Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2008 May 19;76(8):3595–3605. doi: 10.1128/IAI.01620-07

Vibrio cholerae RND Family Efflux Systems Are Required for Antimicrobial Resistance, Optimal Virulence Factor Production, and Colonization of the Infant Mouse Small Intestine▿

Xiaowen R Bina 1,†, Daniele Provenzano 2,†, Nathalie Nguyen 1, James E Bina 1,*
PMCID: PMC2493215  PMID: 18490456

Abstract

Vibrio cholerae is a gram-negative human intestinal pathogen that causes the diarrheal disease cholera. Humans acquire cholera by ingesting V. cholerae-contaminated food or water. Upon ingestion, V. cholerae encounters several barriers to colonization, including bile acid toxicity and antimicrobial products of the innate immune system. In many gram-negative bacteria, resistance to the antimicrobial effects of these products is mediated by RND (resistance-nodulation-division) family efflux systems. In this study we tested the hypothesis that the V. cholerae RND efflux systems are required for antimicrobial resistance and virulence. The six V. cholerae genes encoding RND efflux pumps were deleted from the genome of the O1 El Tor strain N16961, resulting in the generation of 14 independent RND deletion mutants, including one RND-null strain. Determination of the antimicrobial susceptibilities of the mutants revealed that the RND efflux systems were responsible for resistance to multiple antimicrobial compounds, including bile acids, antimicrobial peptides, and antibiotics. VexB (VC0164) was found to be the RND efflux pump primarily responsible for the resistance of V. cholerae to multiple antimicrobial compounds in vitro. In contrast, VexD (VC1757) and VexK (VC1673) encoded efflux pumps with detergent-specific substrate specificities that were redundant with VexB. A strain lacking VexB, VexD, and VexK was attenuated in the infant mouse model, and its virulence factor production was unaffected. In contrast, a V. cholerae RND-null strain produced significantly less cholera toxin and fewer toxin-coregulated pili than the wild type and was unable to colonize the infant mouse. The decreased virulence factor production in the RND-null strain was linked to reduced transcription of tcpP and toxT. Our findings show that the V. cholerae RND efflux systems are required for antimicrobial resistance, optimal virulence factor production, and colonization of the infant mouse.


Vibrio cholerae is a highly motile gram-negative, facultative human pathogen that causes the potentially lethal diarrheal disease cholera (52). Cholera is an acute intestinal infection characterized by a profuse watery diarrhea that, if untreated, can lead to dehydration and death. V. cholerae infection is acquired by ingestion of contaminated food or water. To reach its niche, V. cholerae must pass through the acid environment of the stomach, overcome the bactericidal effects of bile detergents, traverse the mucous layer of the small intestine, and colonize the epithelial surface. Once V. cholerae reaches this colonization site, a complex regulatory cascade is initiated by two membrane-associated transcriptional activators, ToxR and TcpP, in response to yet-undefined environmental stimuli. ToxR and TcpP, together with their respective protein partners ToxS and TcpH, activate the transcription of toxT (29). ToxT, a cytoplasmic transcriptional activator of the AraC family, directly activates transcription of the genes encoding cholera toxin (CT) and the toxin-coregulated pilus (TCP) (11, 19). CT is an A-B type enterotoxin and the main cause of the severe diarrhea characteristic of cholera. TCP is a type IV bundle-forming pilus that is essential for colonization of the intestinal tracts of both human and laboratory animals (18, 61, 62, 64). Several additional proteins, including VieA (65), cyclic AMP receptor protein (57), AphA (58), AphB (31), Nqr (16), HapR (27), and PepA (2), fine-tune this regulatory hierarchy by modulating the production of virulence factors in response to various environmental signals, including temperature, pH, osmolarity, cell density, growth phase, and nutrient status.

The human gastrointestinal tract presents a number of barriers to colonization by pathogenic organisms, including the gastric acid barrier of the stomach, bile acid toxicity, competition from resident flora, antimicrobial products produced by resident flora, and the innate immune system (44, 54, 56). Gram-negative enteric pathogens have evolved mechanisms to resist the bactericidal effects of these factors. Resistance to acid shock may be induced by the expression of specific genes, such as cadA, in V. cholerae (36-38) or the production of biofilms (68). Resistance to the antimicrobial affects of toxic low-molecular-weight compounds is achieved by reducing the rate of diffusion of antimicrobial compounds across the outer membrane and expressing energy-dependent efflux systems (43).

V. cholerae, like most gram-negative bacteria, regulates the rate of small-molecule diffusion across its outer membrane by modulating the production of specific outer membrane porin proteins, as reported for OmpU and OmpT (6, 41, 59). In response to bile salts, ToxR positively induces ompU expression while repressing ompT. Production of OmpT is associated with increased sensitivity to bile (48, 49), while production of OmpU has been implicated in resistance to antimicrobial peptides (33), organic acids (34), and anionic detergents of bile (48, 49). While the barrier properties of the outer membrane are important contributors to antimicrobial resistance, additional resistance is provided by active efflux mechanisms, as evidenced by the elevated antimicrobial sensitivity of efflux mutants such as V. cholerae tolC, vceAB, vexB, and vexB vexD mutants (4, 5, 9). Active efflux systems export toxic compounds from within the cell envelope into the external environment, thereby decreasing the intracellular concentration of antimicrobial compounds (43). Bacterial efflux systems are classified into five families based on sequence similarity (53). The RND (resistance-nodulation-division) family of efflux proteins is of particular interest in bacterial antimicrobial resistance because of its unusually broad substrate specificity (66). Individual RND efflux pumps, including the Escherichia coli AcrAB-TolC (32) and Pseudomonas aeruginosa MexAB-OprM systems (47), have been shown to efflux numerous chemically diverse antimicrobial compounds, including dyes, detergents, antibiotics, and antimicrobial peptides (66).

RND efflux systems are tripartite transporters that consist of an integral cytoplasmic membrane RND pump protein, a periplasmic membrane fusion protein, and an outer membrane pore protein homologous to E. coli TolC (14). The energy for transport is provided by the proton motive force, and the RND pumps function as proton antiporters. The crystal structures of all three components of the RND efflux systems have been solved and support the model that these three proteins function to form a channel for the proton motive force-dependent extrusion of substrates from within the cell envelope into the extracellular milieu (1, 12, 25, 42).

A growing body of evidence suggests that RND efflux systems play a role in V. cholerae pathogenesis. In a previous report we described a putative RND efflux-negative V. cholerae strain lacking tolC, the putative outer membrane component of the V. cholerae RND systems (4). The ΔtolC strain displayed a severe colonization defect in the infant mouse model of cholera. In addition, three separate studies applying microarray technology to profile the transcriptional patterns of V. cholerae collected either from stool of cholera patients or from rabbit ileal loops highlighted the upregulation of the vexAB RND efflux system (3, 35, 67). In this study, we determined the role of the V. cholerae RND efflux systems in antimicrobial resistance and pathogenesis by deleting the genes encoding the six RND family efflux pump proteins, culminating with the construction of a RND-null strain in which all six RND pump protein-encoding genes were deleted. We report that three of the six RND efflux systems are involved in antimicrobial resistance in vitro. We found that the RND efflux systems were dispensable for growth in vitro but essential for colonization of the intestinal tracts of infant mice. Deletion of all six RND efflux systems repressed tcpP and toxT transcription and the downstream production of CT and TCP compared to those for the wild-type (WT) parental strain. Collectively, our results suggest that V. cholerae RND efflux systems are required for antimicrobial resistance, optimal virulence gene expression, and colonization of the infant mouse small intestine.

MATERIALS AND METHODS

Chemicals, enzymes, and bacterial strains.

Chemicals were obtained from Sigma (St. Louis, MO), and enzymes were purchased from New England Biolabs (Beverly, MA) unless otherwise stated. Carbenicillin was purchased from Agri-Bio (North Miami, FL). Bacterial strains, plasmids, and oligonucleotide PCR primers used in this study are listed in Table 1. E. coli DH5αλpir was employed as a host for all cloning experiments, and E. coli SM10λpir was used to transfer plasmids into V. cholerae by conjugation. All genetic constructs were introduced into V. cholerae strain N16961.

TABLE 1.

