Abstract
Protein nucleases and RNA enzymes depend on divalent metal ions to catalyze the rapid hydrolysis of phosphate diester linkages of nucleic acids during DNA replication, DNA repair, RNA processing, and RNA degradation. These enzymes are widely proposed to catalyze phosphate diester hydrolysis using a “two-metal-ion mechanism.” Yet, analyses of flap endonuclease (FEN) family members, which occur in all domains of life and act in DNA replication and repair, exemplify controversies regarding the classical two-metal-ion mechanism for phosphate diester hydrolysis. Whereas substrate-free structures of FENs identify two active site metal ions, their typical separation of >4 Å appears incompatible with this mechanism. To clarify the roles played by FEN metal ions, we report here a detailed evaluation of the magnesium ion response of T5FEN. Kinetic investigations reveal that overall the T5FEN-catalyzed reaction requires at least three magnesium ions, implying that an additional metal ion is bound. The presence of at least two ions bound with differing affinity is required to catalyze phosphate diester hydrolysis. Analysis of the inhibition of reactions by calcium ions is consistent with a requirement for two viable cofactors (Mg2+ or Mn2+). The apparent substrate association constant is maximized by binding two magnesium ions. This may reflect a metal-dependent unpairing of duplex substrate required to position the scissile phosphate in contact with metal ion(s). The combined results suggest that T5FEN primarily uses a two-metal-ion mechanism for chemical catalysis, but that its overall metallobiochemistry is more complex and requires three ions.
Key cellular processes such as DNA replication, DNA repair, RNA processing, and RNA degradation require the rapid hydrolysis of the phosphate diester linkages of nucleic acids. The uncatalyzed hydrolysis of phosphate diesters under biological conditions is an extremely slow process with an estimated half-life of 30 million years at 25 °C (1). Protein nucleases and RNA enzymes produce rate enhancements of 1015-1017 to allow this reaction to proceed on a biologically useful time scale. Most enzymes catalyzing phosphate diester bond hydrolysis have a requirement for divalent metal ions. Based largely upon crystallographic observations, most metallonucleases are proposed to catalyze reactions using a two-metal-ion mechanism (Fig. 1a) analogous to that suggested for the phosphate monoesterase alkaline phosphatase (2, 3), although this view is not universally accepted. Three recent reviews present contrasting views on the roles of metal ions in protein nuclease and RNA enzyme reactions and illustrate this controversy (4-6).
FIGURE 1.
The two-metal-ion mechanism proposed for reactions of metallonucleases and the active site of T5FEN showing the varying positions of metal ions in FEN structures. a, two metal-ion mechanism. One metal ion acts as a source of nucleophilic hydroxide ion and binds to a non-bridging oxygen of the scissile phosphate diester acting as an electrophilic catalyst. A second metal ion is coordinated to the leaving group oxygen assisting with leaving group departure and binds to the same non-bridging oxygen of the scissile phosphate diester. b, active site structure of T5FEN (1UT5, gray with purple carboxylate residues) illustrating the loop of the helix-three-turn-helix (H3TH) (teal) motif and seven active site carboxylates present in similar positions in all FENs and the eighth carboxylate (D201) present in the active sites of bacteriophage and bacterial enzymes (see supplemental Fig. S1). Two metal ions, M1 and M2 (purple) are bound with a separation of 8 Å. Metal ions observed in structures of T4FEN (1TFR, cyan), MjFEN (Methanococcus jannaschii, 1A77, rose), hFEN (1UL1x, green), positioned by overlay, are shown. Although all FENs conserve seven active site carboxylates, the position of M2 observed in each structure is variable.
One family of metallonucleases over which there has been considerable mechanistic debate are the flap endonucleases (FENs)3 (7-12), which are present in all domains of life and play a key role in DNA replication and repair. Unlike most metallonucleases, which typically possess a cluster of three or four active site carboxylates, the FEN active site is constructed from seven or eight acidic residues located in similar positions in FENs from a range of organisms (Fig. 1b, see also supplemental Fig. S1) (7, 9, 10, 13-16). Several FEN x-ray structures also contain two active site carboxylate-liganded divalent metal ions, designated as metals 1 and 2 (9, 13-15). The position of metal 1 is similar in all cases, but the metal 2 location varies. In all but one structure of human FEN (hFEN), the spacing of these metal ions exceeds that demanded by a two-metal-ion mechanism, which needs to be ≤4 Å for the two ions to bind the same oxygen atom (Fig. 1a). Only two structures of enzyme-DNA complexes exist, but neither contain bound metal ions (8, 17).
To investigate the roles played by metal ions in the FEN reaction, we have carried out a detailed evaluation of the magnesium ion response of T5FEN, and of the inhibition of magnesium- and manganese ion-supported reactions by calcium ions. Together the data suggest that the major acceleration of phosphate diester hydrolysis requires at least two viable cofactor ions, and so could utilize a two-metal-ion mechanism, but that the metallobiochemistry of T5FEN is more complex and overall involves at least three metal ions.
