest natural selection observed in the field [8]. Wolbachia was also found to be common [9,10]. Thus, the effects described above in particular species were likely to be widely important.
Until recently, work in the field of reproductive parasitism has been biased towards Wolbachia, and the potential importance of inherited parasites has generally been equated with the importance of Wolbachia. Within the last five years, a second inherited bacterium, Cardinium, has received increasing attention. Found in fewer species than Wolbachia [11,12], its list of manipulation phenotypes is almost as impressive [13-20]. However, Wolbachia and Cardinium are just two of many bacterial lineages known to act as reproductive parasites. To date, five other bacterial reproductive parasites, unrelated to Wolbachia and Cardinium, have been recorded in the genera Arsenophonus, Rickettsia, non-Cardinium members of the Flavobacterium clade and Spiroplasma (listed in Table 1). Manipulation of host reproduction has been demonstrated in at least one member of each of these clades, although in other cases the nature of the interaction with the host is currently uncertain and reproductive parasitism is unlikely [21-23].
Table 1.
Organism | Phenotype | Host | Reference |
α-PROTEOBACTERIA | |||
Rickettsia sp. | P | Neochrysocharis formosa (Hymenoptera: Eulophidae) | [64] |
MK | Brachys tessellatus (Coleoptera: Buprestidae) | [65] | |
Adalia bipunctata (Coleoptera: Coccinellidae) | [66] | ||
Adalia decempunctata (Coleoptera: Coccinellidae) | [67] | ||
Wolbachia pipientis | CI | Culex pipiens (Diptera: Culicidae)* | [68] |
F | Armadillidium vulgare (Isopoda: Armidillidiidae)* | [32] | |
P | Trichogramma spp (Hymenoptera: Pteromelidae)* | [32,69] | |
MK | Acraea encedon (Lepidoptera: Nymphalidae)* | [59] | |
Oogenesis | Asobara tabida (Hymenoptera: Braconidae)* | [1] | |
γ-PROTEOBACTERIA | |||
Arsenophonus nasoniae | MK | Nasonia vitripennis (Hymenoptera: Pteromelidae) | [62] |
BACTEROIDETES | |||
Cardinium hertigii | CI | Encarsia pergendiella (Hymenoptera: Aphelinidae) | [14] |
Eotetranychus suginamensis (Acari: Tetranychidae) | [13] | ||
F | Brevipalpus spp (Acari: Tenuipalpidae) | [17] | |
P | Encarsia ssp (Hymenoptera: Aphelinidae) | [19,20] | |
Aspidiotus nerii (Hemiptera: Diaspididae) | [16] | ||
Flavobacterium sp. | MK | Adonia variegata (Coleoptera: Coccinellidae) | [70] |
Coleomegilla maculata (Coleoptera: Coccinellidae) | [38] | ||
MOLLICUTES | |||
Spiroplasma ixodetis | MK | Adalia bipunctata (Coleoptera: Coccinellidae) | [56] |
Anisosticta novemdecimpunctata (Coleoptera: Coccinellidae) | [57] | ||
Harmonia axyridis (Coleoptera: Coccinellidae) | [71] | ||
Danaus chrysippus (Lepidoptera: Nymphalidae) | [58] | ||
S. poulsonii | MK | Drosophila willistoni group (Diptera: Drosophilidae) | [41] |
CI, cytoplasmic incompatibility; F, feminisation of genetic males; P, thelytokous parthenogenesis; MK, male killing. *The list of Wolbachia hosts is not exhaustive and only the species from which an effect was discovered first is reported.
The incidence of Wolbachia [9,10], and more recently Cardinium [11,12], have received much attention in studies of arthropod biology. However, the incidence of the broader spectrum of inherited bacteria associated with reproductive parasitism is not known, apart from focussed studies of spiders [22,24] and Drosophila [25]. In addition, a generally low sampling intensity per species for which screens have taken place in previous surveys may have resulted in the underscoring of Wolbachia and Cardinium infections, as some reproductive parasite infections are rare within a host species [22,26,27]. The global diversity of reproductive parasites in their natural contexts and the nature of the interactions with their hosts thus remain to be characterised in depth. Here we test a range of arthropods for the presence of the seven known reproductive parasite clades within the eubacteria, estimating incidence, prevalence and geographical variation between natural populations of arthropods. We sample each species more intensively than in past surveys; that is, primarily more than 10 individuals per species. Lastly, we estimate the relatedness of bacterial strains from our collection to strains recorded previously. We conclude that two other inherited bacteria, members of the clade Arsenophonus and members of the Spiroplasma ixodetis clade, are important associates of insects and demand further study.
Methods
Arthropod collection
Specimens belonging to major families of terrestrial arthropods were collected from various field sites, principally in Western Europe (2004–2006). Species were identified based on the morphology of specimens, and the sex was identified wherever possible through genital morphology. The species screened and their origins are presented in Additional file 1. Most of the spider collection came from a previous study [22]. One population per species was generally analysed, except for seven species for which two to three distinct populations were collected. Within each population there were 1 to 25 individuals separately investigated for analysis. Arthropods were fixed in 95% ethanol and stored at 4°C until analysed. Specimens were separated during storage so as to avoid any potential inter-individual transmission.
Screening and sequencing
Arthropod DNA was extracted using the PROMEGA Wizard® SV 96 Genomic DNA Purification System following the instructions of the manufacturer. DNA extraction was performed on the entire body or abdominal tissue rather than legs, to reduce the risk of missing infection with reproductive parasites when they are present (false negatives). The DNA quality was systematically tested using polymerase chain reaction (PCR) amplification of a conserved region of the arthropod 18S rDNA using primers listed in Table 2. Infections have been investigated in each individual host for seven reproductive parasites: spotted fever group Rickettsia, Wolbachia, Arsenophonus, Cardinium, male killers (MKs) within the flavobacteria, S. ixodetis and S. poulsonii. Independent assays for infection by each reproductive parasite were performed using PCR amplification of a fragment of either the 16S rDNA gene or the 17-kDa ompA gene using specific primers (Table 2). Infected-positive individuals were used as positive controls in each PCR assay (Table 2). Additional PCR amplifications of the Wolbachia surface protein gene (wsp) were completed in some cases to differentiate the diversity of strains present (primers listed in Table 2). PCRs were performed under the following conditions: initial denaturation at 95°C for 2 minutes, 35 cycles of denaturation (94°C, 30 seconds), annealing (50 to 55°C, depending on primers, 30 seconds), extension (72°C, 1 minute to 1 minute 30 seconds) and a final extension at 72°C for 5 minutes. The PCR products were electrophoresed in a 1.5% agarose gel. Where a PCR product was obtained, this was sequenced from two randomly sampled individuals per infected species to ensure that the record represented a true positive and not a PCR artefact or related bacterium. PCR products were sequenced directly (through both strands) and analysed using the Basic Local Alignment Search Tool (BLAST) to establish that they were within the target clade. The relationship between strains was then estimated. Sequences were first aligned and modified visually using MEGA version 3.1 [28]. Phylogenetic analyses were conducted by the neighbour-joining (NJ) method and the maximum-parsimony (MP) method using MEGA version 3.1 [28]. NJ phylogenies were constructed based upon unambiguously aligned sites using the Tajima-Nei model of nucleotide substitution [29]. MP phylogenies were constructed using the close-neighbour-interchange method [30]. Bootstrap probabilities were calculated by generating 1000 bootstrap replicates. The sequences are deposited in GenBank (accession numbers EU333926–EU333941 and EU727094–EU727140).