Bacterial strains, plasmids, and oligonucleotides used in this study

Strain, plasmid, or oligonucleotide primer Genotype or DNA sequencea Source
Strains
    Vibrio cholerae
        N16961-Sm Streptomycin-resistant O1 El Tor Lab collection
        JB58 N16961-Sm ΔlacZ Lab collection
        JB114 JB58 ΔvexM This study
        JB116 JB58 ΔvexH This study
        JB150 JB58 ΔtolC 4
        JB186 JB116 ΔvexD ΔvexH This study
        JB386 JB58 ΔvexD ΔvexH ΔvexM This study
        JB432 JB58 ΔvexF This study
        JB459 JB58 ΔvexD ΔvexF ΔvexH ΔvexM This study
        JB461 N16961 ΔtoxR 3
        JB464 JB58 ΔvexD ΔvexF ΔvexH ΔvexK ΔvexM This study
        JB485 JB58 ΔvexB ΔvexD ΔvexF ΔvexH ΔvexK ΔvexM This study
        JB495 JB58 ΔvexB 5
        JB528 JB58 ΔvexK This study
        JB531 JB58 ΔvexB ΔvexK This study
        JB692 JB58 ΔvexD This study
        JB694 JB58 ΔvexB ΔvexD 5
        JB740 JB58 ΔvexB ΔvexD ΔvexK This study
        JB744 JB740::pXB206 This study
        JB748 JB485::pXB206 This study
    Escherichia coli
        DH5αλpir supE44 ΔlacU169 (φ80 lacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 (λ pirR6K) 41
        SM10λpir thi-1 thr leu tonA lacY supE recA::RP4-2-Tc::Mu Kmr (λ pirR6K) 41
Plasmids
    pWM91 Suicide plasmid vector used for allelic exchange 39
    pM130 pWM91::ΔVC0629 This study
    pM132 pWM91::ΔVC0914 This study
    pM133 pWM91::ΔVC1673 This study
    pM134 pWM91::ΔVCA0638 This study
    pM143 pWM91::ΔVC1757 5
    pM471 pWM91::ΔVC0164 5
    pTL61T Vector for construction of lacZ transcriptional fusions 30
    pXB192 pTL61T containing the toxT promoter region from N16961 This study
    pXB200 pTL61T containing the tcpPH promoter region from N16961 This study
    pM720 Suicide plasmid vector; kanamycin resistant 63
    pXB206 pM720 containing the N16961 vexAB genes This study
Oligonucleotides
    VC0629F1 CGCGCGACTACTTTCTGCAT
    VC0629F2 CGCACCATGACATGTTAGGGCGGCGTAGAA
    VC0629R1 TGAAACCTTTGTGGTAACCCG
    VC0629R2 CCCTAACATGACATGGTGCGGCTCCTAGTG
    VC0914F1 CCCGCGATTTCTGTTGTGAC
    VC0914F2 AGAAGGATGACATCGCTTTGTACGGTGGG
    VC0914R1 CAGAGTTGCTGCACCAGAGG
    VC0914R2 CAAAGCGATGTCATCCTTCTTCAGCGGACG
    VC1673F1 TAGCCCACGAACCCAAAGC
    VC1673F2 ACAATCAGAGGCGACCACTAAACGATCTCCC
    VC1673R1 TCAAGGAGCGAGGGCTGTAG
    VC1673R2 TAGTGGTCGCCTCTGATTGTCGTGCCGGT
    VCA0638F1 CAAACGTCAGTGGGCGTAACT
    VCA0638F2 CAGACCATTGCACCATGACCGCAAATAACCC
    VCA0638R1 ATTGGACGGTGTGGTGCAG
    VCA0638R2 GGTCATGGTGCAATGGTCTGGCGATCAGCTT
    tcpP-XhoI-F CGCTCGAGGGCAGTAAAAGCCAACGTAATGATGC
    tcpP-XbaI-R GGTCTAGAGGTTATCGGGAAATTGATAAATCACGC
    toxT-XhoI-F GCCTCGAGCAGTTTAAGGTTCTTGTTGG
    toxT-XbaI-R CGTCTAGAGAATATGTAAGTATCAAATTTACTC
a

Oligonucleotide sequences are shown in 5′-to-3′ order.

Growth conditions.

E. coli and V. cholerae strains were grown in Luria-Bertani (LB) broth or on LB agar at 37°C. Strains were grown under AKI conditions using AKI broth for the analysis of CT and TCP production in V. cholerae (23, 24). Antibiotics were added to growth media when needed at the following concentrations: carbenicillin (Cb), 100 μg/ml; kanamycin (Km), 50 μg/ml; streptomycin (Sm), 100 μg/ml.

The in vitro growth kinetics of V. cholerae strains were determined in a Biotek LX808IU microplate reader as previously described (5). Briefly, overnight cultures of each strain were diluted (10−4), and aliquots (150 μl) of the diluted cultures were transferred to individual wells of a 96-well microtiter plate. The plate was positioned in a microplate reader prewarmed to 37°C, and growth was monitored by change in the optical density at 630 nm (OD630) over 21 h. Growth curves were performed in triplicate for each strain, and the OD630 measurements were averaged for each time point in order to plot growth curves.

In vitro growth competition assays were performed as described previously (5). Briefly, approximately 105 CFU of either test strain (lac negative) and approximately 105 CFU of the WT reference strain (lac positive) were coinoculated into 5 ml of LB medium. Immediately following inoculation, an aliquot of the mixed culture was removed, serially diluted, and plated onto LB agar plates containing 50 μg/ml 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) for cell enumeration. The remainder of the culture was incubated at 37°C on a rotary shaker overnight. The following day, aliquots were removed, serially diluted, and plated onto LB X-Gal agar plates. Following overnight incubation at 37°C, the resultant colonies were scored as mutant (white) or WT (blue). The competitive index was calculated as the ratio of the WT to the mutant in the input divided by the ratio of the WT to the mutant in the output.

Sequence analysis.

Sequence analysis, genetic maps, PCR primer construction, and DNA manipulation were performed using Clone Manager 9 Professional software (Science & Educational Software, Cary, NC). Primary amino acid sequence identity among the RND pump proteins was determined using the Align Sequence alignment program, available from the European Bioinfomatics Institute website (www.ebi.ac.uk).

Plasmid construction and generation of mutants.

In-frame deletions of the genes encoding the RND efflux pump proteins were accomplished by crossover PCR as previously described (4, 22). Briefly, for each gene, the open reading frame (ORF)-specific F1-R2 and F2-R1 oligonucleotide PCR primer pairs (Table 1) were applied in separate PCRs employing V. cholerae N16961 genomic DNA as a template. The resulting PCR products were purified and pooled. The pooled PCR products were used as the template for a second PCR using the F1-R1 PCR primers. The 2-kb amplicon resulting from this PCR, consisting of ∼1 kb of chromosomal DNA sequence flanking the gene of interest, was cloned into pCR2.1 with the TOPO TA cloning kit (Invitrogen, Carlsbad, CA) according to the manufacturer's directions. The DNA construct was then excised from pCR2.1 by restriction endonuclease digestion and cloned into the counter-selectable suicide vector pWM91 (39) to generate the plasmid deletion constructs. Next, the deletion constructs were conjugated into V. cholerae JB58, and cointegrants were selected for resistance to Cb and Sm. Several Cb/Sm-resistant cointegrants from the mating were then inoculated onto LB agar without antibiotics and allowed to grow for 3 h. The outgrowth from the LB agar plates was then streaked for individual colonies onto LB (without NaCl) agar containing 5% sucrose to select for the loss of the integrated plasmid. Several sucrose-resistant colonies were selected and screened for Cb sensitivity to verify the loss of the plasmid before incorporation of the desired deletion was confirmed by PCR using the flanking PCR primers (F1 and R1 [Table 1]).