EXPERIMENTAL PROCEDURES
Materials—T5FEN was purified to homogeneity as described (18). HP5F substrate (5′-FAM-pd(CGCTGTCGAACACACGCTTGCGTGTGTTC)) was prepared as described (19) and after purification, divalent metal ion contaminants were removed by treatment with Chelex resin. ICP mass spectrometry was used to confirm the absence of significant divalent metal ion contamination in all materials.
Steady State Kinetic Analyses—Steady state kinetic parameters of T5FEN were evaluated at 37 °C using HP5F substrate in 25 mm CHES or potassium glycinate, pH 9.3, 0.1 mg/ml bovine serum albumin, and 1 mm dithiothreitol as described (19). MgCl2 was added to the desired concentration and the ionic strength (MgCl2 + KCl) adjusted to 80 mm using KCl. Substrate concentrations were varied around the Km, and reactions were sampled and quenched by addition of an equal volume of 25 mm EDTA at appropriate time intervals. Reactions were analyzed by dHPLC equipped with a fluorescence detector and initial rates (v) were calculated as described (19). Steady state catalytic parameters were determined at each Mg2+ concentration by curve fitting to the Michaelis-Menten equation. Plots of v/[E] versus [S], where [S] ≪ Km and 29[S] ≤ [Mg2+]/10 were also used to determine kcat/Km.
Calcium Inhibition—Reaction mixtures containing 0.1 or 2 mm MgCl2, HP5F (3 or 1 μm, respectively), 25 mm potassium glycinate, pH 9.3, 0.1 mg/ml bovine serum albumin, appropriate amounts of T5FEN (400-1500 pm), and varying CaCl2 with the appropriate amount of KCl to maintain the same ionic strength in all experiments, were used to determine the initial rate of reaction in the presence of Ca2+. For manganese-supported reactions, reaction mixtures contained 100 μm MnCl2, 100 nm HP5F, 25 mm MOPS, pH 7.5, 0.1 mg/ml bovine serum albumin, 200-1500 pm T5FEN, and CaCl2 with the appropriate amount of KCl. Reactions were analyzed as above to determine kobs (kobs = v/[E]) as a function of calcium ion concentration.
Curve Fitting—All curve fitting was carried out by non-linear regression fitting using Kaleidagraph software (Synergy Software, Reading, PA) where appropriate weighted according to individual error values, using Equations 1-7 (see “Results”).
RESULTS
Stimulation of FEN Catalysis by Magnesium Ions—To elucidate the role and minimal number of metal ions involved in the T5FEN-catalyzed reaction, kinetic parameters were monitored as a function of magnesium ion concentration. As the concentration of Mg2+ was varied, the ionic strength of reaction mixtures was kept constant by adjusting the amount of potassium chloride present. A fluorescent 29 nucleotide 5′-overhanging DNA hairpin substrate (HP5F) was employed. The characteristics of the T5FEN-catalyzed reaction of HP5F have been reported previously (19-21). As both maximal steady state and single turnover rates of Mg2+-supported reactions reach a pH-independent plateau above pH 8.5, pH 9.3 was selected as the pH optimum for the experiments. The variations of the individual kinetic parameters with magnesium ion concentration are shown in Fig. 2, a-c, and sample individual experiments are shown as supplemental Fig. S2.
FIGURE 2.
Variation of the steady state catalytic parameters of T5FEN as a
function of magnesium ion concentration. Experiments were conducted at pH
9.3 and 37 °C with varying amounts of MgCl2 and KCl to maintain
constant ionic strength. All measurements represent the result of three
independent experiments with standard errors shown. a, variation in
kcat as a function of magnesium ion concentration. Slopes
of 0 (red), 1 (blue), and 2 (green) are
illustrated. The data have been fit to Equation 2 (“Results”),
yielding KDMgES1 = 0.04 ± 0.003 mm and
KDMgES2 = 2.3 ± 0.06 mm and
(kcat)max = 146 ± 1 min-1.
b, variation in 1/Km as a function of magnesium
ion concentration fitted to Equation 3 with KDMgE1 =
KDMgE2 (black curve, yields
KDMgE1 = KDMgE2 0.22 ± 0.02
mm and (1/Km)max = 0.03 ±
0.003 nm-1) and Equation 4 where n = 2 (red
curve, yields
= 0.07
± 0.007 mm2, and
(1/Km)max = 0.03 ± 0.003
nm-1). c, variation in
kcat/Km for as a function of magnesium
ion concentration fitted to Equation 5 with
= 0.07 mm2
(black curve, yields KDMgE2 = 4.9 ± 1.4
mm and
(kcat/Km)max = 4.2 ±
1 min-1 nm-1) and Equation 6 with
KDMgE1 = KDMgE2 = 0.21 mm
(blue curve, yields KDMgE3 = 6.0 ± 1.8
mm and
(kcat/Km)max = 4.6 ±
1.3 min -1 nm-1). Data shown as black
circles are derived from the individual catalytic parameters whereas data
shown as red circles are the observed rate constant at low
concentrations of substrate where 29[S] < [Mg]/10.
