Abstract
The IMP-4 metallo-β-lactamase, originally recognized in Acinetobacter spp. from Hong Kong, more recently appeared simultaneously in isolates of the family Enterobacteriaceae from Sydney and Melbourne, Australia. The blaIMP-4-qacG2-aacA4-catB3 cassette array was found in isolates from both cities, but in different wider genetic contexts and on different plasmids, suggesting movement of this array by homologous recombination.
Transmissible metallo-β-lactamases (MβLs) are a serious antibiotic resistance threat (18) and are difficult to identify by phenotype in isolates of the family Enterobacteriaceae (6). The 1998 to 2004 global SENTRY survey found only rare examples of MβL genes (blaIMP-1, blaIMP-11, and blaVIM-1) among Enterobacteriaceae isolates (4). However, blaIMP-4, first identified in the late 1990s in Acinetobacter spp. from Hong Kong (2) and Citrobacter youngae from Guangzhou in the People's Republic of China (PRC) (7), was recognized in Australian Enterobacteriaceae isolates on a broad-host-range conjugative plasmid in Sydney, Australia, in 2003 (5) and caused a simultaneous outbreak in Melbourne, Australia (14).
We have examined the original isolates from the PRC and representative sets of unique isolates from Sydney and Melbourne (Table 1) using the Phoenix NMIC/ID-101 panel (Becton, Dickinson & Co., Franklin Lakes, NJ) and Etest (AB Biodisk, Solna, Sweden). Plasmid extracts were prepared by alkaline lysis (15) and bacterial lysates as described previously (17). Isolates/transconjugants were confirmed to carry blaIMP-4 by PCR; and the genetic contexts were determined by overlapping PCR (Fig. 1 and Table 2), restriction digestion, and sequencing of selected amplicons. DNA sequences were analyzed by searches with the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST). Restriction enzyme (New England Biolabs, Ipswich, MA) digestions and PCR with the Expand Long Template PCR system (Roche Diagnostics GmbH, Manheim, Germany) were carried out according to the manufacturers' instructions, and inverse PCR was performed as described previously (12).
TABLE 1.
Clinical isolates used in this study
| Location and isolatea | Species | Dateb | Pc variantc | MIC (μg/ml) for original isolated
|
Ince | Txf | MIC (μg/ml) for transconjugantd
|
No. of MRRg | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IPM | CTX | ATM | GEN | TOB | CIP | IPM | CTX | GEN | TOB | |||||||
| Sydney | ||||||||||||||||
| Kp1239 | K. pneumoniae | 1.03 | W | >32 | >32 | ≤1 | >8 | 8 | >2 | L/M | Tx | 2 | 32 | >8 | 8 | 1 |
| Kp1945h | K. pneumoniae | 12.03 | W | 8 | >32 | ≤1 | >8 | >8 | 1 | L/M | Nili | 3 | ||||
| Kp2730h | K. pneumoniae | 12.03 | W | 8 | >32 | ≤1 | >8 | >8 | 2 | L/M | Tx | 2 | 32 | >8 | 8 | 3 |
| El3280 | E. cloacae | 1.04 | W | 3 | >32 | ≤1 | >8 | >8 | >2 | L/M | Nil | |||||
| El3518j | E. cloacae | 6.04 | W | 3 | >32 | >16 | >8 | >8 | 1 | L/M | Tx | 2 | 32 | >8 | >8 | |
| Ca3927 | C. amalonaticus | 7.04 | W | 2 | >32 | >16 | >8 | >8 | ≤0.5 | L/M | Tx | ≤1 | 32 | >8 | 8 | 2 |
| El1573j | E. cloacae | 11.04 | W | 8 | >32 | ≤1 | >8 | >8 | >2 | L/M | Tx | 2 | 16 | >8 | 8 | |
| Sm2723 | S. marcescens | 11.04 | W | 1.5 | >32 | ≤1 | >8 | >8 | >2 | L/M | Tx | 2 | 16 | >8 | 8 | 1 |
| Kp7564 | K. pneumoniae | 1.05 | W | 7 | 32 | ≤1 | >8 | 8 | ≤0.5 | L/M | Tx | 2 | 32 | >8 | 8 | |
| Ca38009 | C. amalonaticus | 2.05 | W | 1.5 | >32 | ≤1 | >8 | >8 | ≤0.5 | L/M | Tx | 2 | 16 | >8 | 8 | |
| Kp38009 | K. pneumoniae | 2.05 | W | 0.5 | >32 | ≤1 | >8 | 8 | 1 | L/M | Tx | ≤1 | 32 | >8 | 8 | |
| Mm38009 | Morganella morganii | 2.05 | W | 3 | 32 | ≤1 | >8 | 4 | ≤0.5 | L/M | Tx | 2 | 32 | >8 | 8 | 1 |
| Kp38045 | K. pneumoniae | 3.05 | W | 0.75 | 32 | ≤1 | >8 | 8 | ≤0.5 | L/M | Tx | 2 | 32 | >8 | 8 | |
| Ec9381 | E. coli | 4.05 | W | 1.5 | >32 | ≤1 | >8 | >8 | ≤0.5 | L/M | Tx | ≤1 | 32 | >8 | 8 | 1 |
| Mm1229 | M. morganii | 4.05 | W | 4 | >32 | ≤1 | >8 | >8 | ≤0.5 | L/M | Tx | 2 | 32 | >8 | 8 | |
| El3799 | E. cloacae | 5.05 | W | 1 | >32 | ≤1 | >8 | >8 | ≤0.5 | L/M | Tx | ≤1 | 32 | >8 | 8 | |
| Kp3799 | K. pneumoniae | 5.05 | W | 4 | >32 | ≤1 | >8 | >8 | ≤0.5 | L/M | Tx | 2 | 32 | >8 | 8 | |
| Ko0426 | Klebsiella oxytoca | 5.06 | W | 4 | 32 | ≤1 | >8 | >8 | ≤0.5 | L/M | Tx | 4 | 32 | >8 | 8 | 1 |
| Ko1156 | K. oxytoca | 5.06 | W | 0.75 | 32 | ≤1 | >8 | >8 | ≤0.5 | L/M | Tx | ≤1 | 16 | >8 | 8 | |
| Ca1614 | C. amalonaticus | 6.06 | W | 4 | >32 | >16 | >8 | >8 | ≤0.5 | L/M | ND | |||||
| Cf1614 | Citrobacter freundii | 6.06 | W | 4 | >32 | >16 | >8 | >8 | ≤0.5 | L/M | ND | |||||
| Mm1614 | M. morganii | 6.06 | W | 8 | 32 | 4 | >8 | >8 | ≤0.5 | L/M | ND | |||||
| Kp4614 | K. pneumoniae | 8.06 | W | ≤1 | >32 | ≤1 | >8 | 8 | ≤0.5 | ND | Nil | 5 | ||||
| Melbourne | ||||||||||||||||
| Ec158 | E. coli | 9.02 | H | ≤1 | >32 | ≤1 | >8 | 8 | ≤0.5 | A/C | Tx | 2 | >32 | >8 | 8 | 6 |
| Kp149 | K. pneumoniae | 9.02 | H | 8 | >32 | >16 | >8 | >8 | 1 | A/C | Tx | 4 | >32 | >8 | 8 | 6 |
| Sm220 | Serratia marcescens | ?.02 | H | >8 | >32 | ≤1 | >8 | >8 | 2 | A/C | ND | |||||
| Sm201 | S. marcescens | 2.04 | H | 8 | >32 | ≤1 | >8 | >8 | >2 | A/C | ND | |||||
| Sm203 | S. marcescens | 2.04 | H | 4 | >32 | ≤1 | >8 | >8 | 2 | A/C | ND | |||||
| Kp211 | K. pneumoniae | 2.04 | H | 2 | >32 | ≤1 | >8 | 8 | ≤0.5 | A/C | ND | |||||
| Ec211 | E. coli | 5.04 | H | 4 | >32 | ≤1 | >8 | >8 | ≤0.5 | A/C | ND | |||||
| Kp266 | K. pneumoniae | 5.04 | H | 8 | >32 | ≤1 | >8 | >8 | ≤0.5 | A/C | ND | |||||
| Sm211 | S. marcescens | 6.04 | H | 4 | >32 | ≤1 | >8 | >8 | 2 | A/C | ND | |||||
| Ck211 | Citrobacter koseri | 7.04 | H | ≤1 | >32 | ≤1 | >8 | 8 | ≤0.5 | A/C | Tx | ≤1 | >32 | >8 | 8 | |
| El216 | E. cloacae | 7.04 | H | >8 | >32 | >16 | >8 | >8 | ≤0.5 | A/C | ND | |||||
| Ec221 | E. coli | 10.04 | H | 8 | >32 | ≤1 | ≤2 | 8 | ≤0.5 | A/C | Tx | 4 | 32 | ≤2 | 8 | |
| Ko238 | K. oxytoca | 1.05 | H | 8 | >32 | ≤1 | 4 | 8 | ≤0.5 | A/C | Tx | 2 | 32 | ≤2 | 8 | |
| Kp204 | K. pneumoniae | 10.05 | H | 8 | >32 | ≤1 | ≤2 | 8 | ≤0.5 | A/C | Tx | 4 | >32 | ≤2 | 8 | |
| Sm265 | S. marcescens | 10.05 | H | >8 | >32 | ≤1 | 8 | >8 | ≤0.5 | A/C | Tx | 2 | >32 | ≤2 | 8 | |
| Hong Kong | ||||||||||||||||
| A74510 | Acinetobacter | 5.95 | H | >8 | >32 | >16 | >8 | >8 | >2 | ND | Nil | 4 | ||||
| AbN450 | A. baumannii | ? | S | >8 | >32 | >16 | >8 | >8 | >2 | ND | Nil | 7 | ||||
| Guangzhou | ||||||||||||||||
| CyB38k | C. youngae | 12.98 | H | 8 | >32 | ≤1 | >8 | >8 | >2 | HI2 | Tx | 4 | >32 | ≤2 | 8 | 8 |
Isolates with the same number were obtained from the same patient.
The date of isolation is given as the month. year.
Pc promoter variants: W, weak (TGGACA … TAAGCT); H, hybrid (TTGACA … TAAAGCT); S, strong (TTGACA … TAAACT).
The imipenem (IPM) MIC was determined by Etest for all Sydney isolates except Kp4614; the remainder were determined with the Phoenix panel. The MICs of the other antibiotics were >16 μg/ml for ampicillin, cephalothin, cefuroxime, ceftazidime, and cefoxitin; >16/8 μg/ml for amoxicillin-clavulanic acid; >64 μg/ml for ticarcillin for all isolates and transconjugants carrying blaIMP-4; and ≤1 μg/ml for aztreonam (ATM), ≤0.5 μg/ml for ciprofloxacin (CIP), and >32 μg/ml for nalidixic acid (strain UB5201 was resistant) for all transconjugants obtained. Other abbreviations: CTX, cefotaxime; GEN, gentamicin; TOB, tobramycin.
Inc replicon type of original isolate (shown) was identified in all transconjugants except those underlined.
Tx, transconjugants carrying blaIMP-4 were obtained by selection on 80 μg/ml ampicillin; Nil, transconjugants carrying blaIMP-4 were not obtained; ND, not determined.
For the genetic context of the blaIMP-4 array, see Fig. 1.
The isolate carried the dfrA12-orfF-aadA2 array, in addition to blaIMP-4-qacG2-aacA4-catB3.
Ampicillin-resistant transconjugants did not carry blaIMP-4 or an IncL/M replicon.
The isolate carried the dfrA25 array in addition to blaIMP-4-qacG2-aacA4-catB3.
The isolate carried the blaIMP-4 array instead of blaIMP-4-qacG2-aacA4-catB3.
FIG. 1.
Schematic diagram of the structures and contexts of class 1 integrons containing the blaIMP-4 cassette in isolates from Sydney, Melbourne, and the PRC. (A) Structures related to the Sydney (Syd) MRR; (B) structures differing from the Sydney MRR. Structures are numbered to correspond to the numbers in Table 1, and strain designation/origins are shown on the left (HK, Hong Kong; GZ, Guangzhou). CSs and terminal IRs (IRi and IRt) of class 1 integrons are indicated. Insertion sequences are represented by boxes labeled with the insertion sequence number and selected genes by labeled arrows. Selected PCR products are shown as thin lines labeled with the primer pair used. Thick lines indicate matching regions, with the cassette arrays and the ISCR1-associated genes indicated. The sequences are from GenBank accession nos. AFF550415 (pCTXM-3; Enterobacteriaceae, Poland), AM234698 (Salmonella Keurmassar, Senegal), AJ971343 (pRBDHA; K. pneumoniae, France), and DQ390454 (pLEW517; E. coli).
TABLE 2.
PCR primers used in this work
| Primer | Sequence (5′-3′) | Target gene or region | Referencea |
|---|---|---|---|
| imp-BE1 | CAYGGTTTGGTGGTTCTTGTAA | blaIMP variants | |
| imp-BE2 | CCTTTAACVGCCTGYTCTYMT | ||
| hep58 | TCATGGCTTGTTATGACTGT | Cassette arrays in class 1 integrons | 19 |
| hep59 | GTAGGGCTTATTATGCACGC | ||
| catB3-R | CTGTACCGCCCAACTTTGAT | catB3 gene cassette | |
| K31-R | CAATCCCGCTAAGAAGAb | ||
| Tn3P-F | GGGTTCTGGTCGAAGCTGCT | Tn21-like tnp regions | |
| SP1 | ATCCTGGCGGATTCACTACC | In 5′-CS near IRi | |
| IS26-F2 | TGGCAAACTGAAACGGATAA | IS26 | |
| IS26-R2 | GCAGCCGTTTTTCCATTTCA | ||
| 3CS-F | CTATTGGTCTCGGTGTCG | 3′-CS | |
| 3CS-R | ATCGTTCAGGTAGCCCAC | ||
| CR1-R | TTCAGGGTGCTATTGCTC | ISCR1 | |
| CR1-F | ACAAATCGGAAGGTCTC | ||
| IS1326-R | GATTTGGTGATTCTGGATG | IS1326 | |
| IS6100-R | GTAGGCTGTCGCTCTG | IS6100 | |
| qB2reg-1 | CGGTCGGCTTTTTCGCAA | qnrB2 region | |
| qB2reg-2 | GCCCATCTGACTTGCTAT | ||
| orf98-F | GAGAGTTGGTAGAAGGTGGTTGA | orf98 | |
| mphR-F | TTGCGGTCCCATAGAGTTCAC | mph region | 16 |
All primers listed were designed as part of this work except where referenced.
The underlined C was mistakenly replaced by CC in the primer used.
blaIMP-4 was found in the blaIMP-4-qacG2-aacA4-catB3 cassette array in a class 1 integron in the three cases where context information was already available: Sydney index isolate Klebsiella pneumoniae Kp1239 (GenBank accession no. AJ609296) (5), Acinetobacter sp. strain A74510 from Hong Kong (GenBank accession no. AF445082) (8), and a recent Acinetobacter baumannii isolate from Singapore (GenBank accession no. DQ532122) (10). We identified the same array in all Sydney and Melbourne isolates and A. baumannii AbN450 (Hong Kong) and additional cassette arrays in some isolates (Table 1). blaIMP-4 was present in C. youngae CyB38 (from the People's Republic of China) as a single cassette. Restriction digests (9) and/or sequencing revealed variants of the class 1 integron promoter Pc (3, 11) in isolates from different locations. There was no correlation between the previously defined Pc promoter strength (3, 11) and the imipenem MIC (Table 1), which is host strain dependent (5).
PCR-based replicon typing (1) identified IncL/M plasmids in 22/23 Sydney isolates, IncA/C plasmids in all Melbourne isolates, and an IncHI2 plasmid in CyB38, while no specific Inc groups were recognized in K. pneumoniae Kp4614, A74510, or AbN450. blaIMP-4 was readily transferred from the majority of Sydney and Melbourne isolates tested to rifampin-resistant Escherichia coli UB5201Rf by conjugation (17) with selection on 80 μg/ml ampicillin (Table 1), and all of these transconjugants contained a replicon of the expected Inc group. Plasmid profiling of selected Sydney isolates and transconjugants carrying blaIMP-4 revealed plasmids whose sizes were similar to the size of pJIBE401 from index isolate Kp1239 (5). Additional smaller plasmids were also present in some transconjugants. Sydney isolates Kp4614 and Enterobacter cloacae El3280 failed to produce any transconjugants following selection on either ampicillin or gentamicin (12 μg/ml). Transconjugants from Kp1945 carried only a smaller plasmid without blaIMP-4. Consistent with the findings of previous studies (7), a large plasmid carrying blaIMP-4 was transferred from CyB38, but this plasmid did not contain the IncHI2 replicon. Isolates A74510 (2) and AbN450 failed to produce transconjugants, although a large plasmid carrying blaIMP-4 has been reported from the former (8).