To assess transcriptional activation, pXB192 and pXB200 were first constructed by PCR amplification of the toxT and tcpP promoters, respectively, from V. cholerae N16961 genomic DNA. The primer pairs employed were toxT-XhoI-F and toxT-XbaI-R for the toxT promoter and tcpP-XhoI-F and tcpP-XbaI-R for the tcpP promoter (Table 1). The resulting amplicons were cut with the XhoI and XbaI restriction enzymes and ligated into similarly digested pTL61T to generate pXB192 and pXB200 (Table 1).

pXB206, containing the N16961 vexAB genes, was constructed as follows. First, pJBvexAB (5) was digested with the SalI and XbaI restriction endonucleases, and the resulting 1.989-kb restriction fragment (encoding 5′-truncated vexB) was cloned into similarly digested pM720 to generate pXB206a. Then pJBvexAB was digested with the SacI and XbaI restriction endonucleases, and the resulting 2.352-kb restriction fragment (containing vexA and the remaining 5′ portion of vexB) was ligated to similarly digested pXB206a to generate pXB206. The presence of vexA in pXB206 provides a region of homology to facilitate homologous recombination of the suicide plasmid into the chromosomal vexAB locus in ΔvexB strains for cis-complementation. Integration of pXB206 into the vexA locus of ΔvexB results in generation of the WT vexAB locus. cis-complemented strains were generated by conjugating pXB206 into the indicated strains and then selecting plasmid integrants on LB-Km agar plates.

CT production.

Synthesis of CT in V. cholerae strains grown under AKI conditions (48) was determined as follows. Overnight cultures of V. cholerae strains grown in LB broth were inoculated (10−4) into 10 ml of AKI broth in 150- by 15-mm test tubes and incubated statically at 37°C for 4 h. The cultures were then aseptically transferred to 125-ml Erlenmeyer flasks and incubated with shaking at 37°C for 18 h before CT production was determined by GM1 enzyme-linked immunosorbent CT assays (CT-ELISA) as described elsewhere (5) using anti-CT polyclonal antisera (a kind gift of John J. Mekalanos). Purified CT (Sigma) was used as a standard to determine the amount of CT present in the samples.

TcpA immunoblotting.

Synthesis of TcpA, the pilin subunit of TCP, from V. cholerae strains grown under AKI conditions (48) was determined by Western blotting as follows. Aliquots of AKI-grown cultures were adjusted by OD600 and the cells collected by centrifugation. The cell pellets were resuspended in Laemmli solubilization buffer and heated at 100°C for 10 min. Equal volumes of each resulting cell lysate were resolved by sodium dodecyl sulfate (SDS)-12.5% polyacrylamide gel electrophoresis and then transferred to a polyvinylidene fluoride membrane (Bio-Rad, Hercules, CA). The membrane was blotted first with rabbit polyclonal antisera against TcpA (a kind gift from John Mekalanos) and then with horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Biomeda) as the secondary antibody. The protein was visualized using the SuperSignal West Pico chemiluminescent detection kit (Pierce Biotechnology, Rockford, IL) according to the manufacturer's directions.

Antimicrobial susceptibility tests.

Antimicrobial susceptibility was determined by the gradient agar plate method as previously described (10, 60) using 9-cm-square petri dishes. Briefly, 40 ml of LB agar without antibiotic was poured into the petri plate and allowed to harden on a slant by elevating one side of the plate. Subsequently, 40 ml of LB agar containing the test antibiotic was added to the leveled plate and allowed to solidify. The antibiotic gradient was allowed to form for 2 h, and the gradient plates were used within 3 h of preparation. The gradient plates were inoculated by dipping sterile cotton swabs into fresh overnight cultures of the bacterial strains. The saturated cotton swabs were then used to apply a swath of bacterial cells to the surface of each gradient plate. The gradient plates were then incubated for 18 to 24 h at 37°C before the length of growth of each strain along the gradient was measured. The MIC for each strain was then inferred from the length of bacterial growth on the gradient relative to the antibiotic gradient present in the agar plate. Each plate was inoculated with six strains, consisting of four test strains and strains JB58 (WT) and JB485 (RND null) as internal controls. Antimicrobial susceptibility tests were performed in three independent replicates and the results averaged.

Infant mouse competition assay.

Overnight cultures of mutant (lac negative) and WT reference (lac positive) V. cholerae strains were diluted separately 1:100 in LB broth. Subsequently, the inoculum was generated by adding 10 μl of each diluted mutant and control strain to 980 μl 0.15 M NaCl containing 8 μl of blue food-coloring dye for visualization of gastric inoculation. The 50-μl inoculum was delivered perorally to lightly anesthetized 5-day-old infant mice that had been separated from their mothers approximately 2 h prior to inoculation. An aliquot of the inoculum was also serially diluted and plated onto LB agar plates containing X-Gal for enumeration of the inoculum. The mice were incubated at 30°C for 18 h and then sacrificed, and small intestines were removed above the cecum. The intestines were homogenized in 5 ml 0.15 M NaCl, serially diluted, and plated on LB agar plates containing Sm and X-Gal. Colonies were enumerated following overnight incubation at 37°C and were scored as mutant (white colonies) or WT (blue colonies). The competitive index was calculated as the ratio of the WT to the mutant in the input divided by the ratio of the WT to the mutant in the output.

Transcriptional reporter assay.

The expression levels of toxT and tcpP in JB58 and JB485 were determined as follows. Plasmids pXB192 and pXB200 were independently transformed into JB58 and JB485. The resulting strains were grown under AKI conditions, and aliquots of the cultures were removed and processed in triplicate at time points postinoculation to quantify β-galactosidase activity as described by Miller (40). The experiment was performed three independent times, and representative results are reported.

RESULTS

Six RND-encoding loci were annotated in the V. cholerae genome (17). Five of the loci map to the large chromosome and one to the small chromosome. Each RND efflux system is arranged in an operon structure including a gene encoding the RND pump protein and at least one gene encoding a member of the membrane fusion (MF) protein family (Fig. 1). We propose the naming scheme presented in Fig. 1 for the genes comprising the RND efflux systems. A putative promoter was found upstream of the MF protein in each operon except for the vexRAB locus, where the putative promoter was located upstream of the vexR gene. RND efflux operons typically encode one MF protein upstream of the gene encoding the RND pump protein. This gene arrangement was observed in five of the six RND operons. The exception was the vexIJK locus, which encoded two MF proteins (i.e., VexI and VexJ) preceding the RND pump protein.

FIG. 1.

FIG. 1.

Gene arrangement of the Vibrio cholerae RND family efflux systems. Each RND locus is arranged in an operon structure consisting of a gene encoding a pump protein (filled arrows) and a gene encoding at least one MF protein (shaded arrows). The ORF number and proposed gene name are given below each gene. A putative TetR family transcriptional regulator is encoded by vexR (open arrow). The loci are shown to scale.

The third component of the RND efflux systems is an outer membrane pore protein homologous to E. coli TolC. None of the V. cholerae RND efflux system loci contained an ORF encoding an outer membrane component, suggesting that the previously described unlinked tolC gene encodes the protein for this function (4). The assignment of tolC is further supported by the finding that the antimicrobial susceptibility profile of a tolC mutant is identical to that of the RND-null strain (see below). RND efflux systems are often flanked by a divergently transcribed gene belonging to the tetR family that functions in regulating the expression of the efflux system (45). The only regulatory gene closely associated with any of the V. cholerae RND systems is vexR, which is likely cotranscribed with vexAB. It is not known if VexR functions to regulate the expression of vexAB or any of the other RND efflux systems.

Primary amino acid sequence analysis of the RND pump proteins revealed an average of ∼23% amino acid identity shared between the V. cholerae RND efflux pump proteins (Table 2), with two notable exceptions. While VexB and VexH were 36% identical to each other, this was not reflected functionally; we were unable to attribute a phenotype to VexH under the growth conditions tested (see below), while the ΔvexB mutant displayed increased sensitivity to detergents and antibiotics (Table 3). The second exception was VexD and VexK, which were 42% identical. VexD was previously identified as a bile-inducible and bile-specific efflux system (5). Our results suggest that VexK also enhances bile resistance in addition to enhancing resistance to other detergents (see below).

TABLE 2.

Sequence identities between the V. cholerae RND pump proteins

Protein % Amino acid identity
VexD VexF VexH VexK VexM
VexB 24 22 36 22 22
VexD 22 24 42 23
VexF 24 23 22
VexH 23 22
VexK 25

TABLE 3.