The turnover number (kcat) is magnesium ion-dependent
and increases until a Mg2+-independent plateau is observed above 10
mm. Below 10 μm Mg2+, reactions no longer
proceed to completion, and therefore data were not collected below this
concentration. At low magnesium ion concentration (10-100 μm),
kcat has a second order dependence on divalent metal ion
concentration (Fig.
2a, green slope of 2 in log-log plot) that
becomes first order (Fig.
2a, blue slope of 1) at cofactor concentrations
greater than 100 μm. This change in reaction order cannot be
accounted for by the participation of a single Mg2+ in the
FEN-catalyzed reaction (see Equation 1). A reaction supported by a single ion
would display first order dependence (Fig.
2a, slope of 1 in log-log plot) at all concentrations of
magnesium ions ≤ KDMgES. Instead the minimal number of
metal ions that could give rise to the behavior observed in
Fig. 2a is 2. Moreover
the change in reaction order requires that these two metal ions are bound
independently and have differing affinities, but that for a reaction to
proceed, both ions must be present. A model of this situation leads to
Equation 2, where (kcat)obs is the observed
turnover number at a given concentration of magnesium ions,
KDMgES1 and KDMgES2 are the respective
apparent magnesium ion dissociation constants from the ES complex, and
kcat(max) is the maximal turnover rate at infinite
magnesium ion concentration. At low concentrations of metal ions ([Mg] <
KDMgES1 and KDMgES2), two metal ion
binding sites of differing affinity need to be occupied to produce a
catalytically active form of the enzyme giving rise to the slope of 2. At
higher concentrations of magnesium ions ([Mg] < KDMgES2
but [Mg] > KDMgES1, so that
(KDMgES1 + [Mg]) = [Mg]), the higher affinity site is
saturated, and the reaction becomes first order as only the low affinity site
is titrated and the occupancy of both sites is necessary for reaction to
proceed. Curve fitting of the data to Equation 2 yields metal ion dissociation
constants of KDMgES1 = 0.04 ± 0.003 mm
and KDMgES2 = 2.25 ± 0.06
mm.
Product release is partially rate-limiting for T5FEN-catalyzed hydrolysis of HP5F (22). Thus, the rate constants under single turnover conditions (kST) were also monitored as a function of magnesium concentration, and are 2-3-fold greater than kcat in all cases (supplemental Fig. S3). The response to magnesium ion concentration is the same as for the kcat data and could be fitted to Equation 2 to give KDMgES1 and KDMgES2 values of 0.09 ± 0.01 mm and 2.8 ± 0.35 mm, respectively. These values are in good agreement with those obtained from the kcat data, and so the parameters obtained from Fig. 2a apply to the magnesium-dependent events prior to product release.
HP5F binds to T5FEN weakly in the absence of divalent metal ions
(KD > 15 μm). Substrate/product binding
equilibria, as reflected by 1/Km, are magnesium
ion-dependent and Km reaches a minimum (0.04 ± 0.01
μm) above 0.25 mm Mg2+
(Fig. 2b). In the
Mg2+-dependent range, the slope of the log-log plot is 1.8 ±
0.2, suggesting a second order dependence. This magnesium-dependent behavior
can only be explained by the involvement of at least two metal ions, but could
potentially arise from two different models. In one model, two metal ions bind
independently, and the presence of both is required to stabilize one or more
enzyme-substrate state(s). However, to give rise to the slope close to 2 over
the whole Mg2+-dependent range, both metal ions must bind with
virtually identical binding constants. Applying this model to the data
(Equation 3, where (1/Km)obs is the observed
parameter at a given magnesium ion concentration,
(1/Km)max is the maximal reciprocal of the
concentration of substrate required to convert half the enzyme into the
form(s) preceeding the rate-limiting step(s) at infinite magnesium ion
concentration, and KDMgE1 and KDMgE2
are the respective apparent magnesium ion dissociation constants from free
enzyme, with KDMgE1 and KDMgE2 kept
identical) yields values of KDMgE1 (=
KDMgE2) = 0.21 ± 0.02 mm
(Fig.
2b).
In an alternative model, the metal ions bind cooperatively to the enzyme. A
curve fit to this scheme (Equation 4, n = 2, where
is the product of 2 apparent
magnesium ion dissociation constants from free enzyme) yields
= 0.07 ± 0.01
mm2. The difference between independent and cooperative
behavior is only evident as the curves approach saturation, where an
independent binding model produces a more gradual change to metal
ion-independent behavior (see Fig.