Table 2.
Organism | Gene | Primer (5' – 3') | Annealing temperature | Positive control | Size | Reference |
Arthropods | 18S rDNA | NSF4/18 – CTGGTTGATYCTGCCAGT * | 54°C | Any arthropod | 400–450 bp | [72,73] |
NSR399/19 – TCTCAGGCTCCYTCTCCGG * | ||||||
Rickettsia sp. | 17-kDa | R1 – GCTCTTGCAACTTCTATGTT * | 54°C | Adalia decempunctata | 434 bp | [67] |
R2 – CATTGTTCGTCAGGTTGGCG * | ||||||
Wolbachia pipientis | 16S rDNA | 16Swolb76-99f – TTGTAGCCTGCTATGGTATAACT * | 54°C | Culex pipiens | 896 bp | [74] |
16Swolb1012-994r – GAATAGGTATGATTTTCATGA * | ||||||
wsp | 81F – TGGTCCAATAAGTGATGAAGAAAC | 50°C | 81F/522R: Aedes albopictus – wAlbB | 442 bp | [75] | |
136F – TGAAATTTTACCTCTTTTC | 172F/691R: Aedes albopictus – wAlbA | 514 bp | ||||
172F – ACCTATAAGAAAGACAAG | 81F/484R: Protocalliphora sp. – wA2 | 380 bp | ||||
484R – TTTGATCATTCACAGCGT | 136F/691R: Protocalliphora sp. – wA1 | 516 bp | ||||
522R – ACCAGCTTTTGCTTGATA | ||||||
691R – AAAAATTAAACGCTACTCCA | ||||||
Arsenophonus nasoniae | 16S rDNA | ArsF – GGGTTGTAAAGTACTTTCAGTCGT * | 52°C | ArsF, ArsF3/ArsR2, ArsR3: Nasonia vitripennis | 581–804 bp | This study |
ArsF2 – CCCTAAGCTTAACTTAGGA * | ArsF2/ArsR2: Polistes nympha | 612 bp | ||||
ArsF3 – GTCGTGAGGAARGTGTTARGGTT * | ||||||
ArsR2 – GTAGCCCTRCTCGTAAGGGCC * | ||||||
ArsR3 – CCTYTATCTCTAAAGGMTTCGCTGGATG * | ||||||
Cardinium hertigii | 16S rDNA | CLO-f1 – GGAACCTTACCTGGGCTAGAATGTATT * | 54°C | Holocnemus pluchei | CLO-f1/CLO-r1: 466 bp | [13] |
CLO-r1 – GCCACTGTCTTCAAGCTCTACCAAC * | ChF/CLO-r1: 953 bp | |||||
ChF – TACTGTAAGAATAAGCACCGGC | [12] | |||||
Flavobacterium sp. | 16S rDNA | FlavF – CGAATAAGTRTCGGCAAACTCCG * | 52°C | Coleomegilla maculata | 530 bp | This study |
FlavR – CTAAACTRTTTCYAGCTTATTCG * | ||||||
Spiroplasma ixodetis | 16S rDNA | SpixoF – TTAGGGGCTCAACCCCTAACC * | 52°C | Adalia bipunctata | 810 bp | This study |
SpixoR – TCTGGCATTGCCAACTCTC * | ||||||
S. poulsonii | 16S rDNA | SpoulF – GCTTAACTCCAGTTCGCC * | 55°C | Drosophila melanogaster | 421 bp | [42] |
SpoulR – CCTGTCTCAATGTTAACCTC * |
The sizes of PCR products provided are those of positive controls in base pairs (bp). *Primers used in initial screen of the arthropod collection; the other primers were used to obtain additional sequences.
Results
Distribution of infection
We assayed for the presence of 7 putative reproductive parasites in 2052 individual arthropods from 136 species encompassing 115 genera, 36 families, 15 orders and three classes. All host DNA samples retained for analysis were positive for PCR amplification using the 18S rDNA arthropod universal primers, indicating satisfactory DNA template quality (less than 1% of DNA templates failed to amplify the 18S rDNA fragment by PCR). Of the 136 species examined, PCR assay indicated the occurrence of infections by putative bacterial reproductive parasites in 44 species (32.4%). Wolbachia was found to infect 31 species (22.8%), S. ixodetis infected 9 species (6.6%), Arsenophonus infected 6 species (4.4%), Cardinium infected 6 species (4.4%), spotted fever group Rickettsia infected 1 species (0.7%) and S. poulsonii infected 1 species (0.7%); see Table 3 and Additional file 2.
Table 3.
Taxon | Number of species | Number of individuals | Number of infected species (number of infected individuals) | |||||||
Rickettsia | Wolbachia | Cardinium | Arsenophonus | Flavobacterium | Spiroplasma ixodetis | S. poulsonii | multi-infection | |||
ARACHNIDA | ||||||||||
Araneae | 26 | 516 | _ | 10 (78) | 6 (60) | 1 (32) | _ | 5 (41) | 1 (12) | 5 (22) |
Ixodidae | 4 | 77 | _ | _ | _ | _ | _ | _ | _ | _ |
Opiliones | 1 | 16 | _ | _ | _ | _ | _ | _ | _ | _ |
Scorpiones | 1 | 1 | _ | _ | _ | _ | _ | _ | _ | _ |
INSECTA | ||||||||||
Blattaria | 1 | 23 | _ | _ | _ | 1 (23) | _ | _ | _ | _ |
Coleoptera | 26 | 401 | 1 (1) | 1 (12) | _ | _ | _ | 1 (6) | _ | _ |
Dermaptera | 1 | 16 | _ | _ | _ | _ | _ | _ | _ | _ |
Diptera | 25 | 310 | _ | 3 (72) | _ | 2 (17) | _ | 1 (6) | _ | 2 (32) |
Hemiptera | 21 | 271 | _ | 7 (104) | _ | 1 (12) | _ | 2 (11) | _ | 2 (11) |
Hymenoptera | 11 | 104 | _ | 1 (13) | _ | 1 (20) | _ | _ | _ | 1 (20) |
Lepidoptera | 7 | 75 | _ | 3 (29) | _ | _ | _ | _ | _ | _ |
Mantodea | 2 | 9 | _ | _ | _ | _ | _ | _ | _ | _ |
Odonata | 1 | 21 | _ | _ | _ | _ | _ | _ | _ | _ |
Orthoptera | 5 | 72 | _ | 2 (12) | _ | _ | _ | _ | _ | _ |
MALACOSTRACA | ||||||||||
Isopoda | 4 | 140 | _ | 3 (46) | _ | _ | _ | _ | _ | _ |
TOTAL | 136 | 2052 | 1 (1) | 31 (366) | 6 (60) | 6 (104) | _ | 9 (64) | 1 (12) | 10 (85) |
For Wolbachia, 29 single infections were observed (as ascertained through direct sequences of PCR products that were easily readable without messy peaks) and two multiple infections (with messy peaks). That these were double infections was ascertained through the observation of a clean sequence using primer pairs that distinguish clades within Wolbachia, making a total of 33 strains detected. Arsenophonus was also observed as a double infection in one species, Polistes nimpha, where direct sequence indicated more than one infection; strains were differentiated using the ArsF3/ArsR3 and ArsF2/ArsR2 pairs of 16S rDNA primers. Thus, seven Arsenophonus infections were observed in total. Cardinium, Rickettsia, S. ixodetis and S. poulsonii where present were observed solely as single infections. Thus, in total we obtained 57 different strains allied to inherited parasites in our sample, 33 Wolbachia and 24 'non-Wolbachia'. Co-infection by strains of unrelated bacteria (such as Wolbachia and Cardinium) was observed in 8 of the 44 infected species (Table 3 and Additional file 2). Adding in the three species co-infected with different strains of the same bacterium, 10 species were finally infected by a diverse assemblage of bacterial strains. However, in only nine species did this reflect co-infection at the individual level.