Susceptibilities of V. cholerae RND efflux mutants to antimicrobial compounds

Straina Genotype MIC (SD)b
Cho Doc Tx SDS Ery Pxb Pen
JB58 WT >5 (0) >3 (0) >1 (0) >0.1 (0) 5 (1.1) 110 (5) 4.5 (0.02)
JB150 tolC 0.03 (0.005) 0.006 (0.002) 0.004 (0.003) 0.0025 (0.001) 0.05 (0.02) 27 (6) 1.8 (0.02)
JB485 RND-null mutant 0.03 (0.005) 0.006 (0.002) 0.004 (0.003) 0.0025 (0.001) 0.05 (0.03) 27 (4) 1.8 (0.02)
JB495 vexB >5 (0) >3 (0) 0.016 (0.011) 0.0045 (0.0009) 0.05 (0.02) 27 (5) 1.8 (0.02)
JB692 vexD >5 (0) >3 (0) >1 (0) >0.1 (0) 5 (1) 110 (6) 4.5 (0.02)
JB694 vexB vexD 0.06 (0.005) 0.012 (0.01) 0.016 (0.014) 0.0045 (0.0007) 0.05 (0.02) 27 (5) 1.8 (0.02)
JB528 vexK >5 (0) >3 (0) >1 (0) >0.1 (0) 5 (0.9) 110 (4) 4.5 (0.02)
JB531 vexB vexK >5 (0) >3 (0) 0.004 (0.003) 0.0025 (0.0007) 0.05 (0.03) 27 (5) 1.8 (0.02)
JB740 vexB vexD vexK 0.03 (0.005) 0.006 (0.002) 0.004 (0.003) 0.0025 (0.0004) 0.05 (0.03) 27 (4) 1.8 (0.02)
a

Strains JB186 (ΔvexD ΔvexH), JB386 (ΔvexH ΔvexD ΔvexM), JB432 (ΔvexF), JB459 (ΔvexH ΔvexD ΔvexM ΔvexF), JB694 (ΔvexB ΔvexD), JB114 (ΔvexM), and JB116 (ΔvexH) were also tested for antimicrobial susceptibility but were omitted from this table because no change in the MIC was observed for any of the drugs tested.

b

MICs are expressed in micrograms per milliliter for antibiotics and as percentages (grams per 100 ml) for detergents except for Triton X-100, for which MICs are expressed as volume/volume. Abbreviations: Cho, cholate; Doc, deoxycholate; Tx, Triton X-100; Ery, erythromycin; Pxb, polymyxin B; Pen, penicillin.

RND efflux mutants are more susceptible to antimicrobial compounds.

To determine the role of RND efflux systems in antimicrobial resistance, V. cholerae strains harboring deletions in genes encoding the RND pump proteins were examined for antimicrobial susceptibility. Since nonspecific growth defects could influence the results of the antimicrobial susceptibility tests, we first compared the growth rates of all the RND efflux mutants to that of the parental RND WT strain (JB58). The growth rates of all efflux mutants were not significantly different from that of JB58, suggesting that the RND efflux systems were dispensable for growth under standard laboratory conditions (data not shown).

The RND pump protein mutants were then analyzed for changes in antimicrobial susceptibility to a panel of antibiotics and detergents in order to delineate the contribution of each RND pump protein to V. cholerae antimicrobial resistance. The RND-null strain JB485 displayed significant decreases in the MICs for the bile salts cholate and deoxycholate, the detergents Triton X-100 and SDS, and the antibiotics erythromycin, polymyxin B, and penicillin, suggesting that these compounds were substrates for one or more of the V. cholerae RND efflux systems (Table 3). In contrast, we could not distinguish any change in the MIC of kanamycin, nalidixic acid, ciprofloxacin, rifampin, cefotaxime, carbenicillin, tetracycline, or chloramphenicol for JB485 (data not shown). This outcome suggests that the observed changes in antimicrobial susceptibility resulted from the loss of RND efflux activity rather than from a generalized membrane defect, which would have caused increased susceptibility to most, if not all, antimicrobial compounds tested.

We previously reported that deletion of tolC in V. cholerae N16961 leads to increased antimicrobial susceptibility and a colonization-deficient phenotype (4). Given that five tolC homologues have been identified in the N16961 genome (VC1409, VC1565, VC1606, VC1621, and VC2436), we sought to determine whether any of the other four tolC homologues could functionally complement for the lack of TolC (VC2436). To accomplish this, we compared the antimicrobial susceptibility of the ΔtolC (VC2436) mutant to that of the RND-null strain. Our results showed that the antimicrobial susceptibility profile of the ΔtolC mutant JB150 was identical to that of the RND-null strain JB485 (Table 3). This result further strengthens the hypothesis that TolC (encoded by VC2436) is the outer membrane component for the RND efflux systems and suggests that none of the remaining four TolC homologues function with the RND efflux systems.

VexB is the primary RND efflux pump mediating broad-spectrum antimicrobial resistance.

To determine the substrate specificity of each RND efflux system, we tested V. cholerae strains lacking each individual RND efflux pump protein (strains JB114 [ΔvexM], JB116 [ΔvexH], JB432 [ΔvexF], JB495 [ΔvexB], JB528 [ΔvexK], and JB692 [ΔvexD]) for changes in antimicrobial susceptibility. Changes in the MICs of the tested antimicrobial compounds were associated only with the vexB deletion strain JB495 (Table 3). No changes in the MICs of the tested antimicrobial compounds were detected for strains containing single deletions in the other five RND efflux pump proteins (Table 3 and data not shown). Consistent with our previous report (5), the ΔvexB strain JB495 exhibited decreases in the MICs of Triton X-100, SDS, polymyxin B, and erythromycin, suggesting that these compounds were efflux substrates for VexB. Erythromycin, polymyxin B, and penicillin MICs for the ΔvexB strain JB495 were identical to the corresponding MICs for the RND-null strain (strain JB485), suggesting that these antibiotics are not substrates for any of the other five RND efflux systems. Complementation of JB740 (ΔvexB ΔvexD ΔvexK) and the RND-null mutant JB485 with vexB restored their resistance to antimicrobial compounds (Table 4).

TABLE 4.

Antimicrobial susceptibilities of V. cholerae efflux mutants complemented with vexAB

Strain Genotype MIC (SD)a
Cho Doc Tx SDS Ery Pxb Pen
WT WT >5 (0) >3 (0) >1 (0) >0.1 (0) 2.5 (1) 100 (5) 7.6 (0.05)
JB485 RND null mutant 0.03 (0.005) 0.004 (0.001) 0.003 (0.002) 0.003 (0.001) 0.02 (0.01) 20 (4) 1.8 (0.02)
JB748 JB485::vexB+ >5 (0) >3 (0) >1 (0) >0.1 (0) 2.5 (1) 100 (5) 7.6 (0.05)
JB740 vexB vexD vexK 0.03 (0.005) 0.004 (0.001) 0.003 (0.002) 0.003 (0.001) 0.02 (0.01) 20 (4) 1.8 (0.02)
JB744 JB740::vexB+ >5 (0) >3 (0) >1 (0) >0.1 (0) 2.5 (1) 100 (5) 7.6 (0.05)
a

MICs are expressed in micrograms per milliliter for antibiotics and as percentages (grams per 100 ml) for detergents except for Triton X-100, for which the MIC is expressed as volume/volume. Abbreviations: Cho, cholate; Doc, deoxycholate; Tx, Triton X-100; Ery, erythromycin; Pxb, polymyxin B; Pen, penicillin.

We previously showed that both the VexAB and VexCD RND efflux systems contribute to enhanced bile resistance (5). In this study, we found that the MICs of cholate and deoxycholate for strain JB694 (ΔvexB ΔvexD) were twofold higher than the MICs for the RND-null strain JB485 (Table 3) while the MIC profile for a ΔvexB ΔvexD ΔvexK triple mutant (JB740) was identical to that for the RND-null strain JB485 (Table 3). This suggests that VexK possesses low-level and redundant efflux activity for bile salts. Given the minimal contribution of VexK to bile salt resistance, it is likely that our inability to detect bile salt efflux in the ΔvexK (JB528) and ΔvexB ΔvexK (JB531) mutants resulted from redundant activity provided by VexB and/or VexD efflux pumps.

SDS and Triton X-100 are substrates of the VexK efflux pump.