2b). Distinguishing between these two models is generally
difficult and especially so for this data set because Km
measurements for nucleases derived from discontinuous assays are typically
associated with errors of
±30%.
The magnesium ion dependence of the overall FEN reaction
(kcat/Km) is shown in
Fig. 2c. The apparent
second order rate constant can be obtained in two ways, either from the
individual catalytic parameters reported above, or as the gradient of a plot
of v/[E] versus [S] at concentrations of [S] ≪
Km. Both of these approaches produce identical data within
experimental error (Fig.
2c). In the latter case, the total concentration of
phosphate diesters in HP5F was equal to or lower than 10% of the concentration
of Mg2+, ruling out the possibility that Mg2+ binding to
HP5F is affecting the cofactor dependence. The apparent second order rate
constant increases with magnesium concentration, reaching a
Mg2+-independent plateau above 2 mm. Importantly, the
slope of the log-log plot at low Mg2+ concentrations is 2.9
± 0.2, requiring the participation of at least three metal ions. As
with the 1/Km data, either independent binding or
cooperative models could explain the behavior. Furthermore, as this is at
least a three-ion process, combinations of independent and cooperative models
are plausible. All of these models fit the data reasonably. To maintain
consistency with the data derived from the individual catalytic parameters, a
combination of cooperative and independent binding models (Equation 5) with
= 0.07 mm2
produces a convincing data fit and a value for the dissociation constant of
the third magnesium ion from the enzyme of 4.9 ± 1.4 mm
(KDMgE3). If the independent binding model is used
(Equation 6 with KDMgE1 = KDMgE2 =
0.21 mm), KDMgE3 = 6.1 ± 1.8
mm.
One caveat on the interpretation of this and any metal ion titration data is that the experiments only report on the presence and affinity of magnesium ions in the tested data range. If one or more metal ions are tightly bound over the entire range allowing data collection, then the total number of metal ions required to support the overall catalytic process is 4 or more.
Inhibition of FEN Catalysis by Calcium Ions—When supplied as the sole cofactor, calcium ions do not support FEN catalysis. However, as is typical for other divalent metal ion-dependent nucleases, Ca2+ ions have been demonstrated to stabilize protein-DNA interactions in the absence of catalytically viable cofactors (12). To investigate the effect of added calcium ions on the Mg2+-supported FEN reaction, the rate of reaction was measured as a function of Ca2+ concentration at pH 9.3 in the presence of subsaturating Mg2+, but with saturating HP5F. The effects of addition of calcium ions on the Mn2+-supported FEN reaction were also investigated. For Mn2+-supported reactions, the pH was reduced to 7.5 to avoid the problems associated with the formation of manganese hydroxides at higher pH values. This pH value is still above the measured pKa for the Mn2+-supported FEN-catalyzed reaction of HP5F (21). All reactions were inhibited by addition of Ca2+ (Fig. 3). To evaluate the apparent Ki at a given concentration of cofactor, data were fitted to a simple competitive inhibition model (Equation 7) where kobs is the normalized initial rate (v/[E]) at a given concentration of calcium ions, k0 is v/[E] in the absence of calcium ions, and Ki is equal to the concentration of calcium ions that produces 50% inhibition at the respective concentration of viable divalent metal ion cofactor. In all cases, the data fit acceptably to a simple competitive inhibition model up to 80% inhibition (kobs/k0 = 0.2) (Fig. 3a). At 2 mm Mg2+ Ki = 0.22 ± 0.02 mm whereas decreasing the concentration of Mg2+ to 0.1 mm decreased Ki = 0.037 ± 0.002 mm, indicating that Ca2+ inhibition is competitive with Mg2+. At 0.1 mm Mn2+ the Ki = 1.2 ± 0.1 mm. The 30-fold higher concentration of Ca2+ ions required to inhibit the Mn2+ reaction by a factor of 2 may in part be a consequence of the greater affinity of the FEN protein for Mn2+ versus Mg2+ (12, 21). However, by necessity Mn2+ and Mg2+ experiments had to be carried out at different pH values, and pH-dependent effects cannot be ruled out. When Mn2+ was supplied as the cofactor for the EcoRVcatalyzed reaction of plasmid substrates, addition of calcium ions stimulated or first stimulated then inhibited reactions (23). This was explained by the formation of a mixed enzyme Mn2+Ca2+ species that was more reactive than an Mn2+Mn2+ form. However, a detailed study at low concentrations of Ca2+ revealed that no stimulation of activity was observed in the Mn2+-supported FEN reaction (Fig. 2b).
![]() |
(Eq.7) |
FIGURE 3.