Note that the assays for flavobacteria, Arsenophonus and Spiroplasma poulsonii also resulted in false positives for these bacteria (a band was present, but the sequence was outside of the target clade). In the case of the flavobacterium, a member of the beneficial clade of inherited bacteria, Blattabacterium, was detected in Loboptera decipiens, a cockroach, and a known obligate symbiont in Icerya purchasi, a scale insect. In the case of Arsenophonus, Sodalis sp. was detected in one of the 136 species (0.7%), Providencia sp. in two (1.5%), Pectobacterium sp. in two (1.5%), Pantoea sp. in one (0.7%) and Serratia sp. in one (0.7%). Of these, Sodalis is known to be an inherited bacterium, and the others are likely to represent gut or environmental contaminants. In the case of the S. poulsonii assay, two spiroplasmas from outside the citri clade were amplified, whose relationship with the host species is uncertain. These infections were all excluded from further analysis.
We asked four questions of the true positive infections. First, do inherited parasites differ in incidence? Second, are there any host taxa where infection is more or less common than expected? Third, what is the prevalence of infection in different species, and is there any evidence of sex bias in infection prevalence that would indicate sex-ratio distortion activity? Fourth, does narrow geographic sampling cause an underestimation of incidence?
With respect to the first question, Wolbachia was found to infect significantly more species than the other maternally inherited bacteria (P < 0.001, Fisher's exact test). Wolbachia was found in most families of three classes of terrestrial arthropods (Arachnida, Insecta and Malacostraca; Table 3 and Additional file 1). The point estimate of 22.8% of species infected with Wolbachia in this study is numerically higher than recorded previously, but still lies close to the range of values previously reported in wide surveys of arthropods (incidence from 16.6% [9] to 19.3% [10]; all P > 0.18, Fisher's exact test).
The second question we examined was: are there any host taxa where infection with reproductive parasites is more common? Four orders were sampled with more than 20 species: Araneae, Coleoptera, Diptera and Hemiptera. Infection incidence varied between these taxa (Fisher's exact test, P = 0.002). As suggested previously, the Araneae were a particular hotspot (with 16 species infected out of 26; 61.5%) having higher incidence than Coleoptera (P = 0.001) and Diptera (P = 0.004) but not Hemiptera (P = 0.15). However, the three insect clades remain homogeneous (P = 0.19), although the Hemiptera (8 out of 21 species infected; 38.1%) has a higher incidence than Coleoptera (4 out of 26; 15%) and Diptera (5 out of 25; 20%). The Araneae (spiders) was a particular hotspot for Cardinium, with Wolbachia and S. ixodetis infections also more common in the spider sample than in those of other arthropods. Notably, results from assays of individuals via templates derived from abdomen were reflected precisely by results from the template derived from legs, indicating that the infections that were detected were internalised within the host, and not derived from the contents of the gut. Despite representing less than 20% of the total species sample, all six Cardinium infections were found in this group (Fisher's exact test, P < 0.001). Five of the nine S. ixodetis infected species and 10 of 30 Wolbachia infected species were also in the Araneae, both of which are cases of over-representation (Fisher's exact test incidence in Araneae versus others; P < 0.025 in each case). Of the four infections represented more than once in the data set, only Arsenophonus was not over-represented in spiders (1 of 26 Araneae species versus 5 of 110 non-Araneae; Fisher's exact test, P > 0.5).
The third question we asked related to the prevalence of these bacteria and the effect of screening depth on the incidence discovered. Inherited bacteria exist at a variety of prevalence levels in natural populations, from 1% to 100% of individuals. Where Wolbachia infection was observed in a host species, prevalence ranged from rare (5%) to very common (100%) at the population level (Table 4 and Additional file 1). Wolbachia infection was generally fixed, or close to fixation, except in spiders where prevalence was more variable (5% to 95%). In Cardinium, S. ixodetis and S. poulsonii-infected species, low and medium prevalence (15% to 75%) was observed in all cases, and infection was never observed in all specimens. In the Rickettsia-infected species, only 1 individual (8.3%) out of 12 was positive for infection. In the case of Arsenophonus, prevalence reached systematically high values (>75%) and infection was frequently fixed, except in the case of Arsenophonus infection in the fly Protocalliphora sp. (2 infected individuals out of 12; 16.7%). Aside from the Protocalliphora datum, Arsenophonus prevalence data contrasted with the original record of Arsenophonus nasoniae, which infected just 4% of individuals in the wasp Nasonia vitripennis [31].
Table 4.
Prevalence in species | All | Rickettsia | Wolbachia | Arsenophonus | Cardinium | Flavobacterium | Spiroplasma ixodetis | S. poulsonii |
High (P ≥ 0.80) | 29 (0.51) | _ | 22 (0.67) | 6 (0.86) | _ | _ | _ | _ |
Medium (0.20 ≥ P > 0.80) | 22 (0.39) | _ | 7 (0.21) | _ | 6 (1.00) | _ | 8 (0.89) | 1 (1.00) |
Low (P < 0.20) | 7 (0.12) | 1 (1.00) | 4 (0.12) | 1 (0.14) | _ | _ | 1 (0.11) | _ |
Total | 57 | 1 | 33 | 7 | 6 | _ | 9 | 1 |
We also examined the data for sex bias in infection prevalence, as an indication of potential sex ratio distorting activity. Bacteria other than Wolbachia showed no evidence of sex-biased prevalence (all P > 0.08, Fisher's exact test; see Additional file 1). Wolbachia did show evidence for sex-biased prevalence in some cases. Three species, Meta mengei (Tetragnathidae), Tetragnatha montana (Tetragnathidae) and Armadillidium vulgare (Armadillidiidae) carried Wolbachia infection more commonly in females than males (P = 0.001, 0.03 and 0.0001, respectively, Fisher's exact test) but only M. mengei and A. vulgare displayed a significant difference after sequential Bonferroni correction for multiple comparisons (feminising Wolbachia was previously evidenced in A. vulgare; compare with [32]). Whilst there was no evidence to reject the null hypothesis of equal prevalence in male and females in other cases, we would note that in all spider species (apart from Pholcus phalangioides) and in the moth Chilo sp. (Crambidae), Wolbachia infection was generally rarer in males than females, or was even absent in males, suggesting more intensive sampling would be useful. Furthermore, males do not exist in the parthenogenetic wasp Diplolepis rosae (Cynipidae) and all of the females sampled were Wolbachia-positive.