As shown in Table 3, Triton X-100 and SDS MICs for the ΔvexB strain (JB495) were higher than the corresponding MICs for the RND-null mutant JB485, suggesting that at least one additional RND efflux system enhanced Triton X-100 and SDS resistance. The SDS and Triton X-100 MICs for a ΔvexB ΔvexK double mutant (JB531) were identical to those for the RND efflux-deficient strain JB485, suggesting that VexK contributes to SDS and Triton X-100 resistance (Table 3). We suspect that our inability to detect changes in SDS and Triton X-100 susceptibility for the single ΔvexK mutant (JB528) is likely due to its phenotype being masked by the redundant efflux activity provided by VexB.

RND-deficient V. cholerae is unable to colonize the infant mouse small intestine.

The MIC results presented above indicate that V. cholerae RND efflux systems are responsible for resistance to host antimicrobial products, including antimicrobial peptides, fatty acids, bile, and other detergent-like molecules. We therefore hypothesized that V. cholerae resistance to these products could be critical for colonization of the small intestine. To test this hypothesis, we investigated whether the RND mutants were able to compete with the parental N16961 strain for colonization of the infant mouse small intestine. Competition assays revealed that only strain JB740 (ΔvexB ΔvexD ΔvexK), strain JB464 (ΔvexD ΔvexF ΔvexH ΔvexK ΔvexM), and the RND-null strain JB485 exhibited significant attenuation for colonization of the infant mouse small intestine (Fig. 2). Strains JB114 (ΔvexM), JB116 (ΔvexH), JB432 (ΔvexF), JB495 (ΔvexB), JB528 (ΔvexK), JB692 (ΔvexD), JB186 (ΔvexD ΔvexH), JB694 (ΔvexB ΔvexD), JB386 (ΔvexH ΔvexD ΔvexM), and JB459 (ΔvexH ΔvexD ΔvexM ΔvexF) were not significantly affected in their abilities to colonize the infant mouse small intestine (Fig. 2; also data not shown). JB464 exhibited a mild colonization defect and was approximately fivefold attenuated relative to the WT. Deletion of the three RND efflux systems that were responsible for the intrinsic antimicrobial resistance of V. cholerae in vitro (i.e., vexB, vexD, and vexK) resulted in significant attenuation in the mouse model, as exhibited by the ∼46-fold reduction in the colonization proficiency of strain JB740 relative to that of the WT. Strain JB485, the RND-null mutant, was the most severely attenuated strain. We were unable to recover JB485 from infant mouse small intestines. A theoretical competitive index was calculated for JB485 by using an artificial value of 1 JB485 colony recovered from each mouse in the colonization assays. This resulted in a calculated competitive index of <0.002, which correlates with a reduction in colonization proficiency of >500-fold for JB485. The in vivo growth defect observed for strains JB740 and JB485 was complemented by the introduction of a WT copy of vexB into each respective strain (Fig. 2; compare JB740 to JB744 and JB485 to JB748), confirming that the in vivo attenuation resulted from a loss of efflux activity. Control growth competition assays performed in vitro showed that no significant growth differences could be distinguished between any of the RND efflux mutants and the WT strain (data not shown), suggesting that the in vivo differences observed resulted from loss of the RND efflux systems and not from a generalized growth defect.

FIG. 2.

FIG. 2.

Colonization of the infant mouse small intestine by V. cholerae RND efflux mutants. In vivo competitive index experiments were performed as described in Materials and Methods. V. cholerae strains (with their respective RND efflux pump genotypes in parentheses) are given below the plot. The Mann-Whitney U test was used for analyses of statistical significance. The horizontal lines indicate the means. (1), P < 0.0001; (2), P = 0.0014; *, colonization of the infant mouse small intestine by strain JB485 was below the limit of detection, and an artificial value of 1 recovered CFU for JB485 was used to calculate the reported competitive index.

CT and TcpA synthesis in the RND-null mutant is decreased.

Our previous report indicated that a bile-hypersensitive ΔvexB ΔvexD mutant competed equally with the WT for colonization of the infant mouse small intestine (5). This result, combined with other reports (44), suggested that bile production in the infant mouse may not pose a significant restriction to colonization. In this study we report that mutants lacking vexB and vexD (JB694) or vexB, vexD, and vexK (JB740), as well as the RND-null mutant (JB485), displayed significantly increased susceptibilities to the bile acids cholate and deoxycholate (Table 3). Although the extents of bile susceptibility exhibited by these three strains were similar, JB485 was unable to colonize the infant mouse small intestine while JB694 was colonization proficient and JB740 exhibited an approximately 50-fold reduction in colonization proficiency (Fig. 2). Based on these findings, we hypothesized that additional factors might be involved in the in vivo attenuation of JB485. To investigate this hypothesis, we assayed whether CT production was affected in the RND-null strain JB485 during growth under AKI culture conditions. CT GM1-ELISA results revealed a 70% decrease in CT production by the RND-null strain JB485 (Fig. 3) compared to that by the WT during growth under AKI conditions. CT production was reduced by ∼20 to 30% compared to that of the WT in RND efflux mutants JB386 (ΔvexD ΔvexH ΔvexM), JB459 (ΔvexD ΔvexF ΔvexH ΔvexM), JB464 (ΔvexD ΔvexF ΔvexH ΔvexK ΔvexM), JB694 (ΔvexB ΔvexD), and JB740 (ΔvexB ΔvexD ΔvexK), while no CT was detected in the control ΔtoxR strain JB461 (Fig. 3). TcpA Western blotting of the same strains showed a corresponding decrease in TcpA synthesis by the RND-null strain JB485 but failed to show significant differences in TcpA production in other RND mutants (Fig. 3B). Strains JB114 (ΔvexM), JB116 (ΔvexH), JB432 (ΔvexF), JB495 (ΔvexB), JB528 (ΔvexK), and JB692 (ΔvexD) were also assayed for CT and TcpA production but did not show significant differences in CT production (data not shown). The results of the CT and TCP bioassays showed that functional RND efflux systems are required for optimal virulence factor production.

FIG. 3.

FIG. 3.

Production of CT and TcpA is reduced in V. cholerae mutants harboring deletions in RND efflux pump genes. V. cholerae strains are given at the bottom of each panel, with their respective RND efflux pump genotypes in parentheses. Strains were grown under AKI conditions for 24 h before processing for the CT GM1-ELISA (A) or TcpA Western blotting (B). The error bars indicate the standard deviations of the means for three independent experiments.

The results described above suggested that a loss of RND efflux activity caused a reduction in CT and TcpA production. To confirm this, we complemented strains JB740 and JB485 with vexB in cis. We hypothesized that complementation of the RND-null strain JB485 with vexB would restore CT and TcpA production to a level comparable to that of strain JB464, which harbors deletions of vexH, vexD, vexM, vexF, and vexK. Likewise, we predicted that complementation of vexB in JB740 (ΔvexB ΔvexD ΔvexK) would restore CT production to WT levels. We therefore assayed strains JB744 (ΔvexBDK::B+) and JB748 (ΔvexBDFHKM::B+) for CT and TcpA production following growth under AKI conditions. Our results show that complementation of vexB in strain JB740 restored CT production to WT levels (compare JB740 and JB744 in Fig. 4), while complementation of vexB in JB485 restored CT and TcpA production to a level comparable to that of strain JB464 (compare JB485 and JB748 in Fig. 4). These results confirm that the reduction in CT and TcpA production in the RND-null strain resulted from a lack of efflux activity rather than an unlinked spontaneous mutation.

FIG. 4.

FIG. 4.

Complementation of RND efflux mutants with vexAB. The indicated strains were grown under AKI conditions for 24 h before processing for the CT GM1-ELISA (A) or TcpA Western blotting (B). The error bars indicate the standard deviations of the means for three independent experiments.

The RND efflux systems are required for optimal tcpP and toxT transcription.