The inhibitory effects of added calcium ions on Mg2+- and Mn2+-supported T5FEN reactions. Experiments were conducted at 37 °C with varying amounts of CaCl2 and KCl to maintain the same ionic strength in all experiments. Reactions supported by Mg2+ were studied at pH 9.3, whereas those supported by Mn2+ were studied at pH 7.5 as described under “Experimental Procedures.” a, variation in kobs/k0 as a function of calcium ion concentration where kobs is the observed normalized initial rate (v/[E]) at a given concentration of Ca2+ and k0 is v/[E] in the absence of Ca2+. Reactions contained 0.1 mm Mg2+ (triangles), 2 mm Mg2+ (diamonds), or 0.1 mm Mn2+ (circles). Data were fitted to Equation 7 to yield respective values of apparent KI (the concentration of Ca2+ where kobs/k0 = 0.5) of 0.037 ± 0.002 mm, 0.22 ± 0.02 mm, and 1.2 ± 0.1 mm. b, the variation in kobs/k0 as a function of Ca2+ concentration for a reaction containing 0.1 mm Mn2+. Combined standard errors for kobs/k0 are shown. The black line shows the best fit to a simple competitive inhibition scheme where one Ca2+ displaces one Mn2+ (Equation 7). The red line is a slope of -2 indicating a dependence on 1/[Ca2+]2 at high Ca2+. c, variation in kobs/k0 as a function of Ca2+ concentration for a reaction containing 2 mm Mg2+. Combined standard errors for kobs/k0 are shown. The black line shows the best fit to Equation 7. The red line is a slope of -2 indicating a dependence on 1/[Ca2+]2 at high Ca2+.
The observation that the overall FEN reaction requires the presence of at least three magnesium ions (Fig. 2c) suggests that a competitive inhibition scheme based on binding one Ca2+ ion (Equation 7) could be too simplistic as the calcium ions could replace more than one of the viable cofactor ions. Evidence that this is the case is observed at higher concentrations of inhibitory ions, where the Ca2+ dependence deviates from that predicted from a simple competitive inhibition model (Equation 7). In these regions, the slopes of log-log plots are -2.0 ± 0.1 (0.1 mm Mn2+) and -2.1 ± 0.2 (2 mm Mg2+) rather than the slope of -1 predicted by the simple competitive inhibition model (Fig. 3, b and c). Thus the simultaneous binding of two calcium ions inhibits the FEN reaction. However, a model where the presence of two calcium ions is the sole inhibitory form of the enzyme-substrate complex is also inadequate as this would give rise to a slope of -2 over the entire Ca2+-dependent data range. Assuming that Ca2+ ions inhibit the reaction by displacing catalytically competent cofactors, the FEN protein must possess at least two viable cofactor ions at specific sites, and replacement of either or both of these by Ca2+ significantly reduces activity. However, it is possible that one of the three FEN metal ions can be replaced by Ca2+ without altering the ability to catalyze the reaction. A similar biphasic response to inhibitory Ca2+ ions has been noted for the magnesium-supported reactions of the Tetrahymena ribozyme (24).
DISCUSSION
The data presented here demonstrate that the overall T5FEN-catalyzed reaction requires at least three magnesium ions. However, most FEN x-ray structures (in the absence of substrate) show only two divalent metal ions bound (Fig. 1b), consistent with ITC studies of divalent metal ion binding to T5FEN (12). This implies that a third metal ion binds in the presence of substrate and has a lower association constant for the free enzyme. There are several structural precedents for the binding of additional active site metal ions by nucleases in the presence of substrate or products. A recent example is RNase HI where x-ray crystallography revealed the presence of a single magnesium ion in the absence of substrate (25), but an inhibited enzyme-nucleic complex contained two active site magnesium ions (26). However, debate has focused on the functional relevance of the metal ions within co-crystal structures and whether these additional metal ions are required for catalysis of phosphate diester hydrolysis.