The fourth question related to the presence of geographic variation in incidence that may potentially produce underscoring of incidence where one population alone is sampled. We examined specimens from different locations in seven species (see Additional file 1). Four of the species showed no variation in infection presence between locations: the different populations of Argiope lobata (Araneidae) and Cetonia aurata (Scarabaeidae) were uninfected in all locations and P. phalangioides and A. vulgare were infected with the same strain (based on 16S rDNA sequences) wherever sampled. In contrast, in Linyphia triangularis (Linyphiidae), Cylisticus convexus (Cylisticidae) and Porcellio dilatatus (Porcellionidae), the infection presence varied between the populations sampled. In C. convexus and P. dilatatus, there was one Wolbachia-infected and one uninfected population, which in the case of P. dilatatus related to sub-specific status (P. d. petiti was infected whereas P. d. dilatatus was not; see Additional file 1). In the case of L. triangularis, the two United Kingdom populations were infected by Wolbachia, but the population from Germany was not (P = 0.004, Fisher's exact test; see Additional file 1). Cardinium infection was observed to be common in both the United Kingdom and German L. triangularis populations, and the prevalence did not differ significantly between populations (P = 0.27, Fisher's exact test).
Phylogenetic analysis
The phylogenetic relationships amongst each group of inherited bacterium was estimated using the sequences obtained in this study (including those of non-inherited bacteria), as well as sequences from other hosts available in GenBank. Topologies of the trees obtained under MP were similar to the NJ trees presented in Additional files 3 to 7. Each bacterial group formed a distinct and robust monophyletic clade of arthropod symbionts. Within each group, very closely related symbionts were frequently found in distantly related arthropod hosts.
Arthropods from this study carried Wolbachia strains belonging to four supergroups (A, B, F and G) of the eight currently recognised within the Wolbachia clade (A to H; see [33]). Although the Wolbachia phylogeny was primarily constructed based on the 16S rDNA sequences from mono-infected species (Additional file 3A), the phylogeny of the Wolbachia strains occurring in multi-infection (such as in Aedes albopictus and Protocalliphora sp.) have been established using the wsp sequences (Additional file 3B). Most Wolbachia strains (20 out of 33 strains; 60.6%) belonged to the B supergroup. Six Wolbachia strains (18.2%) belonged to the A supergroup, five (15.2%) to the G supergroup and one (3.0%) to the F supergroup. However, the L. triangularis Wolbachia could not be attached to any supergroup currently described, although it clustered with the Wolbachia strain from Drosophila takahashii described previously [25] (Additional file 3A).
The Cardinium phylogeny was constructed using the six Cardinium 16S rDNA sequences from spiders, as well as Cardinium sequences from Hymenoptera, the Hemiptera and the Acari available in GenBank, using the closest known relative of Cardinium, the Acanthamoeba symbiont Amoebophilus asiaticus, as an outgroup (Additional file 4). The spider Cardinium strains clearly fall within the Cardinium species group and especially with Cardinium strains from Acari species. However, the power of the phylogeny to resolve relationships between the strains collected to date is poor, owing to a dearth of informative characters in the slow evolving 16S rDNA sequence.
Nine Spiroplasma strains from diverse origins (Araneae, Diptera and Hemiptera) clustered strongly in the S. ixodetis clade, but bootstrapping provided little support to branches within this clade (Additional file 5). The Spiroplasma strain of Pardosa lugubris (Lycosidae) clustered closely with S. poulsonii within the S. citri clade. The attachment of the two remaining Spiroplasma strains to a Spiroplasma clade remained ambiguous, although they are close to the S. citri clade.
The Rickettsia strain from Mordellistena sp. clearly falls among the rickettsias and has highest sequence similarity to the maternally inherited endosymbiont of the cat fleas Ctenocephalides felis which belong to the Rickettsia felis group [34] (Additional file 6). However, the strain of Mordellistena. sp. was highly divergent from the MK Rickettsia identified in Coccinellidae.
The Arsenophonus strains formed a robust clade of arthropod endosymbionts (Additional file 7). The bacterial strains of Hippobosca equina (Hippoboscidae), Protocalliphora sp. (Calliphoridae), Pyrrhocoris apterus (Pyrrhocoridae) and Polistes nimpha (Vespidae) were tightly clustered with the MK Arsenophonus strain. The three other Arsenophonus strains from Araneus diadematus (Araneae), Loboptera decipiens (Blatellidae) and P. nimpha fitted better with bacterial strains isolated in bloodsucking flies [35] and lice [36]. Although some phylogenetic structure did exist within the Arsenophonus clade, it is not well resolved by analysis of the 16S rRNA gene, although the subgroup which included the MK Arsenophonus appears distinct from Arsenophonus isolates from bloodsucking flies and lice previously reported [35,36].
Discussion
We sampled a medium number of male and female individuals (median 20 total) of 136 arthropods species for Wolbachia, a reproductive parasite well known to be common in various arthropod taxa [9,10], for Cardinium, a reproductive parasite known to exist widely but in fewer species [11,12,22], and for five other unrelated reproductive parasites whose incidence and prevalence were largely unknown. The observed incidence of infection for arthropods was 32.4% for inherited bacteria putatively acting as reproductive parasites.
Our results reveal that Wolbachia is, as expected, the most common reproductive parasite clade associated with arthropods, being recorded in 22.8% of species in our sample. Three other clades, Cardinium, S. ixodetis and Arsenophonus bacteria were present widely, with each occurring in 4% to 7% of the arthropod species. Whilst there has been some work on the former of these bacteria, S. ixodetis and Arsenophonus clearly represent 'understudied groups' that merit careful investigation. We would also note that the frequency of these four bacteria means that around one fifth of infections co-occurred with other species of inherited bacteria (8 of 44 infected species carry two different bacteria), an estimate of course made conservative by our own restrictive sampling for 'known' symbiont groups. This observation reinforces the call of Weeks et al. [37] to adequately sample the inherited flora of a species before interpreting data in terms of particular inherited bacteria.
There were three clades of bacteria that were either found in just one species or not found: Rickettsia, S. poulsonii and flavobacteria relatives. With respect to flavobacteria, the PCR assay detected allied clades of beneficial bacteria and was thus broad spectrum. We can thus be clear that this bacterial clade does not commonly reach mid or high prevalence outside ladybird beetles, where infection was initially established [38]. It is possible that this bacterial group is phylogenetically restricted to being 'ladybird MK'. The low incidence of Rickettsia was more surprising. These have been conjectured as being common, understudied bacterial symbionts of arthropods [39], but we can be confident that spotted fever group Rickettsia does not commonly exist at medium to high prevalence. This comment is made with the caveat that our screen for Rickettsia was relatively narrow, designed to find bacteria allied to a clade of ladybird MK, and would exclude some Rickettsia. Finally, there is S. poulsonii, otherwise known as group I spiroplasmas [40]. Other spiroplasmas were detected in the assay, indicating the PCR assay had a relatively broad catch. S. poulsonii itself is a MK associate of Drosophila species [41], with related strains in leafhoppers. Clearly, whilst spiroplasmas may be common, this particular clade either has low incidence, or always has low prevalence (as is the case for S. poulsonii in Drosophila, for example [42]).
As there is an intuitive link between the frequency of symbiotic infection and the overall importance of symbionts in arthropod biology, some comment on the true incidence level of these bacteria is appropriate. Given that we have tested against the presence of false positives in the PCR assay by obtaining product sequence in all cases, we would emphasise that our estimate underscores true incidence. Two main sources of underestimation of incidence are inherent in our survey. First, there is the possibility of false negatives in the PCR assay. These would be individuals (and, hence, species) in our sample that are in fact infected, but where infection has not been detected. Second, there are species where the PCR assay was accurate and our samples were truly uninfected, but other members of the species, not sampled and tested, are in fact infected. We would argue that both of these factors lead to a considerable underestimation of the frequency of infection.