The decrease in CT and TcpA production observed in the RND-null mutant strain JB485 suggested a defect in induction of the ToxR regulon. ToxR, TcpP, and ToxT are the three primary regulatory proteins involved in virulence gene expression in V. cholerae. According to the current model (reviewed in reference 8), TcpP and ToxR bind to the toxT promoter and activate the expression of toxT. ToxT, a member of the AraC family of transcriptional regulators, then directly activates the transcription of the genes responsible for the biosynthesis of CT and TCP. ToxR also functions independently of TcpP to regulate the production of the OmpT and OmpU porins. Altered expression of these two porins can be used to assay for ToxR expression (50). To determine whether the lack of efflux activity altered ToxR expression, we resolved whole-cell lysate proteins of the RND-null strain JB485 and the parental WT strain by SDS-polyacrylamide gel electrophoresis. The resolved cell lysates were then visualized with Commassie brilliant blue R-250 to compare the expression ratios of the ToxR-regulated OmpT and OmpU porins. This analysis did not reveal altered production of either porin by the RND-null strain compared to that by the WT (data not shown), which led us to conclude that ToxR production was probably not responsible for the observed phenotype in the RND-null strain. Next, we assayed the transcription of toxT and tcpP in WT and RND-null strains by employing episomal toxT-lacZ and tcpP-lacZ transcriptional reporter fusions during growth under AKI inducing conditions for 4 to 7 h. The results of these experiments showed that under inducing conditions, tcpP transcription and toxT transcription in the RND-null strain JB485 are significantly reduced from those in the WT (Fig. 5). Since tcpP is upstream of toxT in the signaling cascade, these results suggest that the defect in CT and TCP production in JB485 occurs at the level of tcpP expression, and they suggest a link between the RND efflux systems and virulence factor production via reduced expression of tcpP.

FIG. 5.

FIG. 5.

Transcription of tcpP and toxT is repressed in the RND-null strain. V. cholerae strains were grown under AKI conditions. At the times indicated, aliquots from the cultures were processed and β-galactosidase production determined. Results are reported as percentages of the toxT and tcpP transcription levels of WT JB58 toxT-lacZ and JB58 tcpP-lacZ, respectively. β-Galactosidase activity in the WT at 5.5 h ranged from ∼8,000 Miller units for the toxT-lacZ reporter to ∼1,000 Miller units for the tcpP-lacZ reporter. Error bars, standard deviations of the means for three independent experiments.

DISCUSSION

We found that three of the six V. cholerae RND efflux systems (VexAB, VexCD, and VexIJK) contributed to V. cholerae antimicrobial resistance in vitro. Among these three systems, the VexAB RND efflux system was the main contributor to resistance against bile salts, SDS, Triton X-100, polymyxin B, erythromycin, and penicillin. In contrast, substrates of the VexCD (bile salts) and VexIJK (SDS, Triton X-100, and bile salts) RND efflux systems were more limited and were redundant with VexAB. This latter finding suggests that VexCD and VexIJK may be important for growth in certain environmental niches, such as the human small intestine, where V. cholerae is exposed to high concentrations of bile salts and other detergent-like molecules. We were not able to ascribe a function to the VexEF, VexGH, and VexLM RND efflux systems. This result does not exclude the possibility that these efflux systems contribute to antimicrobial resistance, since they may function under different conditions than those employed in our assay or may efflux antimicrobial compounds not tested in this study. Supporting this notion is the recent report showing that expression of the vexGH and vexIJK RND efflux systems may be induced in vivo in humans (31). In addition, Rahman et al. recently reported that V. cholerae vexEF can produce a functional multiple-drug efflux system when recombinantly expressed in E. coli (51). Thus, it appears likely that the VexEF, VexGH, and VexLM RND efflux systems are produced under yet unknown conditions.

Alternate approaches or different experimental conditions from those employed here will be required to determine the functions of the VexEF, VexGH, and VexLM RND efflux systems. One such approach was recently published following the completion of these studies. Rahman et al. recombinantly expressed each of the RND efflux systems in an acrB tolC-negative E. coli strain (51). They found that efflux activity was dependent on the presence of V. cholerae tolC, confirming our findings that tolC (VC2436) functioned as the outer membrane component for the V. cholerae RND efflux systems. Consistent with our previous report (5) and results presented here, Rahman et al. also found that VexAB and VexCD produced functional RND efflux systems in E. coli. They also found that vexEF produced a functional RND efflux system in E. coli and was expressed in V. cholerae under standard laboratory growth conditions. We did not observe a phenotype associated with deletion of vexEF in V. cholerae. It is possible that this discrepancy reflects functional differences of VexEF in E. coli versus V. cholerae. However, it is interesting that our in vivo results showed at least a 10-fold difference in colonization proficiency between JB740 (ΔvexB ΔvexD ΔvexK) and the RND-null strain JB485, suggesting that at least one of the remaining three RND efflux systems was important for colonization of the infant mouse small intestine. Ongoing work in our laboratory is focused on determining whether VexEF functions in this respect. Lastly, vexGH, vexIJK, and vexLM did not produce functional efflux systems when expressed in E. coli (51). Our results showed that the VexIJK efflux system functions in SDS and Triton X-100 resistance in V. cholerae. It is not clear why the vexIJK system failed to function in E. coli. The vexIJK RND system is unusual in that it contains two MF proteins (vexI and vexJ), and it is possible that this configuration has additional biological requirements that are found only in V. cholerae.

The finding that the RND efflux systems were required for virulence gene expression is intriguing. RND efflux systems are not generally regarded as regulatory proteins; however, they have been shown, in a number of bacterial pathogens, to indirectly modulate gene expression via efflux of intracellular second-messenger molecules (46). For example, the MexAB-OprM RND efflux system in Pseudomonas aeruginosa was shown to efflux the PAI-1 autoinducer, resulting in reduced expression of PAI-1-dependent virulence genes (13). In V. cholerae the expression of tcpPH is regulated by quorum sensing. In the current model, two transcriptional regulators, AphA and AphB, bind to the tcpPH promoter to activate its expression (28, 58). Expression of aphA is negatively regulated by the quorum-sensing regulator HapR, thus linking aphA expression (and the expression of the downstream tcpPH) to quorum sensing (27). Since aphA is derepressed in N16961 due to a frameshift mutation in hapR, it is unlikely that this regulatory circuit is responsible for tcpPH repression in the RND-null mutant.

Strong evidence supports the existence of additional low-molecular-weight effector molecules that influence virulence factor production in V. cholerae (7, 15, 20, 21, 55). Recently, Hung et al. demonstrated that the synthetic compound virstatin inhibits the transcriptional regulator ToxT, thereby preventing the expression of CT and TCP (21). The efflux of such molecules represents a potential mechanism by which the RND efflux systems could influence virulence gene expression. For example, the AphB transcriptional regulator is reported to activate tcpPH expression in response to yet unknown environmental signals (28). Interestingly, AphB is a member of the LysR family of transcriptional regulators. The activity of LysR regulators is modulated by the binding of low-molecular-weight effector molecules, which provides a potential mechanism for the RND efflux systems to affect tcpPH expression. Lastly, we cannot exclude the possibility that lack of efflux activity affected other regulatory factors that have been shown to modulate tcpPH expression, including cyclic AMP receptor protein (26) and PepA (2).

Collectively, the findings presented here support the conclusion that the V. cholerae RND efflux systems are required for virulence. Our results suggest that the RND efflux systems play a dual role in V. cholerae virulence. First, we show that the RND efflux systems play an important role in resistance to host-derived antimicrobial compounds, including detergents, detergent-like compounds, and antimicrobial peptides. Our in vivo results suggest that one of the primary functions for the RND efflux systems is resistance to antimicrobial products that are present in the host. This is evidenced by the significant attenuation, in the absence of a defect in virulence gene production, of the vexB vexD vexK deletion mutant JB740 (Fig. 2). Second, the loss of the RND efflux systems resulted in decreased expression of the virulence gene regulator tcpP. This was a particularly intriguing finding, because it suggests that the RND efflux systems function in a novel regulatory circuit involved in modulating virulence gene expression independently of the quorum-sensing systems. There is strong evidence that effector molecules are substrates for RND efflux systems in P. aeruginosa (13). A similar situation could exist in V. cholerae; effector molecules could function to modulate virulence gene expression in response to environmental stimuli. One possible scenario could be that antimicrobial substances present in the external environment (e.g., bile salts) function as competitive inhibitors for the efflux of an intracellular effector molecule (e.g., an AphB effector molecule), thus affecting the intracellular concentration of the effector molecule and allowing the cell to modulate the expression of virulence factors (via tcpPH expression) in response to its environment. Much additional work will be required to elucidate the role of efflux in virulence gene expression in V. cholerae, and we are currently working to define the molecular components involved in this novel regulatory pathway.

Acknowledgments

This work was supported by a grant from the University of Tennessee Pathogenesis Center (to J.E.B.) and NIH grant GM068855 (to D.P.). We are grateful to John J. Mekalanos at Harvard Medical School for the kind gift of polyclonal antisera against CT and TCP and for support of these studies through NIH grant AI-18045.