For the T5FEN reaction, the magnesium ion response of the maximal FEN reaction rate (kcat or kST) requires at least two independently bound magnesium ions. The calcium ion inhibition data also provide evidence for two inhibitory metal ion binding sites. This is most simply explained by a competitive inhibition scheme where replacement of either or both of the catalytically essential viable cofactors leads to inactivation. The finding that at least two viable cofactor ions are required to render the FEN protein catalytically competent makes it plausible that FEN derives its major rate acceleration using a two-metal-ion mechanism. This mechanism involves two metal ions interacting with the same oxygen atom of the scissile phosphate diester and requires they must have a separation of ≤4Å (Fig. 1a). The separation of the two metal ions (designated metal 1 and 2) observed in the T5FEN structure (8 Å) is much greater than this (Fig. 1b). However, in one hFEN structure two metal ions are liganded with a separation of 3.4 Å (Fig. 1b and supplemental Fig. S1) (15) to the same central carboxylate of the FEN active site, in an analogous fashion to the metal ion coordination observed in other nucleases (3, 26). The third T5FEN metal ion (metal 3), implicated by this study, could bind to Asp-130 in close proximity to metal 1 in an analogous fashion to the metal coordination observed in hFEN, and support a two-metal-ion mechanism for chemical catalysis. Mutation of Asp-130, or its equivalent in other FENs, leads to undetectable activity, supporting a key role for this Asp-130 site in metal ion coordination (12, 27, 28). In contrast mutation of metal 2 coordinating carboxylates in T5FEN produces readily detectable activity (12), suggestive metal 2 does not play a vital role in catalysis. Superposition of hFEN and T5FEN structures demonstrate that the third metal ion implicated by this study could be accommodated within the T5FEN active site bound to Asp-130 to support a two metal ion mechanism (Fig. 1b). However, the possibility remains that metal ions not involved in direct scissile bond interactions could contribute substantive rate acceleration by transition state stabilization (29) and the location of the third metal ion required by the T5FEN reaction merits further investigation.
Metal ions involved in the overall FEN catalytic process could potentially play roles in substrate binding equilibria and/or chemical catalysis. Therefore, this study provides evidence that between one and three ions could participate in FEN substrate equilibria as the overall FEN reaction has a three metal ion requirement. The magnesium ion dependence of 1/Km can only be explained by the participation of at least two ions. For enzyme reactions rate limited by steps other than the chemical reaction under steady state conditions, Km values define the concentration of substrate required to convert half the enzyme into the form(s) proceeding the rate-limiting step(s) (30). As product release is partially rate-limiting for the WT T5FEN-catalyzed reaction of HP5F (kST = 2.3 kcat), the stability of enzyme-product species is measured by Km. Furthermore, the stability of any intermediates formed after initial interaction of enzyme and substrate would also be reflected in this parameter. In the absence of direct interrogation of all of these enzyme-substrate and enzyme-product equilibria, any interpretation of the metal ion dependence of 1/Km is tentative, but the data suggest a role for metal ions in stabilizing T5FEN-substrate equilibria.
Support for a requirement for metal ion(s) for productive substrate binding is provided by a recent bacteriophage T4FEN structure solved in complex with pseudo-Y DNA (8). This structure lacks divalent metal ions and has a mutation of metal 1-liganding central carboxylate (D132N). The DNA substrate makes no contacts with the FEN active site lacking metal ions, presumably due to the electrostatic repulsion by the carboxylates. Thus, bound metal ion(s) are probably required to stabilize a FEN-DNA complex where substrate is positioned for reaction to occur.
An intriguing feature of the T4FEN DNA structure is that the scissile phosphate corresponding to the major site of FEN reaction, one nucleotide into the duplex region at the site of bifurcation, is located within duplex DNA bound parallel to the active site. Positioning metal 1 within the T4-DNA complex according to a T4FEN structure without substrate bound (9) placed this ion 7 Å away from this scissile phosphate (8) (supplemental Fig. S4b). Metal 2 is at a much greater distance from the major reaction site (8). Nevertheless, a model of T5FEN-DNA interaction, based upon overlay with the T4-DNA structure, is in excellent agreement with experimental data on the interactions of the protein with the duplex and the 3′-overhang of the pseudo-Y (supplemental Fig. S4a) (19, 31). This makes it difficult to envisage how the scissile phosphate, one nucleotide into the duplex region, can bind within the active site while still maintaining a Watson-Crick terminal base pair and the functional substrate-protein contacts. However, breaking the terminal base pair and making at least the first nucleotide and reaction site extrahelical would allow active site binding while maintaining substrate-protein contacts. The metal dependence of substrate equilibria observed here may be the consequence of a metal dependent conformational change, analogous to the nucleotide flipping seen in base excision repair enzymes (32), which positions the scissile bond within the active site (supplemental Fig. S4c).
The reactions of all FENs may have an overall three metal ion requirement. However, in archaeal and hFEN structures (10, 14-17) the protein N terminus occupies a position similar to metal ion 2 in phage enzymes (supplemental Fig. S1). In bacteriophage and bacterial FEN structures, this region is disordered (7, 9, 13). Bacteriophage FENs lacking the N-terminal regions possess wild type activity (12, 33), whereas the functional relevance of the N-terminal region of archaeal and mammalian FENs is untested. It is possible that the N terminus might substitute for metal ion 2 in these enzymes. While the role played by metal 2 deserves further investigation it could act in stabilization of FEN-substrate equilibria and/or may play a non-essential but rate accelerating role in chemical catalysis. It is intriguing to note that the same function may be provided by the protein in higher organism FENs.