The contexts of the blaIMP-4-qacG2-aacA4-catB3 array in selected isolates/transconjugants from different locations were compared (Table 1; Fig. 1). Inverse PCR with pJIBE401 revealed IS26 separated from the start [IRi] of the 5′-CS consensus sequence by 20 bp of the transposition (tnp) region of Tn21 and had the same boundary with IRi as in Tn21 itself (GenBank accession no. AF071413). PCR with primers specific for sequences in IS26 and blaIMP-4 suggested the same structure for A74510 and all but three of the Sydney isolates (Kp4614, Kp1945, and Kp2730). ISCR1 was identified beyond the 3′-CS in A74510 and in all Sydney isolates except Kp4614. Most (five of six) Sydney transconjugants examined had the same structure beyond ISCR1, consisting of regions carrying genes conferring low-level resistance to fluoroquinolones (qnrB2) and resistance to macrolides (mphA) and encoding a probable chromate transporter (orf97), along with a second partial copy of the 3′-CS, IS4321, IS6100, and IS26. This structure was not found in A74510, while Citrobacter amalonaticus 3927 had a similar structure but without IS4321 (Fig. 1). The typical Sydney multiresistance region (MRR) flanked by IS26 in opposite orientations could form a composite transposon, although the flanking sequences needed to confirm acquisition in this way were not obtained here.
In isolate Kp4614, a partial resolution (res) site with a few nucleotide changes from Tn1721 (GenBank accession no. X61367) was found adjacent to IRi, and the 3′-CS appeared to be missing, as the complete array could not be amplified with a primer specific for this region. In Ec158 and Kp149, the Tn1696 res site abutted IRi, with the same boundary as in Tn1696 itself (13), and all other Melbourne isolates tested produced amplicons consistent with this structure (Table 1). In AbN450, IS26 interrupted the 5′-CS at a position seen previously (GenBank accession nos. AJ870923, AY277027, AY522431, and AJ639924). Neither AbN450 nor any Melbourne isolates contained ISCR1, IS6100, or IS1326 linked to blaIMP-4; and the context of the integron in CyB38 carrying blaIMP-4 only was not identified.
Thus, in Australia, distinct broad-host-range plasmids carrying identical cassette arrays in different contexts simultaneously emerged in two cities, with no apparent mixing over several years. All of the components seen in the large (∼20-kb) typical Sydney MRR have been seen before in other MRRs (Fig. 1), often with the same boundaries between them, suggesting that the Sydney MRR was constructed by homologous recombination. The similarity between the regions immediately flanking the blaIMP-4 array in the Sydney MRR and in A74510 from Hong Kong suggests a link between them, while the blaIMP-4 cassette array has presumably moved to or from the other contexts seen here by homologous recombination in the 5′- and 3′-CSs. Our data highlight the importance of this process in the dissemination of resistance genes and the value of carrying out at least a basic characterization of the associated plasmid vehicle(s) and wider genetic contexts.
Nucleotide sequence accession numbers.
GenBank accession number AJ609296, originally containing just the blaIMP-4-qacG2-aacA4-catB3 array from K. pneumoniae Kp1329, has been extended to include some of the additional sequence obtained here.
Acknowledgments
B.A.E. is supported by an Australian Postgraduate Award and a Westmead Millennium Institute Scholarship. S.R.P. was supported by a Centre of Clinical Research Excellence Grant from the National Health & Medical Research Council of Australia (grant 264625).
B.A.E. thanks B. Dillon, L. Thomas, and F. Power for technical assistance and E. Cheong and J. Valenzuela for useful discussions. We thank T. Olma, J. Branley, T. Gottlieb, J. Pham, R. Benn, and the Australian Antibiotic Cycling Group for the Sydney isolates; J. Pham for E. coli Ec158 and K. pneumoniae Kp149; D. Spelman for the other Melbourne isolates; J. Bell for AbN450; E. Houang for A74510; and P. Hawkey for CyB38.
Footnotes
Published ahead of print on 19 May 2008.
REFERENCES
- 1.Carattoli, A., A. Bertini, L. Villa, V. Falbo, K. L. Hopkins, and E. J. Threlfall. 2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods 63:219-228. [DOI] [PubMed] [Google Scholar]
- 2.Chu, Y. W., M. Afzal-Shah, E. T. Houang, M. I. Palepou, D. J. Lyon, N. Woodford, and D. M. Livermore. 2001. IMP-4, a novel metallo-β-lactamase from nosocomial Acinetobacter spp. collected in Hong Kong between 1994 and 1998. Antimicrob. Agents Chemother. 45:710-714. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Collis, C. M., and R. M. Hall. 1995. Expression of antibiotic resistance genes in the integrated cassettes of integrons. Antimicrob. Agents Chemother. 39:155-162. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Deshpande, L. M., R. N. Jones, T. R. Fritsche, and H. S. Sader. 2006. Occurrence and characterization of carbapenemase-producing Enterobacteriaceae: report from the SENTRY Antimicrobial Surveillance Program (2000-2004). Microb. Drug Resist. 12:223-230. [DOI] [PubMed] [Google Scholar]
- 5.Espedido, B., J. Iredell, L. Thomas, and A. Zelynski. 2005. Wide dissemination of a carbapenemase plasmid among gram-negative bacteria: implications of the variable phenotype. J. Clin. Microbiol. 43:4918-4919. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Espedido, B. A., L. C. Thomas, and J. R. Iredell. 2007. Metallo-β-lactamase or extended-spectrum β-lactamase: a wolf in sheep's clothing. J. Clin. Microbiol. 45:2034-2036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hawkey, P. M., J. Xiong, H. Ye, H. Li, and F. H. M'Zali. 2001. Occurrence of a new metallo-β-lactamase IMP-4 carried on a conjugative plasmid in Citrobacter youngae from the People's Republic of China. FEMS Microbiol. Lett. 194:53-57. [DOI] [PubMed] [Google Scholar]
- 8.Houang, E. T., Y. W. Chu, W. S. Lo, K. Y. Chu, and A. F. Cheng. 2003. Epidemiology of rifampin ADP-ribosyltransferase (arr-2) and metallo-β-lactamase blaIMP-4 gene cassettes in class 1 integrons in Acinetobacter strains isolated from blood cultures in 1997 to 2000. Antimicrob. Agents Chemother. 47:1382-1390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kim, T. E., H. J. Kwon, S. H. Cho, S. Kim, B. K. Lee, H. S. Yoo, Y. H. Park, and S. J. Kim. 2007. Molecular differentiation of common promoters in Salmonella class 1 integrons. J. Microbiol. Methods 68:453-457. [DOI] [PubMed] [Google Scholar]
- 10.Koh, T. H., L. H. Sng, G. C. Wang, L. Y. Hsu, and Y. Zhao. 2007. IMP-4 and OXA β-lactamases in Acinetobacter baumannii from Singapore. J. Antimicrob. Chemother. 59:627-632. [DOI] [PubMed] [Google Scholar]
- 11.Lévesque, C., S. Brassard, J. Lapointe, and P. H. Roy. 1994. Diversity and relative strength of tandem promoters for the antibiotic-resistance genes of several integrons. Gene 142:49-54. [DOI] [PubMed] [Google Scholar]
- 12.Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Partridge, S. R., H. J. Brown, H. W. Stokes, and R. M. Hall. 2001. Transposons Tn1696 and Tn21 and their integrons In4 and In2 have independent origins. Antimicrob. Agents Chemother. 45:1263-1270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Peleg, A. Y., C. Franklin, J. M. Bell, and D. W. Spelman. 2005. Dissemination of the metallo-β-lactamase gene blaIMP-4 among gram-negative pathogens in a clinical setting in Australia. Clin. Infect. Dis. 41:1549-1556. [DOI] [PubMed] [Google Scholar]
- 15.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 16.Szczepanowski, R., I. Krahn, B. Linke, A. Goesmann, A. Pühler, and A. Schlüter. 2004. Antibiotic multiresistance plasmid pRSB101 isolated from a wastewater treatment plant is related to plasmids residing in phytopathogenic bacteria and carries eight different resistance determinants including a multidrug transport system. Microbiology 150:3613-3630. [DOI] [PubMed] [Google Scholar]
- 17.Valenzuela, J. K., L. Thomas, S. R. Partridge, T. van der Reijden, L. Dijkshoorn, and J. Iredell. 2007. Horizontal gene transfer within a polyclonal outbreak of carbapenem-resistant Acinetobacter baumannii. J. Clin. Microbiol. 45:453-460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Walsh, T. R., M. A. Toleman, L. Poirel, and P. Nordmann. 2005. Metallo-β-lactamases: the quiet before the storm? Clin. Microbiol. Rev. 18:306-325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.White, P. A., C. J. McIver, Y. Deng, and W. D. Rawlinson. 2000. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiol. Lett. 182:265-269. [DOI] [PubMed] [Google Scholar]