False negatives with respect to undetected presence in infected samples are an issue with PCR assays, their sensitivity to titre and their ability to detect diverse infections. For Wolbachia, for instance, our use of a PCR assay based on 16S rDNA is likely to include most of the Wolbachia diversity. For Rickettsia, we would note that whereas we found no Rickettsia infection among spiders, Goodacre et al. [24] used PCR primers with a broader 'catch' and reported 19.7% of species to be infected by Rickettsia strains related only distantly to Rickettsia MK strains. These are likely to be inherited bacteria, and possibly reproductive parasites, but they would not be detected in our screen. Furthermore, we probably also underestimated the number of bacterial strains present in species we found to be infected. Given that our survey is in most cases based on PCR amplification of fragments of the slow evolving 16S rDNA sequence, we had limited power to detect multiple infections of closely related bacterial strains. For instance, the 16S rDNA sequences of Wolbachia infecting the mosquito Culex pipiens are well known to be strictly identical, suggesting that only one Wolbachia strain could occur, but sequencing of faster evolving genes has demonstrated the occurrence of more than 60 Wolbachia strains in this host species [43-45].
The second issue that causes an underestimation of the frequency of these agents is failing to sample an infected individual in an infected species. There are two aspects to this, the first being cases where infections are rare within a population. For example, MK infections tend to exist at low prevalence and examples of infection at between 1% and 10% frequency in females represent about one-half of all known infections [46]. Within our survey, we sampled two species in which just 1 of 20 individuals was infected, which clearly indicates the potential for false negatives arising from low prevalence infection. The second cause of failure to sample an infected individual arises from infection presence varying from population to population. We sampled seven species from several localities and revealed three examples of the presence or absence variation between populations within Western Europe. Such geographical variation is not uncommon [47], and is likely to be much greater when the scale of sampling is increased beyond Western Europe (which because of the recent ice age represents one recently recolonised region in ecological terms). Insufficient geographical sampling will lead to serious underestimation of infection incidence.
Overall, therefore, our point estimate of 32.4% of species infected with bacteria allied to reproductive parasites is likely to seriously underestimate the true figure. Our data improve on past surveys by increasing the intensity of sampling within species. For instance, for the case of Wolbachia, resampling our data (taking one individual from each species that is infected with a probability of infection given by the overall prevalence found) indicates that the move from single individual sampling to our modest multiple individual sampling reveals around one-third more cases of infection: the median Wolbachia incidence on sampling one individual per species is 17.6%, rather than the observed 22.8%. However, the sample size within each species is still limited and, most importantly, the restriction in geographical sampling may produce a very serious underestimation of symbiont presence or absence.
We obtained some insight into the degree to which host taxa vary in the frequency of their interaction with inherited bacteria. The depth of conclusion is very limited by virtue of the intensity of sampling within particular clades in a broad survey. Nevertheless, spiders (the Araneae) harboured a higher richness of inherited bacteria than others and represented diversity hotspots for these bacteria with 61.5% of species infected, contrasting to the relatively low incidence observed within Diptera and Coleoptera. The Araneae hotspot was present for Wolbachia, Cardinium and S. ixodetis, although not for Arsenophonus. Why some arthropod taxa are hotspots for inherited bacteria remains one of the most challenging questions with regard to the ecology of reproductive parasites. Certain taxa are clearly more susceptible to acquiring bacteria via horizontal transfer and/or to stably maintaining infection. Given that cocladogenesis is rare, it is the establishment of new infections that appears important in dictating incidence [48]. Intimate contact with other species is likely to predispose to transfer, be this parasitism, predation, physical damage or becoming prey [49-53]. Indeed, species which include other living arthropods in their diet through predation or parasitism are more frequently infected (43.8%) than other species (26.1%; P = 0.05, Fisher's exact test). As a result, predation and/or parasitism could be an efficient transfer mechanism to elucidate the origin of hotspots, as illustrated by Araneae, which is exceptional because all species of this group depend completely on predation of other invertebrates which are largely polyphagous [54].
An alternative hypothesis to account for heterogeneity of endosymbiont incidence among host clades is based on differences in host phylogenies [55], but this does not seem to be a likely explanation for the Araneae.
Conclusion
We hope that this paper has established that Wolbachia and Cardinium are not alone: S. ixodetis and Arsenophonus relatives also exist in appreciable numbers of arthropod species. Perhaps the most important consideration for the future is not the incidence of infection, but phenotype. Whilst there have been detailed studies of Wolbachia and Cardinium in a variety of arthropods, there has been little work on the other pair of 'common' symbionts, S. ixodetis relatives and Arsenophonus. S. ixodetis relatives are known to be MKs in ladybirds [56,57] and butterflies [58,59], but have also been isolated from ticks [60] and aphids [61], where they do not kill males. A. nasoniae was established as the MK of the wasp N. vitripennis [62] but other strains of Arsenophonus isolated from a divergent range of arthropods show no evidence of sex-ratio distortion activity [21,23]. The S. ixodetis and Arsenophonus strains isolated in our study do not show evidence of MK behaviour as they are present in both males and females. It is very likely that these symbionts represent important understudied components of arthropod biology. We would advocate an open approach to their biology; they may cause cytoplasmic incompatibility, but may also be secondary symbionts that could be conditionally beneficial, and their presence in bacterial clades containing reproductive parasites would be of great interest. It is also possible that horizontal (infectious) transmission plays a larger role in the population biology of these infections than is usually perceived. Sexual transmission of aphid secondary symbionts [63] and transmission on coparasitisation for Arsenophonus [31] make this avenue worthy of investigation. If biologists are to understand the role that inherited bacteria play in arthropod evolution, a thorough examination with respect to documenting their effects is now required.
Authors' contributions
OD carried out the molecular genetic studies, the sequence alignment and drafted the manuscript. DB, SB, LB, LZ and JE participated in the molecular genetic studies. OD and GDH conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript.
Supplementary Material
Acknowledgments
Acknowledgements
We are very grateful to Sylvain Charlat and Patricia Simoes for helpful comments on this manuscript and to Klaus Birkhofer, Dries Bonte, Jan Bosselaers, Christine Chevillon, Michelle Clements, Michel de Garine Wichatitsky, Thierry de Meeûs, Lauriane Domenech, Liam Duron, Pierre Echaubard, Aude Lecler, Sara Magalhães, Raymonde Marcoux, Michel Raymond, Karen McCoy, Isabelle Olivieri, Klaus Reinhardt, Susan Riechert, Martin Schmidt and Jutta Schneider for providing specimens. We also thank Barbara Kremeyer, Hong Nga Nguyen Vu and Chun Siew for help with collecting specimens, the warden of Richmond Park, London for permission to collect specimens, and Steve Jones for his hospitality and providing access to land for collection in France. We acknowledge financial support from the Marie Curie Intra-European fellowship from the European Commission (O.D.).
Contributor Information
Olivier Duron, Email: o.duron@ucl.ac.uk.
Didier Bouchon, Email: didier.bouchon@univ-poitiers.fr.
Sébastien Boutin, Email: sebboutin@msn.com.
Lawrence Bellamy, Email: lawrence.bellamy@ucl.ac.uk.
Liqin Zhou, Email: liqin.zhou@st-hughs.ox.ac.uk.
Jan Engelstädter, Email: jan.engelstaedter@env.ethz.ch.
Gregory D Hurst, Email: G.Hurst@liverpool.ac.uk.
References
- Dedeine F, Vavre F, Fleury F, Loppin B, Hochberg ME, Bouletreau M. Removing symbiotic Wolbachia bacteria specifically inhibits oogenesis in a parasitic wasp. Proc Natl Acad Sci USA. 2001;98:6247–6252. doi: 10.1073/pnas.101304298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stevens L, Giordano R, Fialho RF. Male-killing, nematode infections, bacteriophage infection, and virulence of cytoplasmic bacteria the genus Wolbachia. Annu Rev Ecol Syst. 2001;32:519–545. doi: 10.1146/annurev.ecolsys.32.081501.114132. [DOI] [Google Scholar]
- Stouthamer R, Breeuwer JAJ, Hurst GDD. Wolbachia pipientis: Microbial manipulator of arthropod reproduction. Annu Rev Microbiol. 1999;53:71–102. doi: 10.1146/annurev.micro.53.1.71. [DOI] [PubMed] [Google Scholar]
- Werren JH. Biology of Wolbachia. Annu Rev Entomol. 1997;42:587–609. doi: 10.1146/annurev.ento.42.1.587. [DOI] [PubMed] [Google Scholar]
- Bandi C, Dunn AM, Hurst GDD, Rigaud T. Inherited microorganisms, sex-specific virulence and reproductive parasitism. Trends Parasitol. 2001;17:88–94. doi: 10.1016/S1471-4922(00)01812-2. [DOI] [PubMed] [Google Scholar]
- Charlat S, Hurst GDD, Merçot H. Evolutionary consequences of Wolbachia infections. Trends Genet. 2003;19:217–223. doi: 10.1016/S0168-9525(03)00024-6. [DOI] [PubMed] [Google Scholar]
- Hurst GDD, Werren JH. The role of selfish genetic elements in eukaryotic evolution. Nat Rev Genet. 2001;2:597–606. doi: 10.1038/35084545. [DOI] [PubMed] [Google Scholar]
- Charlat S, Hornett EA, Fullard JH, Davies N, Roderick GK, Wedell N, Hurst GDD. Extraordinary flux in sex ratio. Science. 2007;317:214. doi: 10.1126/science.1143369. [DOI] [PubMed] [Google Scholar]
- Werren JH, Windsor D, Guo L. Distribution of Wolbachia among neotropical arthropods. Proc R Soc Lond B. 1995;262:197–204. doi: 10.1098/rspb.1995.0196. [DOI] [Google Scholar]
- Werren JH, Windsor DM. Wolbachia infection frequencies in insects: evidence of a global equilibrium? Proc R Soc Lond B. 2000;267:1277–1285. doi: 10.1098/rspb.2000.1139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weeks AR, Velten R, Stouthamer R. Incidence of a new sex-ratio-distorting endosymbiotic bacterium among arthropods. Proc R Soc Lond B. 2003;270:1857–1865. doi: 10.1098/rspb.2003.2425. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zchori-Fein E, Perlman SJ. Distribution of the bacterial symbiont Cardinium in arthropods. Mol Ecol. 2004;13:2009–2016. doi: 10.1111/j.1365-294X.2004.02203.x. [DOI] [PubMed] [Google Scholar]
- Gotoh T, Noda H, Ito S. Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity. 2007;98:13–20. doi: 10.1038/sj.hdy.6800881. [DOI] [PubMed] [Google Scholar]
- Hunter MS, Perlman SJ, Kelly SE. A Bacteroidetes-group bacterial symbiont induces cytoplasmic incompatibility in the parasitoid wasp Encarsia pergandiella. Proc R Soc Lond B. 2003;270:2185–2190. doi: 10.1098/rspb.2003.2475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kenyon SG, Hunter MS. Manipulation of oviposition choice of the parasitoid wasp, Encarsia pergandiella, by the endosymbiotic bacterium Cardinium. J Evol Biol. 2007;20:707–716. doi: 10.1111/j.1420-9101.2006.01238.x. [DOI] [PubMed] [Google Scholar]
- Provencher LM, Morse GE, Weeks AR, Normark BB. Parthenogenesis in the Aspidiotus nerii complex (Hemiptera: Diaspididae): a single origin of a worldwide, polyphagous lineage associated with Cardinium bacteria. Ann Entomol Soc Am. 2005;98:629–635. doi: 10.1603/0013-8746(2005)098[0629:PITANC]2.0.CO;2. [DOI] [Google Scholar]
- Weeks AR, Marec F, Breeuwer JA. A mite species that consists entirely of haploid females. Science. 2001;292:2479–2482. doi: 10.1126/science.1060411. [DOI] [PubMed] [Google Scholar]
- Weeks AR, Stouthamer R. Increased fecundity associated with infection by a Cytophaga-like intracellular bacterium in the predatory mite, Metaseiulus occidentalis. Proc R Soc Lond B. 2003;271:S193–S195. doi: 10.1098/rsbl.2003.0137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zchori-Fein E, Gottlieb Y, Kelly SE, Brown JK, Wilson JM, Karr TL, Hunter MS. A newly discovered bacterium associated with parthenogenesis and a change in host selection behavior in parasitoid wasps. Proc Natl Acad Sci USA. 2001;98:12555–12560. doi: 10.1073/pnas.221467498. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zchori-Fein E, Perlman SJ, Kelly SE, Katzir N, Hunter MS. Characterization of a Bacteroidetes symbiont in Encarsia wasps (Hymenoptera: Aphelinidae): proposal of 'Candidatus cardinium hertigii'. Int J Syst Evol Microbiol. 2004;54:961–968. doi: 10.1099/ijs.0.02957-0. [DOI] [PubMed] [Google Scholar]
- Dale C, Beeton M, Harbison C, Jones T, Pontes M. Isolation, pure culture, and characterization of "Candidatus Arsenophonus arthropodicus, " an intracellular secondary endosymbiont from the Hippoboscid louse fly Pseudolynchia canariensis. Appl Environ Microbiol. 2006;72:2997–3004. doi: 10.1128/AEM.72.4.2997-3004.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Duron O, Hurst GDD, Hornett EA, Josling JA, Engelstädter J. High incidence of the maternally inherited bacterium Cardinium in spiders. Mol Ecol. 2008;17:1427–1437. doi: 10.1111/j.1365-294X.2008.03689.x. [DOI] [PubMed] [Google Scholar]
- Hypsa V, Dale C. In vitro culture and phylogenetic analysis of "Candidatus Arsenophonus triatominarum, " an intracellular bacterium from the triatomine bug, Triatoma infestans. Int J Syst Bacteriol. 1997;47:1140–1144. doi: 10.1099/00207713-47-4-1140. [DOI] [PubMed] [Google Scholar]
- Goodacre SL, Martin OY, Thomas CFG, Hewitt GM. Wolbachia and other endosymbiont infections in spiders. Mol Ecol. 2006;15:517–527. doi: 10.1111/j.1365-294X.2005.02802.x. [DOI] [PubMed] [Google Scholar]
- Mateos M, Castrezana SJ, Nankivell BJ, Estes AM, Markow TE, Moran NA. Heritable endosymbionts of Drosophila. Genetics. 2006;174:363–376. doi: 10.1534/genetics.106.058818. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Balas MT, Lee MH, Werren JH. Distribution and fitness effects of the son-killer bacterium in Nasonia. Evol Ecol. 1996;10:593–607. doi: 10.1007/BF01237709. [DOI] [Google Scholar]
- Chiel E, Gottlieb Y, Zchori-Fein E, Mozes-Daube N, Katzir N, Inbar M, Ghanim M. Biotype-dependent secondary symbiont communities in sympatric populations of Bemisia tabaci. Bull Entomol Res. 2007;97:407–413. doi: 10.1017/S0007485307005159. [DOI] [PubMed] [Google Scholar]
- Kumar S, Tamura K, Nei M. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform. 2004;5:150–163. doi: 10.1093/bib/5.2.150. [DOI] [PubMed] [Google Scholar]
- Tajima F, Nei M. Estimation of evolutionary distance between nucleotide sequences. Mol Biol Evol. 1984;1:269–285. doi: 10.1093/oxfordjournals.molbev.a040317. [DOI] [PubMed] [Google Scholar]
- Nei M, Kumar S. Molecular Evolution and Phylogenetics. New York: Oxford University Press; 2000. [Google Scholar]
- Skinner SW. Son-killer: a third extrachromosomal factor affecting the sex ratio in the parasitoid wasp, Nasonia (=Mormoniella) vitripennis. Genetics. 1985;109:745–759. doi: 10.1093/genetics/109.4.745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rousset F, Bouchon D, Pintureau B, Juchault P, Solignac M. Wolbachia endosymbionts responsible for various alterations of sexuality in arthropods. Proc R Soc Lond B. 1992;250:91–98. doi: 10.1098/rspb.1992.0135. [DOI] [PubMed] [Google Scholar]
- Lo N, Paraskevopoulos C, Bourtzis K, O'Neill SL, Werren JH, Bordenstein SR, Bandi C. Taxonomic status of the intracellular bacterium Wolbachia pipientis. Int J Syst Evol Microbiol. 2007;57:654–657. doi: 10.1099/ijs.0.64515-0. [DOI] [PubMed] [Google Scholar]
- Azad AF, Sacci JB, Jr, Nelson WM, Dasch GA, Schmidtmann ET, Carl M. Genetic characterization and transovarial transmission of a typhus-like rickettsia found in cat fleas. Proc Natl Acad Sci USA. 1992;89:43–46. doi: 10.1073/pnas.89.1.43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Trowbridge RE, Dittmar K, Whiting MF. Identification and phylogenetic analysis of Arsenophonus- and Photorhabdus-type bacteria from adult Hippoboscidae and Streblidae (Hippoboscoidea) J Invertebr Pathol. 2006;91:64–68. doi: 10.1016/j.jip.2005.08.009. [DOI] [PubMed] [Google Scholar]
- Allen JM, Reed DM, Perotti MA, Braig HR. Evolutionary relationships of Candidatus Riesia spp., endosymbiotic Enterobacteriaceae living within hematophagous primate lice. Appl Environ Microbiol. 2007;73:1659–1664. doi: 10.1128/AEM.01877-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weeks AR, Reynolds KT, Hoffmann AA. Wolbachia dynamics and host effects: what has (and has not) been demonstrated? Trends Ecol Evol. 2002;17:257–262. doi: 10.1016/S0169-5347(02)02480-1. [DOI] [Google Scholar]
- Hurst GDD, Hammarton TC, Bandi C, Majerus TMO, Bertrand D, Majerus MEN. The diversity of inherited parasites of insects: the male-killing agent of the ladybird beetle Coleomegilla maculata is a member of the Flavobacteria. Genet Res. 1997;70:1–6. doi: 10.1017/S0016672397002838. [DOI] [Google Scholar]
- Perlman SJ, Hunter MS, Zchori-Fein E. The emerging diversity of Rickettsia. Proc R Soc Lond B. 2006;273:2097–2106. doi: 10.1098/rspb.2006.3541. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gasparich GE, Whitcomb RF, Dodge D, French FE, Glass J, Williamson DL. The genus Spiroplasma and its non-helical descendants: phylogenetic classification, correlation with phenotype and roots of the Mycoplasma mycoides clade. Int J Syst Evol Microbiol. 2004;54:893–918. doi: 10.1099/ijs.0.02688-0. [DOI] [PubMed] [Google Scholar]
- Williamson DL, Sakaguchi B, Hackett KJ, Whitcomb RF, Tully JG, Carle PG, Bove JM, Adams JR, Konai M, Henegar RB. Spiroplasma poulsonii sp. nov., a new species associated with male-lethality in Drosophila willistoni, a neotropical species of fruit fly. Int J Syst Bacteriol. 1999;49:611–618. doi: 10.1099/00207713-49-2-611. [DOI] [PubMed] [Google Scholar]
- Montenegro H, Solferini VN, Klaczko LB, Hurst GDD. Male-killing Spiroplasma naturally infecting Drosophila melanogaster. Insect Mol Biol. 2005;14:281–287. doi: 10.1111/j.1365-2583.2005.00558.x. [DOI] [PubMed] [Google Scholar]
- Duron O, Boureux A, Echaubard P, Berthomieu A, Berticat C, Fort P, Weill M. Variability and expression of ankyrin domain genes in Wolbachia infecting the mosquito Culex pipiens. J Bacteriol. 2007;189:4442–4448. doi: 10.1128/JB.00142-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Duron O, Fort P, Weill M. Hypervariable prophage WO sequences describe an unexpected high number of Wolbachia variants in the mosquito Culex pipiens. Proc R Soc Lond B. 2006;273:493–502. doi: 10.1098/rspb.2005.3336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Duron O, Lagnel J, Raymond M, Bourtzis K, Fort P, Weill M. Transposable element polymorphism of Wolbachia in the mosquito Culex pipiens: evidence of genetic diversity, super-infection and recombination. Mol Ecol. 2005;14:1561–1573. doi: 10.1111/j.1365-294X.2005.02495.x. [DOI] [PubMed] [Google Scholar]
- Hurst GDD, Jiggins FM. Male-killing bacteria in insects: mechanisms, incidence, and implications. Emerg Infect Dis. 2000;6:329–336. doi: 10.3201/eid0604.000402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shoemaker DD, Ross KG, Keller L, Vargo EL, Werren JH. Wolbachia infections in native and introduced populations of fire ants (Solenopsis spp.) Insect Mol Biol. 2000;9:661–673. doi: 10.1046/j.1365-2583.2000.00233.x. [DOI] [PubMed] [Google Scholar]
- Baldo L, Hotopp JCD, Jolley KA, Bordenstein SR, Biber SA, Choudhury RR, Hayashi C, Maiden MCJ, Tettelin H, Werren JH. Multilocus sequence typing system for the endosymbiont Wolbachia pipientis. Appl Environ Microbiol. 2006;72:7098–7110. doi: 10.1128/AEM.00731-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cordaux R, Michel-Salzat A, Bouchon D. Wolbachia infection in crustaceans: novel hosts and potential routes for horizontal transmission. J Evol Biol. 2001;14:237–243. doi: 10.1046/j.1420-9101.2001.00279.x. [DOI] [Google Scholar]
- Heath BD, Butcher RDJ, Whitfield WGF, Hubbard SF. Horizontal transfer of Wolbachia between phylogenetically distant insect species by a naturally occurring mechanism. Curr Biol. 1999;9:313–316. doi: 10.1016/S0960-9822(99)80139-0. [DOI] [PubMed] [Google Scholar]
- Huigens ME, de Almeida RP, Boons PAH, Luck RF, Stouthamer R. Natural interspecific and intraspecific horizontal transfer of parthenogenesis-inducing Wolbachia in Trichogramma wasps. Proc R Soc Lond B. 2004;271:509–515. doi: 10.1098/rspb.2003.2640. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huigens ME, Luck RF, Klaassen RHG, Maas MFPM, Timmermans MJTN, Stouthamer R. Infectious parthenogenesis. Nature. 2000;405:178–179. doi: 10.1038/35012066. [DOI] [PubMed] [Google Scholar]
- Jaenike J, Polak M, Fiskin A, Helou M, Minhas M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biol Lett. 2007;3:23–25. doi: 10.1098/rsbl.2006.0577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Coddington JA. Systematics and evolution of spiders (Araneae) Ann Rev Ecol Syst. 1991;22:565–592. doi: 10.1146/annurev.es.22.110191.003025. [DOI] [Google Scholar]
- Engelstädter J, Hurst GDD. The dynamics of parasite incidence across host species. Evol Ecol. 2006;20:603–616. doi: 10.1007/s10682-006-9120-1. [DOI] [Google Scholar]
- Hurst GDD, Jiggins FM, von der Schulenburg JHG, Bertrand D, West SA, Goriacheva II, Zakharov IA, Werren JH, Stouthamer R, Majerus MEN. Male-killing Wolbachia in two species of insect. Proc R Soc Lond B. 1999;266:735–740. doi: 10.1098/rspb.1999.0698. [DOI] [Google Scholar]
- Tinsley MC, Majerus MEN. A new male-killing parasitism:Spiroplasma bacteria infect the ladybird beetle Anisosticta novemdecimpunctata (Coleoptera: Coccinellidae) Parasitology. 2006;132:757–765. doi: 10.1017/S0031182005009789. [DOI] [PubMed] [Google Scholar]
- Jiggins FM, Hurst GDD, Jiggins CD, Von Der Schulenburg JH, Majerus MEN. The butterfly Danaus chrysippus is infected by a male-killing Spiroplasma bacterium. Parasitology. 2000;120:439–446. doi: 10.1017/S0031182099005867. [DOI] [PubMed] [Google Scholar]
- Jiggins FM, Hurst GDD, Majerus MEN. Sex ratio distorsion in Acraea encedon (Lepidoptera: Nymphalidae) is caused by a male-killing bacterium. Heredity. 1998;81:87–91. doi: 10.1046/j.1365-2540.1998.00357.x. [DOI] [Google Scholar]
- Tully JG, Rose DL, Yunker CE, Carle P, Bove JM, Williamson DL, Whithcomb RF. Spiroplasma ixodetis sp. nov., a new species from Ixodes pacificus ticks collected in Oregon. Int J Syst Bacteriol. 1995;45:23–28. doi: 10.1099/00207713-45-1-23. [DOI] [PubMed] [Google Scholar]
- Fukatsu T, Tsuchida T, Nikoh N, Koga R. Spiroplasma symbiont of the pea aphid, Acyrthosiphon pisum (Insecta: Homoptera) Appl Environ Microbiol. 2001;67:1284–1291. doi: 10.1128/AEM.67.3.1284-1291.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gherna RL, Werren JH, Weisburg W, Cote R, Woese CR, Mandelco L, Brenner DJ. Arsenophonus nasoniae gen. nov., sp. nov., the causative agent of the Son-killer trait in the parasitic wasp Nasonia vitripennis. Int J Syst Bacteriol. 1991;41:563–565. [Google Scholar]
- Moran NA, Dunbar HE. Sexual acquisition of beneficial symbionts in aphids. Proc Natl Acad Sci USA. 2006;103:12803–12806. doi: 10.1073/pnas.0605772103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hagimori T, Abe Y, Date S, Miura K. The first finding of a Rickettsia bacterium associated with parthenogenesis induction among insects. Curr Microbiol. 2006;52:97–101. doi: 10.1007/s00284-005-0092-0. [DOI] [PubMed] [Google Scholar]
- Lawson ET, Mousseau TA, Klaper R, Hunter MD, Werren JH. Rickettsia associated with male-killing in a buprestid beetle. Heredity. 2001;86:497–505. doi: 10.1046/j.1365-2540.2001.00848.x. [DOI] [PubMed] [Google Scholar]
- Werren JH, Hurst GDD, Zhang W, Breeuwer JA, Stouthamer R, Majerus ME. Rickettsial relative associated with male killing in the ladybird beetle (Adalia bipunctata) J Bacteriol. 1994;176:388–394. doi: 10.1128/jb.176.2.388-394.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Von der Schulenburg JHG, Habig M, Sloggett JJ, Webberley KM, Bertrand D, Hurst GDD, Majerus MEN. Incidence of male-killing Rickettsia spp. (alpha-proteobacteria) in the ten-spot ladybird beetle Adalia decempunctata L. (Coleoptera: Coccinellidae) Appl Environ Microbiol. 2001;67:270–277. doi: 10.1128/AEM.67.1.270-277.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yen JH, Barr AR. The etiological agent of cytoplasmic incompatibility in Culex pipiens. J Invertebr Pathol. 1973;22:242–250. doi: 10.1016/0022-2011(73)90141-9. [DOI] [PubMed] [Google Scholar]
- Stouthamer R, Breeuwer JA, Luck RF, Werren JH. Molecular identification of microorganisms associated with parthenogenesis. Nature. 1993;361:66–68. doi: 10.1038/361066a0. [DOI] [PubMed] [Google Scholar]
- Hurst GDD, Bandi C, Sacchi L, Cochrane A, Bertrand D, Karaca I, Majerus MEN. Adonia variegata (Coleoptera: Coccinellidae) bears maternally inherited Flavobacteria that kill males only. Parasitology. 1999;118:125–134. doi: 10.1017/S0031182098003655. [DOI] [PubMed] [Google Scholar]
- Majerus TMO, Majerus MEN, Knowles B, Wheeler J, Bertrand D, Kuznetsov VN, Ueno H, Hurst GDD. Extreme variation in the prevalence of inherited male-killing microorganisms between three populations of Harmonia axyridis (Coleoptera: Coccinellidae) Heredity. 1998;81:683–691. doi: 10.1046/j.1365-2540.1998.00438.x. [DOI] [Google Scholar]
- Hendriks L, De Baere R, Peer Y Van de, Neefs J, Goris A, De Wachter R. The evolutionary position of the Rhodophyte Porphyra umbilicalis and the Basidiomycete Leucosporidium scotii among other Eukaryotes as deduced from complete sequences of small ribosomal subunit RNA. J Mol Evol. 1991;32:167–177. doi: 10.1007/BF02515389. [DOI] [PubMed] [Google Scholar]
- Hendriks L, Goris A, Neefs J, Peer Y Van de, Hennebert G, De Wachter R. The nucleotide sequence of the small ribosomal subunit RNA of the yeast Candida albicans and the evolutionary position of the Fungi among the Eukaryotes. Syst Appl Microbiol. 1989;12:223–229. [Google Scholar]
- O'Neill SL, Giordano R, Colbert AME, Karr TL, Robertson HM. 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc Natl Acad Sci USA. 1992;89:2699–2702. doi: 10.1073/pnas.89.7.2699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou WG, Rousset F, O'Neill SL. Phylogeny and PCR based classification of Wolbachia strains using wsp gene sequences. Proc R Soc Lond B. 1998;265:509–515. doi: 10.1098/rspb.1998.0324. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.