Other phosphoryl transferases have three metal ion active sites. For phosphate diesterases that contain three active site zinc ions, such as nuclease P1 (34), phospholipase C (35, 36), and endonuclease IV (37, 38), all three metals are suggested to act in chemical catalysis, but different mechanisms involving these three metal ions have been proposed. Several magnesium-dependent nucleases with three metal ion binding sites may also exist, such as the group I intron (39), EcoRV (40), and 3′-5′ exonuclease (41). Even the prototype two-metal-ion mechanism phosphoryl transferase, the phosphate monoesterase alkaline phosphatase, has an active site composed of two zinc ions plus one magnesium ion, and magnesium ions stimulate activity (2). Thus our new results on T5FEN in the context of existing data argue that three metal ion active sites may be a more common phenomena than previously suspected. Additional metal ions could influence biological efficacy by either moderating chemical reactivity or physical steps of the catalytic cycle such as substrate association, conformational changes, and enzyme-product stability. Thus, while a mechanism can be envisaged for rate accelerations of phosphate monoesterases and diesterases involving two metal ions, the biological function of other phosphoryl transferases in DNA replication, DNA repair, RNA processing, and RNA degradation may well involve a third ion or its functional equivalent.
Supplementary Material
Acknowledgments
We thank Elaine Frary for technical assistance, Alan Cox for recording the ICP mass spectra, and Hal Dixon (Cambridge) and Structural Cell Biology of DNA Repair (SBDR) members for discussions.
This work was supported, in whole or in part, by National Institutes of Health Grant CA081967 (to J. A. T.) and SBDR Program Grant P01 CA92584 (to J. A. T.). This work was also supported by BBSRC Grants B20079 and F0147321 (to J. A. G. and N. H. W.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1-S4.
Footnotes
The abbreviations used are: FEN, flap endonuclease; MOPS, 4-morpholinepropanesulfonic acid; CHES, 2-(cyclohexylamino)ethanesulfonic acid.
References
- 1.Schroeder, G. K., Lad, C., Wyman, P., Williams, N. H., and Wolfenden, R. (2006) Proc. Natl. Acad. Sci. U. S. A. 103 4052-4055 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kim, E. E., and Wyckoff, H. W. (1991) J. Mol. Biol. 218 449-464 [DOI] [PubMed] [Google Scholar]
- 3.Beese, L. S., and Steitz, T. A. (1991) EMBO J. 10 25-33 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Sigel, R. K. O., and Pyle, A. M. (2007) Chem. Rev. 107 97-113 [DOI] [PubMed] [Google Scholar]
- 5.Yang, W., Lee, J. Y., and Nowotny, M. (2006) Mol. Cell 22 5-13 [DOI] [PubMed] [Google Scholar]
- 6.Pingoud, A., Fuxreiter, M., Pingoud, V., and Wende, W. (2005) Cell. Mol. Life Sciences 62 685-707 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Kim, Y., Eom, S., Wang, J., Lee, D., Suh, S., and Steitz, T. (1995) Nature 376 612-616 [DOI] [PubMed] [Google Scholar]
- 8.Devos, J. M., Tomanicek, S. J., Jones, C. E., Nossal, N. G., and Mueser, T. J. (2007) J. Biol. Chem. 282 31713-31724 [DOI] [PubMed] [Google Scholar]
- 9.Mueser, T. C., Nossal, N. G., and Hyde, C. C. (1996) Cell 85 1101-1112 [DOI] [PubMed] [Google Scholar]
- 10.Hosfield, D. J., Mol, C. D., Shen, B. H., and Tainer, J. A. (1998) Cell 95 135-146 [DOI] [PubMed] [Google Scholar]
- 11.Zheng, L., Li, M., Shan, J. X., Krishnamoorthi, R., and Shen, B. H. (2002) Biochemistry 41 10323-10331 [DOI] [PubMed] [Google Scholar]
- 12.Feng, M., Patel, D., Dervan, J. J., Ceska, T., Suck, D., Haq, I., and Sayers, J. R. (2004) Nat. Struct. Mol. Biol. 11 450-456 [DOI] [PubMed] [Google Scholar]
- 13.Ceska, T. A., Sayers, J. R., Stier, G., and Suck, D. (1996) Nature 382 90-93 [DOI] [PubMed] [Google Scholar]
- 14.Hwang, K. Y., Baek, K., Kim, H. Y., and Cho, Y. (1998) Nat. Struct. Biol. 5 707-713 [DOI] [PubMed] [Google Scholar]