Editor: A. Camilli

Footnotes

▿

Published ahead of print on 19 May 2008.

REFERENCES

  • 1.Akama, H., T. Matsuura, S. Kashiwagi, H. Yoneyama, S. Narita, T. Tsukihara, A. Nakagawa, and T. Nakae. 2004. Crystal structure of the membrane fusion protein, MexA, of the multidrug transporter in Pseudomonas aeruginosa. J. Biol. Chem. 27925939-25942. [DOI] [PubMed] [Google Scholar]
  • 2.Behari, J., L. Stagon, and S. B. Calderwood. 2001. pepA, a gene mediating pH regulation of virulence genes in Vibrio cholerae. J. Bacteriol. 183178-188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bina, J., J. Zhu, M. Dziejman, S. Faruque, S. Calderwood, and J. Mekalanos. 2003. ToxR regulon of Vibrio cholerae and its expression in vibrios shed by cholera patients. Proc. Natl. Acad. Sci. USA 1002801-2806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bina, J. E., and J. J. Mekalanos. 2001. Vibrio cholerae tolC is required for bile resistance and colonization. Infect. Immun. 694681-4685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bina, J. E., D. Provenzano, C. Wang, X. R. Bina, and J. J. Mekalanos. 2006. Characterization of the Vibrio cholerae vexAB and vexCD efflux systems. Arch. Microbiol. 186171-181. [DOI] [PubMed] [Google Scholar]
  • 6.Chakrabarti, S. R., K. Chaudhuri, K. Sen, and J. Das. 1996. Porins of Vibrio cholerae: purification and characterization of OmpU. J. Bacteriol. 178524-530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chatterjee, A., P. K. Dutta, and R. Chowdhury. 2007. Effect of fatty acids and cholesterol present in bile on expression of virulence factors and motility of Vibrio cholerae. Infect. Immun. 751946-1953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Childers, B. M., and K. E. Klose. 2007. Regulation of virulence in Vibrio cholerae: the ToxR regulon. Future Microbiol. 2335-344. [DOI] [PubMed] [Google Scholar]
  • 9.Colmer, J. A., J. A. Fralick, and A. N. Hamood. 1998. Isolation and characterization of a putative multidrug resistance pump from Vibrio cholerae. Mol. Microbiol. 2763-72. [DOI] [PubMed] [Google Scholar]
  • 10.Curiale, M. S., and S. B. Levy. 1982. Two complementation groups mediate tetracycline resistance determined by Tn10. J. Bacteriol. 151209-215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.DiRita, V. J., C. Parsot, G. Jander, and J. J. Mekalanos. 1991. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA 885403-5407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Eswaran, J., E. Koronakis, M. K. Higgins, C. Hughes, and V. Koronakis. 2004. Three's company: component structures bring a closer view of tripartite drug efflux pumps. Curr. Opin. Struct. Biol. 14741-747. [DOI] [PubMed] [Google Scholar]
  • 13.Evans, K., L. Passador, R. Srikumar, E. Tsang, J. Nezezon, and K. Poole. 1998. Influence of the MexAB-OprM multidrug efflux system on quorum sensing in Pseudomonas aeruginosa. J. Bacteriol. 1805443-5447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fernandez-Recio, J., F. Walas, L. Federici, J. Venkatesh Pratap, V. N. Bavro, R. N. Miguel, K. Mizuguchi, and B. Luisi. 2004. A model of a transmembrane drug-efflux pump from Gram-negative bacteria. FEBS Lett. 5785-9. [DOI] [PubMed] [Google Scholar]
  • 15.Gupta, S., and R. Chowdhury. 1997. Bile affects production of virulence factors and motility of Vibrio cholerae. Infect. Immun. 651131-1134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hase, C. C., and J. J. Mekalanos. 1999. Effects of changes in membrane sodium flux on virulence gene expression in Vibrio cholerae. Proc. Natl. Acad. Sci. USA 963183-3187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Heidelberg, J. F., J. A. Eisen, W. C. Nelson, R. A. Clayton, M. L. Gwinn, R. J. Dodson, D. H. Haft, E. K. Hickey, J. D. Peterson, L. Umayam, S. R. Gill, K. E. Nelson, T. D. Read, H. Tettelin, D. Richardson, M. D. Ermolaeva, J. Vamathevan, S. Bass, H. Qin, I. Dragoi, P. Sellers, L. McDonald, T. Utterback, R. D. Fleishmann, W. C. Nierman, O. White, S. L. Salzberg, H. O. Smith, R. R. Colwell, J. J. Mekalanos, J. C. Venter, and C. M. Fraser. 2000. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406477-483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Herrington, D. A., R. H. Hall, G. Losonsky, J. J. Mekalanos, R. K. Taylor, and M. M. Levine. 1988. Toxin, toxin-coregulated pili, and the toxR regulon are essential for Vibrio cholerae pathogenesis in humans. J. Exp. Med. 1681487-1492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Higgins, D. E., E. Nazareno, and V. J. DiRita. 1992. The virulence gene activator ToxT from Vibrio cholerae is a member of the AraC family of transcriptional activators. J. Bacteriol. 1746974-6980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hung, D. T., and J. J. Mekalanos. 2005. Bile acids induce cholera toxin expression in Vibrio cholerae in a ToxT-independent manner. Proc. Natl. Acad. Sci. USA 1023028-3033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hung, D. T., E. A. Shakhnovich, E. Pierson, and J. J. Mekalanos. 2005. Small-molecule inhibitor of Vibrio cholerae virulence and intestinal colonization. Science 310670-674. [DOI] [PubMed] [Google Scholar]
  • 22.Imai, Y., Y. Matsushima, T. Sugimura, and M. Terada. 1991. A simple and rapid method for generating a deletion by PCR. Nucleic Acids Res. 192785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Iwanaga, M., and K. Yamamoto. 1985. New medium for the production of cholera toxin by Vibrio cholerae O1 biotype El Tor. J. Clin. Microbiol. 22405-408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Iwanaga, M., K. Yamamoto, N. Higa, Y. Ichinose, N. Nakasone, and M. Tanabe. 1986. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 301075-1083. [DOI] [PubMed] [Google Scholar]
  • 25.Koronakis, V., A. Sharff, E. Koronakis, B. Luisi, and C. Hughes. 2000. Crystal structure of the bacterial membrane protein TolC central to multidrug efflux and protein export. Nature 405914-919. [DOI] [PubMed] [Google Scholar]
  • 26.Kovacikova, G., and K. Skorupski. 2001. Overlapping binding sites for the virulence gene regulators AphA, AphB and cAMP-CRP at the Vibrio cholerae tcpPH promoter. Mol. Microbiol. 41393-407. [DOI] [PubMed] [Google Scholar]
  • 27.Kovacikova, G., and K. Skorupski. 2002. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 461135-1147. [DOI] [PubMed] [Google Scholar]
  • 28.Kovacikova, G., and K. Skorupski. 1999. A Vibrio cholerae LysR homolog, AphB, cooperates with AphA at the tcpPH promoter to activate expression of the ToxR virulence cascade. J. Bacteriol. 1814250-4256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Krukonis, E. S., R. R. Yu, and V. J. DiRita. 2000. The Vibrio cholerae ToxR/TcpP/ToxT virulence cascade: distinct roles for two membrane-localized transcriptional activators on a single promoter. Mol. Microbiol. 3867-84. [DOI] [PubMed] [Google Scholar]
  • 30.Linn, T., and R. St Pierre. 1990. Improved vector system for constructing transcriptional fusions that ensures independent translation of lacZ. J. Bacteriol. 1721077-1084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lombardo, M. J., J. Michalski, H. Martinez-Wilson, C. Morin, T. Hilton, C. G. Osorio, J. P. Nataro, C. O. Tacket, A. Camilli, and J. B. Kaper. 2007. An in vivo expression technology screen for Vibrio cholerae genes expressed in human volunteers. Proc. Natl. Acad. Sci. USA 10418229-18234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ma, D., D. N. Cook, M. Alberti, N. G. Pon, H. Nikaido, and J. E. Hearst. 1995. Genes acrA and acrB encode a stress-induced efflux system of Escherichia coli. Mol. Microbiol. 1645-55. [DOI] [PubMed] [Google Scholar]