- 15.Sakurai, S., Kitano, K., Yamaguchi, H., Hamada, K., Okada, K., Fukuda, K., Uchida, M., Ohtsuka, E., Morioka, H., and Hakoshima, T. (2005) EMBO J. 24 683-693 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Matsui, E., Musti, K. V., Abe, J., Yamasaki, K., Matsui, I., and Harata, K. (2002) J. Biol. Chem. 277 37840-37847 [DOI] [PubMed] [Google Scholar]
- 17.Chapados, B. R., Hosfield, D. J., Han, S., Qiu, J. Z., Yelent, B., Shen, B. H., and Tainer, J. A. (2004) Cell 116 39-50 [DOI] [PubMed] [Google Scholar]
- 18.Sayers, J. R., and Eckstein, F. (1990) J. Biol. Chem. 265 18311-18317 [PubMed] [Google Scholar]
- 19.Williams, R., Sengerová, B., Osborne, S., Syson, K., Ault, S., Kilgour, A., Chapados, B. R., Tainer, J. A., Sayers, J. R., and Grasby, J. A. (2007) J. Mol. Biol. 371 34-48 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Pickering, T. J., Garforth, S. J., Sayers, J. R., and Grasby, J. A. (1999) J. Biol. Chem. 274 17711-17717 [DOI] [PubMed] [Google Scholar]
- 21.Tock, M. R., Frary, E., Sayers, J. R., and Grasby, J. A. (2003) EMBO J. 22 995-1004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Patel, D. V., Tock, M. R., Frary, E., Feng, M., Pickering, T. J., Grasby, J. A., and Sayers, J. R. (2002) J. Mol. Biol. 320 1025-1035 [DOI] [PubMed] [Google Scholar]
- 23.Vipond, I. B., Baldwin, G. S., and Halford, S. E. (1995) Biochemistry 34 697-704 [DOI] [PubMed] [Google Scholar]
- 24.McConnell, T. S., Herschlag, D. M., and Cech, T. R. (1997) Biochemistry 36 8293-8303 [DOI] [PubMed] [Google Scholar]
- 25.Yang, W., Hendrickson, W. A., Crouch, R. J., and Satow, Y. (1990) Science 249 1398-1405 [DOI] [PubMed] [Google Scholar]
- 26.Nowotny, M., Gaidamakov, S. A., Crouch, R. J., and Yang, W. (2005) Cell 121 1005-1016 [DOI] [PubMed] [Google Scholar]
- 27.Bhagwat, M., Meara, D., and Nossal, N. G. (1997) J. Biol. Chem. 272 28531-28538 [DOI] [PubMed] [Google Scholar]
- 28.Shen, B. H., Nolan, J. P., Sklar, L. A., and Park, M. S. (1997) Nucleic Acids Res. 25 3332-3338 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Amyes, T. L., Richard, J. P., and Tait, J. J. (2005) J. Am. Chem. Soc. 127 15708-15709 [DOI] [PubMed] [Google Scholar]
- 30.Gutfreund, F. (1995) Kinetics for the Life Sciences, Cambridge University Press, Cambridge
- 31.Dervan, J. J., Feng, M., Patel, D., Grasby, J. A., Artymiuk, P. J., Ceska, T. A., and Sayers, J. R. (2002) Proc. Natl. Acad. Sci. U. S. A. 99 8542-8547 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hitomi, K., Iwai, S., and Tainer, J. A. (2007) DNA Repair (Amst). 6 410-428 [DOI] [PubMed] [Google Scholar]
- 33.Gangisetty, O., Jones, C., Bhagwat, M., and Nossal, N. (2005) J. Biol. Chem. 280 12876-12887 [DOI] [PubMed] [Google Scholar]
- 34.Volbeda, A., Lahm, A., Sakiyama, F., and Suck, D. (1991) EMBO J. 10 1607-1618 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Hough, E., Hansen, L. K., Birknes, B., Jynge, K., Hansen, S., Hordvik, A., Little, C., Dodson, E., and Derewenda, Z. (1989) Nature 338 357-360 [DOI] [PubMed] [Google Scholar]
- 36.Hansen, S., Hough, E., Svensson, L. A., Wong, Y. L., and Martin, S. F. (1993) J. Mol. Biol. 234 179-187 [DOI] [PubMed] [Google Scholar]
- 37.Hosfield, D. J., Guan, Y., Haas, B. J., Cunningham, R. P., and Tainer, J. A. (1999) Cell 98 397-408 [DOI] [PubMed] [Google Scholar]
- 38.Garcin, E. D., Hosfield, D. J., Desai, S. A., Haas, B. J., Björas, M., Cunningham, R. P., and Tainer, J. A. (2008) Nat. Struct. Mol. Biol. 15 515-522 [DOI] [PubMed] [Google Scholar]
- 39.Shan, S. O., Yoshida, A., Sun, S. G., Piccirilli, J. A., and Herschlag, D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96 12299-12304 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Horton, N. C., and Perona, J. J. (2004) Biochemistry 43 6841-6857 [DOI] [PubMed] [Google Scholar]
- 41.Han, H., Rifkind, J. M., and Mildvan, A. S. (1991) Biochemistry 30 11104-11108 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.