  • 33.Mathur, J., and M. K. Waldor. 2004. The Vibrio cholerae ToxR-regulated porin OmpU confers resistance to antimicrobial peptides. Infect. Immun. 723577-3583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Merrell, D. S., C. Bailey, J. B. Kaper, and A. Camilli. 2001. The ToxR-mediated organic acid tolerance response of Vibrio cholerae requires OmpU. J. Bacteriol. 1832746-2754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Merrell, D. S., S. M. Butler, F. Qadri, N. A. Dolganov, A. Alam, M. B. Cohen, S. B. Calderwood, G. K. Schoolnik, and A. Camilli. 2002. Host-induced epidemic spread of the cholera bacterium. Nature 417642-645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Merrell, D. S., and A. Camilli. 1999. The cadA gene of Vibrio cholerae is induced during infection and plays a role in acid tolerance. Mol. Microbiol. 34836-849. [DOI] [PubMed] [Google Scholar]
  • 37.Merrell, D. S., and A. Camilli. 2000. Regulation of Vibrio cholerae genes required for acid tolerance by a member of the “ToxR-like” family of transcriptional regulators. J. Bacteriol. 1825342-5350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Merrell, D. S., D. L. Hava, and A. Camilli. 2002. Identification of novel factors involved in colonization and acid tolerance of Vibrio cholerae. Mol. Microbiol. 431471-1491. [DOI] [PubMed] [Google Scholar]
  • 39.Metcalf, W. W., W. Jiang, L. L. Daniels, S. K. Kim, A. Haldimann, and B. L. Wanner. 1996. Conditionally replicative and conjugative plasmids carrying lacZα for cloning, mutagenesis, and allele replacement in bacteria. Plasmid 351-13. [DOI] [PubMed] [Google Scholar]
  • 40.Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  • 41.Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 1702575-2583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Murakami, S., R. Nakashima, E. Yamashita, and A. Yamaguchi. 2002. Crystal structure of bacterial multidrug efflux transporter AcrB. Nature 419587-593. [DOI] [PubMed] [Google Scholar]
  • 43.Nikaido, H. 2001. Preventing drug access to targets: cell surface permeability barriers and active efflux in bacteria. Semin. Cell Dev. Biol. 12215-223. [DOI] [PubMed] [Google Scholar]
  • 44.Ouellette, A. J., and M. E. Selsted. 1996. Paneth cell defensins: endogenous peptide components of intestinal host defense. FASEB J. 101280-1289. [DOI] [PubMed] [Google Scholar]
  • 45.Piddock, L. J. 2006. Clinically relevant chromosomally encoded multidrug resistance efflux pumps in bacteria. Clin. Microbiol. Rev. 19382-402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Piddock, L. J. 2006. Multidrug-resistance efflux pumps—not just for resistance. Nat. Rev. Microbiol. 4629-636. [DOI] [PubMed] [Google Scholar]
  • 47.Poole, K., K. Krebes, C. McNally, and S. Neshat. 1993. Multiple antibiotic resistance in Pseudomonas aeruginosa: evidence for involvement of an efflux operon. J. Bacteriol. 1757363-7372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Provenzano, D., and K. E. Klose. 2000. Altered expression of the ToxR-regulated porins OmpU and OmpT diminishes Vibrio cholerae bile resistance, virulence factor expression, and intestinal colonization. Proc. Natl. Acad. Sci. USA 9710220-10224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Provenzano, D., C. M. Lauriano, and K. E. Klose. 2001. Characterization of the role of the ToxR-modulated outer membrane porins OmpU and OmpT in Vibrio cholerae virulence. J. Bacteriol. 1833652-3662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Provenzano, D., D. A. Schuhmacher, J. L. Barker, and K. E. Klose. 2000. The virulence regulatory protein ToxR mediates enhanced bile resistance in Vibrio cholerae and other pathogenic Vibrio species. Infect. Immun. 681491-1497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Rahman, M. M., T. Matsuo, W. Ogawa, M. Koterasawa, T. Kuroda, and T. Tsuchiya. 2007. Molecular cloning and characterization of all RND-type efflux transporters in Vibrio cholerae non-O1. Microbiol. Immunol. 511061-1070. [DOI] [PubMed] [Google Scholar]
  • 52.Reidl, J., and K. E. Klose. 2002. Vibrio cholerae and cholera: out of the water and into the host. FEMS Microbiol. Rev. 26125-139. [DOI] [PubMed] [Google Scholar]
  • 53.Saier, M. H., Jr., and I. T. Paulsen. 2001. Phylogeny of multidrug transporters. Semin. Cell Dev. Biol. 12205-213. [DOI] [PubMed] [Google Scholar]
  • 54.Salminen, S., E. Isolauri, and T. Onnela. 1995. Gut flora in normal and disordered states. Chemotherapy 41(Suppl. 1)5-15. [DOI] [PubMed] [Google Scholar]
  • 55.Schuhmacher, D. A., and K. E. Klose. 1999. Environmental signals modulate ToxT-dependent virulence factor expression in Vibrio cholerae. J. Bacteriol. 1811508-1514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Shi, H. N., and A. Walker. 2004. Bacterial colonization and the development of intestinal defences. Can. J. Gastroenterol. 18493-500. [DOI] [PubMed] [Google Scholar]
  • 57.Skorupski, K., and R. K. Taylor. 1997. Cyclic AMP and its receptor protein negatively regulate the coordinate expression of cholera toxin and the toxin-coregulated pilus in Vibrio cholerae. Proc. Natl. Acad. Sci. USA 94265-270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Skorupski, K., and R. K. Taylor. 1999. A new level in the Vibrio cholerae ToxR virulence cascade: AphA is required for transcriptional activation of the tcpPH operon. Mol. Microbiol. 31763-771. [DOI] [PubMed] [Google Scholar]
  • 59.Sperandio, V., J. A. Giron, W. D. Silveira, and J. B. Kaper. 1995. The OmpU outer membrane protein, a potential adherence factor of Vibrio cholerae. Infect. Immun. 634433-4438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Szybalski, W. 1952. Gradient plate technique for study of bacteria resistance. Science 11646-48. [Google Scholar]
  • 61.Tacket, C. O., R. K. Taylor, G. Losonsky, Y. Lim, J. P. Nataro, J. B. Kaper, and M. M. Levine. 1998. Investigation of the roles of toxin-coregulated pili and mannose-sensitive hemagglutinin pili in the pathogenesis of Vibrio cholerae O139 infection. Infect. Immun. 66692-695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Taylor, R. K., V. L. Miller, D. B. Furlong, and J. J. Mekalanos. 1987. Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin. Proc. Natl. Acad. Sci. USA 842833-2837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Thakran, S., H. Li, C. L. Lavine, M. A. Miller, J. E. Bina, X. R. Bina, and F. Re. 2008. Identification of Francisella tularensis lipoproteins that stimulate the toll-like receptor (TLR) 2/TLR1 heterodimer. J. Biol. Chem. 2833751-3760. [DOI] [PubMed] [Google Scholar]
  • 64.Thelin, K. H., and R. K. Taylor. 1996. Toxin-coregulated pilus, but not mannose-sensitive hemagglutinin, is required for colonization by Vibrio cholerae O1 El Tor biotype and O139 strains. Infect. Immun. 642853-2856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Tischler, A. D., and A. Camilli. 2005. Cyclic diguanylate regulates Vibrio cholerae virulence gene expression. Infect. Immun. 735873-5882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Van Bambeke, F., Y. Glupczynski, P. Plesiat, J. C. Pechere, and P. M. Tulkens. 2003. Antibiotic efflux pumps in prokaryotic cells: occurrence, impact on resistance and strategies for the future of antimicrobial therapy. J. Antimicrob. Chemother. 511055-1065. [DOI] [PubMed] [Google Scholar]
  • 67.Xu, Q., M. Dziejman, and J. J. Mekalanos. 2003. Determination of the transcriptome of Vibrio cholerae during intraintestinal growth and midexponential phase in vitro. Proc. Natl. Acad. Sci. USA 1001286-12891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Zhu, J., and J. J. Mekalanos. 2003. Quorum sensing-dependent biofilms enhance colonization in Vibrio cholerae. Dev. Cell 5647-656. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES