Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Nov 1.
Published in final edited form as: Dev Biol. 2008 Aug 15;323(1):130–142. doi: 10.1016/j.ydbio.2008.08.006

Drosophila Homologue of the Rothmund-Thomson Syndrome Gene: Essential Function in DNA Replication During Development

Jianhong Wu 1, Christopher Capp 1, Liping Feng 2, Tao-shih Hsieh 1,*
PMCID: PMC2600506  NIHMSID: NIHMS77203  PMID: 18755177

Summary

Members of the RecQ family play critical roles in maintaining genome integrity. Mutations in human RecQL4 cause a rare genetic disorder, Rothmund-Thomson syndrome. Transgenic mice experiments showed that the RecQ4 null mutant causes embryonic lethality. Although biochemical evidence suggests that the Xenopus RecQ4 is required for the initiation of DNA replication in the oocyte extract, its biological functions during development remain to be elucidated. We present here our results in establishing the use of Drosophila as a model system to probe RecQ4 functions. Immunofluorescence experiments monitoring the cellular distribution of RecQ4 demonstrated that RecQ4 expression peaks during S phase, and RecQ4 is expressed only in tissues active in DNA replication, but not in quiescent cells. We have isolated Drosophila RecQ4 hypomorphic mutants, recqEP and recq423, which specifically reduce chorion gene amplification of follicle cells by 4–5 fold, resulting in thin and fragile eggshells, and female sterility. Quantitative analysis on amplification defects over a 14-kb domain in chorion gene cluster suggests that RecQ4 may have a specific function at or near the origin of replication. A null allele recq419 causes a failure in cell proliferation, decrease in DNA replication, chromosomal fragmentation, and lethality at the stage of first instar larvae. The mosaic analysis indicates that cell clones with homozygous recq419 fail to proliferate. These results indicate that RecQ4 is essential for viability and fertility, and is required for most aspects of DNA replication during development.

Keywords: Rothmund-Thomson syndrome, Drosophila, RecQ4, DNA replication

Introduction

The evolutionarily conserved RecQ DNA helicase family plays a critical role in maintaining the genomic integrity of organisms from bacteria to man (Brosh and Bohr, 2007; Hanada and Hickson, 2007). Mutations in three human members, BLM, WRN and RecQL4, result in Bloom’s syndrome, Werner’s syndrome and Rothmund-Thomson syndrome (RTS), respectively (Bachrati and Hickson, 2003; Bachrati and Hickson, 2008; Khakhar et al., 2003). RTS is a rare congenital disorder characterized by a shorter stature, skeletal abnormalities, poikiloderma, premature aging, and predisposition to cancers, especially osteogenic sarcoma (Kitao et al., 1998; Kitao et al., 1999; Vennos and James, 1995; Wang et al., 2003). RecQL4 mutations also are associated with RAPADILINO syndrome (Siitonen et al., 2003) and Baller-Gerold syndrome (Van Maldergem et al., 2006). All the RecQ4 mutations identified in RTS patients affect the putative helicase domain, but maintain at least its N-terminal portion intact (Larizza et al., 2006).

There are a number of transgenic mouse lines generated as models for RTS. A RecQL4 knock-out line deleting exons 5–8, sequences upstream of the conserved helicase domain, shows early embryonic death (Ichikawa et al., 2002), implying this region is essential for viability. However, there are two additional transgenic RecQL4 lines that have different phenotypic outcomes. One has exon 13 deleted, thus disrupting the helicase domain, for which only 5% of homozygous mice survived for two weeks after birth (Hoki et al., 2003). However, these survivors had retarded growth and developed other defects that were similar to symptoms of RTS. The embryonic fibroblast from this RecQL4 mutant mouse has impeded cell proliferation. The other transgenic line has a deletion from exon 9 through 13, thus resulting in a truncated peptide containing the first N-terminal 480 amino acid residues of mouse RecQL4 (Mann et al., 2005). All the homozygous animals were born alive, and 84% of them could survive to adulthood; cells from these surviving mice showed aneuploidy.

Molecular analysis of RTS patients (Larizza et al., 2006) and RTS modeling in transgenic mice (Hoki et al., 2003; Ichikawa et al., 2002; Mann et al., 2005) suggest that while the conserved helicase domain is essential for genome stability, the N-terminal portion of RecQL4 may be indispensable for viability. Recent studies (Matsuno et al., 2006; Sangrithi et al., 2005) show that the N-terminus of metazoan RecQ4 bears homology to yeast Sld2/Drc1, which are phosphorylated by cyclin-dependent kinases during S-phase, and this modification is required for establishment of DNA replication (Masumoto et al., 2002; Noguchi et al., 2002; Tanaka et al., 2007; Zegerman and Diffley, 2007). Biochemical analysis indicates that the RecQ4 N-terminus is required for initiation of DNA replication in Xenopus oocyte extract (Matsuno et al., 2006; Sangrithi et al., 2005). However, it remains to be elucidated whether RecQ4 has essential functions outside of embryonic development, and what these functions are.

We are interested in establishing Drosophila as a model system for probing RecQ4 functions, especially with respect to DNA replication. In Drosophila, several distinct modes of DNA replication have been characterized during development. They include syncytial DNA replication during early embryogenesis, mitotic replication in embryo, and in specific tissues of larvae and adults. Furthermore, Drosophila has specialized forms of replication such as endoreplication and gene amplification, which occurs in larval tissues and in ovarian follicle cells, respectively. Therefore, Drosophila provides an excellent system to probe specific functions of a gene of interest involved in DNA replication during development. Using the Drosophila chorion gene amplification system, it has been shown that proteins essential for genomic replication, such as ORC1, ORC2 and MCM6, are also required for chorion gene amplification (Asano and Wharton, 1999; Landis et al., 1997; Royzman et al., 1999; Schwed et al., 2002). In addition, cyclin E, a gene essential for cell cycle entry into S phase, is required for chorion gene amplification (Calvi et al., 1998). Therefore, it was proposed that chorion origins are under cell cycle control similar to other origins, with a requirement of assembly of Pre-Replication Complex (Calvi et al., 1998; Schwed et al., 2002).

Three members of the RecQ helicase family have been found in Drosophila: DmBLM (Kusano et al., 2001), RecQ5 (Sekelsky et al., 1999), and RecQ4 (Drysdale and Crosby, 2005). Accumulating evidence suggests that DmBLM plays critical roles in repairing DNA double-strand breaks and in meiotic recombination (Adams et al., 2003; Kusano et al., 2001; Macris et al., 2006; McVey et al., 2007). Although it has been shown that Drosophila RecQ5 has DNA helicase activity (Ozsoy et al., 2003), no genetic function has been associated with it in this system. For RecQ4 there are no functional studies carried out at present for this gene in Drosophila.

Here we use both cytological and genetic approaches to show that RecQ4 is required for several distinct modes of DNA replication during development, including diploid cell DNA replication, endoreplication and chorion gene amplification. A null mutation in RecQ4 causes failure in cell proliferation, reduced DNA replication, chromosome fragmentation and lethality of larvae, demonstrating the essentiality of RecQ4. Hypomorphic mutations in RecQ4 reduce chorion gene amplification of follicle cells, resulting in thin and fragile eggshells, and female sterility.

Materials and methods

Fly strains

  • w*; Sb1/TM3, P{ActGFP}JMR2, Ser1

  • P{hsFLP}22, y1, w*; P{arm-lacZ.V}70C, P{neoFRT}80B

  • y1, w1118; P{πM}75C, P{neoFRT}80B

  • w1118; P{Ubi-GFP(S65T)nls}3L, P{neoFRT}80B/TM3, Sb1

were obtained from Bloomington Drosophila Stock Center. RecQ4 P-element insertion line (stock number G7470), recq4EP, was obtained from GenExel, South Korea.

Generation of RecQ4 deficient strains

We mapped the P-element insertion to the 5’ untranslated region, 43 base pairs (bp) upstream of the translation initiation codon of RecQ4 gene, referred to as recq4EP in this paper. Hypomorphic mutant recq423 and null mutant recq419 were isolated from an imprecise excision mutagenesis (Engels et al., 1990).

Construction of transgene P{RecQ4-GFP}

P{RecQ4-GFP} is a transgene with the insertion of a coding sequence for GFP (green fluorescent protein) after the last codon of RecQ4 and before the termination codon. The 5’ portion of the RecQ4 gene, up to the last codon, was cloned by using primers 5’-GAAACTAGTCCACTGTCGTGATGC-3’ and 5’-GGATCTCGAGCGTACGCCTCTTGATAATAGC-3’ to amplify a DNA fragment from Drosophila genomic DNA by PCR. This RecQ4 genomic fragment contained a unique restriction site Spe I and Xho I (underlined in the sequence) at its 5’ and 3’ ends, respectively. The 3’ untranslated region of RecQ4 was amplified by primers 5’-CTGAAGCGGCCGCCCGTAATGTCGGGATGAACCGCCGA-3’ and 5’-GGAGAATTCGAGTCTCGTTTATGATTATAAAC-3’, resulting in a DNA fragment with unique restriction sites Not I and EcoR I (underlined in the sequence) at its 5’ and 3’ ends, respectively. The GFP fragment with a stop codon had an Xho I site at its 5’ end and a Not I site at its 3’ end. The tripartite, ligated DNA fragments containing RecQ4, GFP, and the RecQ4 3’ untranslated region were inserted into the Xba I/EcoR I site of the pCaSpeR2 vector DNA (Thummel et al., 1988), generating a genomic RecQ4 transgene with an in-frame fusion of GFP at its carboxyl terminus. The construct was sequenced before it was microinjected into the embryos as previously described (Rubin and Spradling, 1982).

Generation of RecQ4 antibody

Primers 5’-ACTCAGCTAGCATGTACTACAAACTGAAGACATCC-3’ and 5’-CGGACTCGAGCCTCGGCTTTTTCTCCGCCTTG-3’ were synthesized to construct a truncation of RecQ4, consisting of amino acids 50 to 521. This region of RecQ4 protein was selected because it was not part of the RecQ helicase domain (amino acid 867 to 1231). The PCR products were digested by Nhe I and Xho I, and were inserted into pET23b(+) (Novagen, Madison, WI) cut by Nhe I and Xho I. The resulting construct was sequenced before it was moved into the expression strain BL21(DE3) (Novagen, Madison, WI). The truncated protein was isolated from the insoluble inclusion bodies. Ni-NTA agarose (Qiagen, Valencia, CA) was used to purify the truncation protein under denaturing conditions according to the protocol supplied by the manufacturer. This protein was used as an antigen to immunize rabbits to generate antibody and as a ligand for affinity purification of the antibody. The purified antibody was used to detect RecQ4 by Western blotting.

BrdU incorporation

BrdU (5-bromo-2’-deoxyuridine) incorporation and detection was performed as described previously (Lilly and Spradling, 1996) with modifications. Briefly, tissues were dissected in Schneider’s Drosophila Medium (Invitrogen, Carlsbad, CA), and incubated at 25°C for 1 hour in the same medium with 1 mg/ml of BrdU (Sigma, St. Louis, MO). After washing out the unincorporated nucleotide, tissues were fixed for 15 minutes with 6% formaldehyde. Fixed samples were treated with 3N HCl/0.1% Triton X-100 for 30 minutes. Tissues were washed extensively with PBS, followed by preparations for immunofluorescence, as described in the previous section. PCI software (Compix, Inc. Sewickley, PA) was used to quantify the signal of BrdU incorporation.

Immunofluorescence and reagents

Triple labeling of embryos followed the procedures as described (Zhang et al., 1996). Immunostaining and image collection were performed as previously described (Wu et al., 2006). DAPI (4,6-diamidino-2-phenylindole) and propidium iodide (Sigma, St. Louis, MO) were used at 0.5 µg/ml. The following antibodies were used: rabbit anti-GFP (Molecular Probes, Eugene, OR) (1:2,000); mouse anti-adducin monoclonal antibody (1:100) (DSHB, Iowa University, Iowa City, IA); mouse anti-α-Tubulin antibody (Sigma, St. Louis, MO) (1:1,000); mouse anti-BrdU (Becton Dickinson, San Jose, CA) (1:50); rabbit anti-Topo II antibody (1:2,000) (Sander and Hsieh, 1983).

Mosaic analysis

A mosaic analysis was performed using the FLP/FRT mitotic recombination system (Xu and Rubin, 1993). recq419 null mutation was incorporated into FRT chromosome of y1, w1118; P{πM}75C, P{neoFRT}80B. Mutant clones were induced 3 days after egg deposition, and wing imaginal discs were dissected from wandering larvae, stained with anti-GFP antibody and DAPI.

Quantitative Real-time PCR

recq4EP egg chambers of stage 11–13 were collected, and genomic DNA was isolated as previously described (Bender et al., 1983). In parallel, DNA from wildtype control was used as an external control template. The primers used were 5’-TCTTCTGGCTACTGGATGCTGG-3’ and 5’-TTGTGAATGGCTTATGGGTGGGCG-3’, 5’-GGTGGTGAGCCTGTTCTTCAAG-3’ and 5’-ACTGGTGTGTGGAATGTCTCGG-3’ for ACE3 and ry (3R non-amplified internal control), respectively; 5’-GGCATCAATCCAAATGTCACG-3’ and 5’-TTGCTCTTCGGCTTCTGGTGTG-3’, 5’-TCTCCTGCTCTATCGTTCACGG-3’ and 5’-GCAATCGCCAGTCTTGTCTGTG-3’ for ACE1 and wh (Wu et al., 2006) (X chromosome non-amplified control), respectively. ACE3 and ACE1 are chorion gene amplification control elements on 3R and X, respectively. For both chorion clusters, three experiments were carried out. Ratio of chorion gene amplification= (ACE3 (or ACE1) copy number in recq4EP/ ACE3 (or ACE1) copy number in wildtype)/ (ry (or wh) copy number in recq4EP/ ry (or wh) copy number in wildtype). For figure 8 (G), in addition to ry primers as internal control, the following primer sets were used to quantify gene amplification surrounding ori-β (denoted as 0) on the third chromosome.

  • -7For: CAGGTCAGGATAAGGTTCTACACTGG

  • -7Rev: ACTGTTTGCCCTCATCGCCCTGCTC

  • -5For: GCTCCTCCCACTACATACTCTCGG

  • -5Rev: CCTCCTCTTCATCGTCATCATACAAC

  • -3For: TGCTTCAGAAATCGTTGCGAC

  • -3Rev: CATAGTCCTCCGTCCTACCTTTTG

  • -1.7For: TCTTCTGGCTACTGGATGCTGG

  • -1.7Rev: TTGTGAATGGCTTATGGGTGGGCG

  • ori-For: AGTTACCATAAGTAAAGAATCTA

  • ori-Rev: AGTGATTACTAGTCACATACAA

  • +1.7For: AATGGAGGCGATACGATACGC

  • +1.7Rev: TTTGTTGGGGAACTTTCTGTGG

  • +3For: CTTGAGGCCAGAAAGCGCCACAGTTC

  • +3Rev: CCAAACAAGTCAGCAGATGCG

  • +4For: GCTATAAAAGCAATTTGGACACACG

  • +4Rev: CATCAGGCAGAGAAGACGTAGGG

  • +7For: GAGGTCTGCTTGCTACGGATTG

  • +7Rev: GGTAAACTGGGGCTACTTCTCGG

Other techniques

Larval brains were dissected in EBR buffer (Lin et al., 1994) and squashed as previously described (Pimpinelli et al., 2000). 4-day old adult flies, ovaries, or testes were used for Western blotting performed as previously described (Wu et al., 2006).

Results

We address the RecQ4 functions in the following three major aspects (A to C).

A. Expression and Cellular Distribution of RecQ4

RecQ4 expression peaks in S-phase during the cell cycle

To gain insight into RecQ4 functions in Drosophila, we analyzed expression patterns and subcellular localization by immunostaining. We constructed a RecQ4 genomic DNA transgene, P{RecQ4-GFP}, with an in-frame fusion of green fluorescent protein (GFP) to the carboxyl terminus of RecQ4 (diagrammatically shown in Fig. 4A). It is located on the second chromosome and homozygous viable and fertile. Since P{RecQ4-GFP} is fully functional based on genetic analysis (see later sections in this paper), we used RecQ4-GFP fusion protein as a surrogate marker for the intracellular distribution of RecQ4.

RecQ4-GFP distribution in syncytial mitotic cycles in early embryos is shown in Fig. 1A. RecQ4 is nuclearly localized during interphase, and is coincident with DNA staining. After nuclear envelopes breakdown in prophase, RecQ4-GFP begins to leak into the cytoplasm. During metaphase and anaphase, this protein is dispersed in the cytoplasm and is not associated with chromatin. After the new nuclear envelopes reform during telophase, RecQ4-GFP is localized into nuclei. These precellular cycles of embryogenesis before cycle 14 lack G1 and G2 phases, and DNA replication begins immediately after the completion of mitosis (Foe et al., 1993). Therefore, all interphase nuclei in these cycles, which are active in DNA replication, have maximal levels of RecQ4.

In embryos after cellularization, when cell cycle slows down and becomes asynchronous (Foe et al., 1993), the subcellular localization of RecQ4-GFP also changes throughout the cell cycle (Fig. 1B). In interphase, RecQ4-GFP is associated with chromatin (marked as cell 1 in Fig. 1B). During metaphase and anaphase, RecQ4-GFP is stripped from chromatin and exhibits a cytoplasmic localization (Fig. 1B, cell 2 and 3). Once the new nuclear envelopes form at telophase, the RecQ4-GFP is re-imported into the nuclei (Fig. 1B, cell 4).

Fig. 1.

Fig. 1

Open in a new tab

RecQ4 peaks in S phase during cell cycles. (A) Cellular distribution of RecQ4 during early embryonic cell division. RecQ4-GFP (green), DNA (blue) and tubulin (red) were visualized by confocal microscopy in fixed P{RecQ4-GFP} transgenic embryos. (B) Dorsal view of a cycle 14 embryo stained for RecQ4-GFP (green), DNA (blue) and tubulin (red). The boxed areas are shown at higher magnification in insets. Cells in interphase (1), metaphase (2), anaphase (3) and telophase (4) are outlined. Scale bars, 10 µm (A), 25 µm (B).

We have also analyzed RecQ4 expression in a number of tissues that are mitotically active during larval development. Intense RecQ4-GFP expression can be observed in the central nervous system in third instar larvae, including optic lobes and neuroblasts (Supplementary Fig. S1, A and D), and in wing, eye, and leg imaginal discs (Supplementary Fig. S1, A and G). Both eye and wing imaginal discs offer an opportunity to monitor the regulation of RecQ4 expression during cell cycles. Developmentally programmed cell cycle transition occurs in the eye (Wolff and Ready, 1993) and wing (Johnston and Edgar, 1998) imaginal discs. In the eye imaginal disc, the cells in the morphogenetic furrow are arrested in extended G1 phase, and have no detectable RecQ4-GFP (Fig. 2A). The cells anterior to the furrow are cycling but not synchronous, while those immediately posterior to the furrow are synchronous in the second mitotic wave. Both DNA replication revealed by BrdU incorporation (Fig. 2A) and RecQ4-GFP staining are apparent in the cycling, non-synchronous cells, and in the synchronous, mitotic cells (Fig. 2A). After going through the second mitotic wave, and moving further toward the posterior end, the cells are no longer active in DNA replication and also have diminished RecQ4-GFP (Fig. 2A). In the wing imaginal disc, at the dorsoventral boundary, the zone of non-proliferating cells (ZNC) is composed of three subdomains (Johnston and Edgar, 1998). Cells in the center of the anterior and posterior ZNC are arrested in late G1 phase or in G1/S boundary; those in the dorsal and ventral domains of the anterior ZNC are arrested in G2 phase. RecQ4-GFP expression is noticeably absent in cells arrested in G2 phase, and reduced in G1 cells, but robust in the cycling cells outside of ZNC (Supplementary Fig. S1, G–I).

Fig. 2.

Fig. 2

Open in a new tab

RecQ4 expression is coincident with DNA replication. (A) RecQ4 has higher expression during late G1-S phase transition in the eye imaginal disc (posterior to right). BrdU labeling shows the two mitotic waves. The second one, which is immediately posterior to the morphogenetic furrow (arrowhead), is synchronous. (B) RecQ4 is associated with DNA endoreplication in salivary glands. Following BrdU incorporation (see Materials and methods), eye imaginal discs or salivary glands from wandering larvae were stained with GFP and BrdU antibodies and DAPI for triple staining. Scale bars: 10 µm (A) and 100 µm (B).

The above data therefore suggest that there are high levels of RecQ4-GFP in dividing cells, with maximal expression at S phase when cells are actively engaged in DNA replication. RecQ4 expression is noticeably diminished or absent between G2 to G1 phases.

RecQ4 expression is associated with endoreplication

Besides these mitotic tissues, larvae contain tissues, like salivary glands, that go through extensive endoreplication. Tissues with endoreplication carry out multiple rounds of DNA replication without cytokinesis. In the salivary glands of wandering larvae, there is an anterior-posterior gradient in chromosomal polyploidy of gland cells, resulting in a continuous increase in nuclear size from anterior to posterior (Berendes, 1978). Therefore, the salivary glands offer a unique system in which the anterior cells are active in endoreplication, and the ones in the posterior exit this process. Interestingly, the immunostaining results showed that the level of RecQ4-GFP is the highest in the anterior gland cells, and is reduced in the posterior end (Fig. 2B). Furthermore, BrdU incorporation showed that most of the gland cells with the higher level of RecQ4 also have the stronger BrdU labeling (Fig. 2B).

RecQ4 expression in germ tissues

The major dividing cells in adult flies are in the germ tissues. In females, RecQ4- GFP is localized in the nuclei of germline cells, and in follicle cells throughout oogenesis, with the highest level in germline stem cells and nurse cells of egg chambers at stages 1 to 5 (Fig. 3A). In males, RecQ4-GFP is expressed only in the mitotic domain of the testis, and is then immediately diminished when primary spermatocytes exit mitosis and enter cell growth phase (Fig. 3B). No RecQ4-GFP was detectable afterwards during later stages in spermatogenesis (data not shown). A single testis is a tube with different developmental stages of spermatogenesis laid out in chronological order from germ line stem cells at the anterior-most tip to mature spermatozoa at the opposite end. Mitotic and premeiotic DNA replication occurs only at the tip (Fuller, 1993), where we showed that RecQ4-GFP is abundantly expressed (Fig. 3B). We have also examined the expression of endogenous RecQ4 in germ tissues by Western blotting using an antibody raised against the N-terminus of RecQ4 protein. Indeed, RecQ4 could be detected only in the ovary or testis, but not in the carcass fractions (Fig. 3C). However, it is apparent that RecQ4 protein is present at a higher level in the ovary than testis, consistent with the immunostaining result that RecQ4 is more abundantly expressed during oogenesis than spermatogenesis.

Fig. 3.

Fig. 3

Open in a new tab

RecQ4 expression in germ tissues. (A, B) Confocal images of RecQ4-GFP (green), DNA (blue) and adducin (red) were visualized by staining with rabbit anti-GFP , DAPI and mouse anti-adducin, respectively. The genotype of specimens is P{RecQ4-GFP} /P{RecQ4-GFP} ;RecQ4/RecQ4. Scale bars, 25 µm. (A) RecQ4 is highly expressed in germline stem cells (GSC), nurse cells (N), follicle cells (F), and oocytes (O), examples of which are indicated with arrows. Open arrowhead in the inset of merged image indicates GSC, which was marked by a spherical spectrosome at apical cytoplasm (Deng and Lin, 1997). (B) RecQ4 is expressed only in the mitotic domain of the testis. Branched fusomes mark the growing spermatocytes. (C) In adult flies, RecQ4 can be detected only in the ovary and testis by Western blotting. 4-day old flies were dissected to separate the ovaries or testes from carcasses. Actin serves as a loading control.

Taken together, RecQ4 is specifically expressed in tissues undergoing DNA replication at all developmental stages that we examined in embryos, larvae, and adults. These results suggest that RecQ4 plays a role in DNA metabolism, specifically DNA replication.

B. Phenotypes of RecQ4 Mutants

Drosophila RecQ4 is essential for viability

To probe RecQ4’s potential function in DNA metabolism through genetic means, we endeavored to generate mutants affecting RecQ4 functions. We obtained a Drosophila melanogaster P-element line with an insertion at the 5’-end of RecQ4 gene, and balanced this allele with a balancer chromosome of TM3 or TM3, P{ActGFP}JMR2. We mapped the insertion to 43 nucleotides upstream of the translation initiation codon of RecQ4, and named the allele recq4 EP (Fig. 4A). Its homozygous males and females are viable, albeit with a low viability. No fertility defect was observed for males homozygous for recq4EP. However, homozygous recq4EP females are sterile. The female sterile phenotype is due to a defect in oogenesis (data to be presented in later sections). Since the transgene P{RecQ4-GFP} is able to fully rescue the phenotypes of females homozygous for recq4EP (Fig. 4B), the fertility defect is attributed to the RecQ4 mutation. This genetic rescue also suggests that the transgene P{RecQ4-GFP} is functional. Western blotting showed that recq4EP is a hypomorphic mutant, with RecQ4 expression level approximately 6% of the wildtype level (Fig. 4C).

Fig. 4.

Fig. 4

Open in a new tab

RecQ4 gene, and its mutants and transgene. (A) Genomic structure of RecQ4, and its mutants and transgene. We mapped the P-element insertion site to 43 bp before the translation initiation codon of RecQ4 for mutant recq4EP. P-element imprecise excision of recq4EP gave rise to recq423 with an insert of ~3.8 kb left at the original P-element insertion site, and recq419, which has an insert of ~3.5 kb at the original P-element insertion site and a deletion of 3220 bp from the nucleotide 43 bp upstream of the translation initiation codon to nucleotide 3174 bp downstream of the translation initiation codon of RecQ4. Introns are indicated by gray. Dashed line shows the deletion. Black bar indicates the putative helicase region. The construction of transgene P{RecQ4-GFP} was described in Materials and methods. (B) Transgene P{RecQ4-GFP} could fully rescue the infertility of recq4EP females. Three 3-day old females were crossed with 3 males of Oregon R P2 strain for each cross. Parents were removed 3 days later. All the F1 progeny were scored. Standard deviations are shown in error bars (n, cross number). (C) Western blotting shows that mutants recq4EP and recq423 are hypomorphic alleles and recq419 is a null mutant. Top panel, ovaries were dissected from 4-day old females, homogenized and the proteins were separated by SDS-PAGE; the RecQ4 protein was detected with rabbit anit-RecQ4 antibody. Bottom panel, quantification of ratio of total RecQ4 (including RecQ4-GFP, since it is fully functional.) to loading control actin for top panel. (D) RecQ4 was not detectable in first instar larvae homozygous for recq419 by Western blotting. Extract from whole animals was probed with RecQ4 antibody by Western blotting. Actin was used as a loading control.

Additionally, we carried out mutagenesis by mobilizing the P-element in recq4EP to isolate more severe mutants. We obtained three groups of mutants based on the phenotypes. Of them, allele recq419 has the phenotype of homozygous lethality, and allele recq423 is phenotypically similar to hypomorph recq4EP. Recq42 is one of the excisions exhibiting no apparent defect. Molecular mapping experiments confirmed that it is a RecQ4 line with a precise excision, and it is used as a wildtype control for the experiments presented here.

Phenotypes of recq419 and recq423 could be fully rescued by transgene P{RecQ4-GFP} (data not shown), suggesting that the lethality of recq419 and the female sterile phenotype of recq423 are indeed caused by the mutations of RecQ4, and that the RecQ4 gene is essential for both viability and fertility.

RecQ4 null mutant causes lethality

To elucidate the molecular basis of these RecQ4 mutants, genomic mapping experiments showed that at the original P-element insertion site, there is a remnant insertion of about 3.8 kb and 3.5 kb in recq423 and recq419, respectively. In addition, recq419 has a deletion of 3220 bp from the nucleotide 43 bp upstream to nucleotide 3174 bp downstream of the translation initiation codon of RecQ4 (Fig. 4A). Since this deletion removes most of the RecQ4 protein coding region (at least 1041 amino acid residues from the N-terminus, including 175 amino acids of the putative helicase domain), recq419 is expected to be a null mutant. This was also confirmed by the following biochemical experiment.

Since we could recover flies homozygous for recq419 harboring the transgene P{RecQ4-GFP}, we took advantage of the fact that the RecQ4-GFP fusion protein could be distinguished from the endogenous one by molecular mass, and thus by Western blotting. In the P{RecQ4-GFP}-rescued flies homozygous for recq419, only RecQ4-GFP could be detected, while the precise excision control harboring the transgene had both RecQ4-GFP and RecQ4, and the wildtype control had the endogenous RecQ4 only (Fig. 4C). Moreover, no RecQ4 protein could be detected in homozygous recq419 larvae, in contrast to the wildtype control (Fig. 4D). These Western blotting results demonstrate the specificity of our RecQ4 antibody, and support the molecular mapping data that the recq419 is a RecQ4 null allele.

Quantification of the immunoblot experiments confirmed that recq423 is a hypomorphic mutant, with a level of RecQ4 expression about 10% of that from wildtype (Fig. 4C). Since recq423 is female sterile as well, these data suggest that there are different threshold levels for RecQ4 necessary for the viability and the fertility of the organism. Interestingly, recq4EP, another female sterile mutant with reduced viability, has about 6% of the wildtype RecQ4 expression level (Fig. 4C). Thus a level of about 6–10 % of the wildtype RecQ4 expression allows for viability, albeit at a reduced level, but is not sufficient for fertility.

RecQ4 is required for larvae development

To dissect the lethality phenotype of recq419 homozygotes, we sorted the newly hatched larvae based on the presence or absence of GFP fluorescence. The heterozygous larvae are fluorescent due to the balancer chromosome TM3, P{ActGFP}JMR2, and the homozygous mutant are not. We did not observe a deviation from Mendelian ratio of the homozygous vs. heterozygous progeny, suggesting that the recq419 homozygotes could survive through embryogenesis to larval stage, relying on the maternal supply of RecQ4 (data not shown).

Although the null mutant larvae have no apparent defect when they are hatched, they stop growing and begin to show an apparent growth retardation, and decreased survival 3 days after egg deposition (AED) (Fig. 5). Their heterozygous siblings showed normal growth and viability; 90% of the larvae developed into pupae 9 days AED, and 83% developed to adults 12 days AED (Fig. 5). In contrast, about 13 days AED, all the recq419 larvae eventually died (Fig. 5). According to the morphology of the mouth hook apparatus, nearly all of the dead larvae were arrested in the first instar. Thus, RecQ4 is essential for the development beyond the first instar stage.

Fig. 5.

Fig. 5

Open in a new tab

RecQ4 is required for larval development. Larvae heterozygous or homozygous for recq419 were sorted 24 hours after egg deposition (AED), and normally fed at 25°C. Surviving larvae were counted daily for mutants (◊). Mutant larvae never developed beyond larval stages. Since heterozygous siblings began to pupate 6 days AED, we only scored the pupae (□) and adults (∆). The data (mean ± SD) represent the results of triplicate experiments.

RecQ4 is required for cell proliferation

To determine the potential cell proliferation defects in recq19 mutants, a mosaic analysis was performed in wing imaginal discs using the FLP/FRT mitotic recombination system (Xu and Rubin, 1993). This approach allows us to compare cell proliferation between homozygous recq419 mutant cells and adjacent homozygous wildtype ones in a recq419 heterozygous background. We induced mutant clones 3 days AED, dissected wing imaginal discs from wandering larvae, and stained them with ani-GFP antibody and DAPI. In wildtype control (Fig. 6, left panel), wildtype sister clones marked by the absence of GFP (dark region) or intense fluorescence from two copies of the GFP gene (bright region) were observed. However, in the recq419 mutant mosaic analysis (FIG. 6, right panel), a homozygous wildtype clone marked by two copies of GFP (Fig. 6, right panel, outlined bright area) was present, the adjacent mutant sister clone of homozygous recq419 marked by absence of GFP was absent, indicating that homozygous recq419 mutant cells could not proliferate. The total absence of homozygous mutant clones highlights a stringent requirement of RecQ4 for cell division.

Fig. 6.

Fig. 6

Open in a new tab

RecQ4 is required for cell proliferation. Confocal images of wing imaginal discs used for mosaic analysis are shown. Mitotic recombination was induced 3 days AED. Cells without mitotic recombination have one copy of GFP gene. Left panel, wildtype sister clones marked by absence of GFP (black region) or intense fluorescence from two copies of the GFP gene (bright region). Right panel, sister clones of a homozygous recq419 mutant clone marked by absence of GFP and a homozygous wildtype clone marked by two copies of GFP. Scale bars, 25 µm.

C. RecQ4 Function in DNA Replication

Loss of RecQ4 function leads to DNA replication failure in larvae

For investigating the essential function of RecQ4 for larval development, we dissected and examined the null mutant larvae and their heterozygous siblings. Two groups of cells, polyploid and diploid, are present in Drosophila larvae. Polyploid cells do not divide but undergo DNA endoreplication, giving rise to cells with higher ploidy and larger size during larval development (Edgar and Orr-Weaver, 2001). Diploid cells are rapidly dividing, and many are present in imaginal discs, which are the progenitors of the body parts in adult flies. The larvae increase their mass by 200 fold, primarily by an increase in cell size rather than by an increase in cell number (Edgar and Orr-Weaver, 2001).

Polyploid cells are present in many larval tissues, including salivary gland and the surrounding fat body. We first examined salivary glands from both null mutants and heterozygous siblings 5 days AED. Salivary glands of null mutants are dramatically reduced in size compared with those of their heterozygous siblings (Fig. 7A, B). Since endoreplication serves to increase nuclear and cellular size in salivary gland cells, the lower DNA content and smaller nuclear size (Fig. 7A, B, arrowhead) suggest that endoreplication is arrested in salivary glands from the null mutant. This is not unique to salivary glands, as it was also observed in another endoreplicating tissue, fat body, surrounding the salivary gland (Fig. 7A, B, arrow). In addition, there is a group of diploid cells in the larval salivary gland, imaginal ring cells, situated between the gland and duct (Fig. 7, boxed area in A and B, and enlarged in C and D), which resume mitosis at the molting from second to third instar larvae (Madhavan and Schneiderman, 1977). In mature third instar larvae each ring has about 150 cells (Bryant and Levinson, 1985). In mutant salivary glands, no more than 4 cells were observed at imaginal ring sites (Fig. 7D), in contrast to more than 100 cells for heterozygous siblings (Fig. 7C). Therefore, mitotic cell division is also arrested in salivary imaginal rings of larvae homozygous for recq419.

Fig. 7.

Fig. 7

Open in a new tab

RecQ4 is required for larval mitotic cell DNA replication and endoreplication. (A–D) Salivary glands from recq419/TM3 (A, C) or recq419/recq419 (B, D) larvae 5 days AED were stained with DAPI to visualize nuclei. Arrowheads and arrows point to the nuclei of gland and fat body polyploid nuclei, respectively (A, B). Imaginal rings are in boxed areas in (A) and (B), and shown at a higher magnification in (C) and (D), respectively. (E, F) Confocal images of BrdU labeling for visualization of DNA replication in brains. Brains were dissected from recq419/TM3 (E) or recq419/recq419 (F) larvae 3 days AED. (G) Quantification of intensity of BrdU labeling for (E) and (F). Error bars indicate standard deviations (n, the sample number). (H, I) No intact metaphase DNA plate was observed in mutant brains. Propidium iodide-stained metaphase plate (H) and fragmented chromosomes (I) are shown. The metaphase defects were quantified in (J). The larval brains were squashed 3 days AED as previously described (Pimpinelli et al., 2000). 2457 and 1184 total cells were scored for recq419/TM3 and recq419/recq419, respectively. Scale bars: 100 µm in (A) and (B); 25 µm in (C) and (D); 50 µm in (E) and (F); 10 µm in (H) and (I).

To further characterize the defects in mitotic cell divisions, we dissected brains from larvae 3 days AED and carried out BrdU incorporation to visualize DNA replication. The overall size of mutant brain is smaller than that of the heterozygous control (Fig. 7E, F), which is consistent with the observation that the null mutant larvae begin to show lagged growth 3 days AED. BrdU incorporation in the null mutant brain is severely reduced compared with the heterozygous control (Fig. 7E, F). Quantification of the BrdU labeling signals revealed that DNA synthesis in the RecQ4 null mutant is less than 1% of that in the heterozygous sibling (Fig. 7G). Thus, diploid cell DNA synthesis is severely reduced in the absence of RecQ4.

To look closely at the cell fate of brain tissues, we squashed them and scored the metaphase plates by propidium iodide staining. For mutants, no metaphase plates were observed, and 0.34% of total scored nuclei (n=1184) showed fragmented, condensed chromosomes (Fig. 7I, J). However, in heterozygous controls, ~1% of cells (n=2457) were in metaphase, with 0.04% having fragmented chromosome appearances (Fig. 7H, J). The increased frequency of fragmented chromosomes in RecQ4 null mutants most likely is triggered by failures in DNA replication, as mutants for the components in the DNA replication machinery also cause chromosome fragmentation (Landis et al., 1997; Pflumm and Botchan, 2001). However, the exact biochemical role of RecQ4 during DNA replication remains to be elucidated.

RecQ4 is required for chorion gene amplification

The insertion mutants of RecQ4, recq4EP and recq423, are female sterile. We observed fragile eggshells and spiracle defects in embryos laid by these hypomorphic mutants (data not shown). A closer examination of the eggshells of recq4EP revealed structural defects (Fig. 8A, B). These phenotypes are reminiscent of defects seen in mutants of other DNA replication components (Asano and Wharton, 1999; Landis and Tower, 1999; Schwed et al., 2002). Eggshell is made up of chorion protein. The genes encoding the major chorion proteins reside in two clusters in the Drosophila genome: one localized on the X chromosome and the other on the third chromosome. In order to meet the demand for the rapid synthesis of chorion proteins in a short time window, the somatic follicle cells that cover the oocyte amplify the two chorion gene clusters by ~16-fold and ~60-fold, respectively (Orr-Weaver, 1991; Spradling and Mahowald, 1980), with the amplicons forming an onion skin-like structure from the overlapping DNA replication forks (Fig. 8C). In stage 10B of Drosophila oogenesis, chorion gene amplification can be visualized by detecting the incorporated BrdU (Calvi et al., 1998). Four apparent nuclear foci with different intensities can be detected: the most intense BrdU focus corresponds to DNA replication of the chorion genes on the third chromosome, the intermediate one to the chorion locus on the X chromosome (Calvi et al., 1998; Calvi and Spradling, 1999), and the two faint BrdU spots to recently identified amplicons DAFC-30B and DAFC-62D (Claycomb et al., 2004).

Fig. 8.

Fig. 8

Open in a new tab

RecQ4 is required for chorion gene amplification. (A) A phase-contrast view of wildtype egg shows apparent hexagons, which represent the imprints of follicle cells. The rims correspond to the borders of follicle cells. (B) With the same magnification as (A), a close view of the eggshell of an egg laid by a recq4EP female indicates the aberrant patterns of hexagons. (C) Onion skin structure of amplifying chorion gene locus as previously reported (Claycomb et al., 2004; Orr-Weaver, 1991). In stage 10B of oogenesis, chorion gene amplification occurs, and newly synthesized DNA (green) can be visualized by BrdU incorporation (Calvi et al., 1998). Primers for examining the amplifying chorion gene clusters are indicated by arrows and primers for an internal non-amplifying control are marked with arrowheads. (D, E) Confocal images of BrdU labeling of chorion gene loci (green) in follicle cells of wildtype (D) and recq4EP (E); rabbit anti-Topo II antibody was used to mark the nuclei (blue). Scale bars, 10 µm. (F, G) Quantification of chorion gene amplification. Quantitative real-time PCR was performed as described in Materials and methods to quantify chorion gene amplification for wildtype and recq4EP. The data (mean ± SD) represent results from at least three experiments. (F) A pair of primers based on ACE3 or ACE1 was used to quantify gene amplification of the third chromosome or X chromosome. (G) Quantification of gene amplification surrounding ori-β (denoted as distance 0 kb) of chorion gene cluster on the third chromosome was performed using quantitative PCR. Red bars represent wildtype, and blue bars represent recq4EP.

We hypothesized that the phenotype of fragile embryos with thin eggshells is caused by defects in chorion gene amplification. We examined the activities of DNA synthesis in egg chambers from recq4EP by detecting BrdU incorporation, with Topo II staining to visualize nuclei. No apparent defect was observed in follicle cells during mitotic cycles and endocycles before Stage 10B (data not shown). As expected, in wildtype egg chambers starting from Stage 10B, two strong BrdU-positive foci could be detected in most follicle cells, plus two faint ones in some of them (Fig. 8D). However, BrdU incorporation in chorion gene clusters on both the X and third chromosome was greatly reduced in follicle cells of hypomorphic mutants (Fig. 8E), with only a fraction of cells showing BrdU labeling. To quantify the decrease of chorion gene amplification, we carried out quantitative real-time PCR using primers adjacent to the replication origin, and primers based on either ry or wh as controls (Fig. 8C). These experiments showed that chorion gene amplification on both the X and third chromosomes is decreased by about 5 fold (Fig. 8F), relative to the wildtype control, indicating that this hypomorphic mutation commensurately affects the gene amplification of chorion gene clusters in both the X and third chromosomes. Therefore, besides the replication of the whole genome, RecQ4 is also required for a special type of DNA replication, namely chorion gene amplification.

Since chorion gene amplification is origin-dependent, we asked if the decreased gene amplification in hypomorphic recq4EP mutant is due to a functional defect at the replication origin, or during elongation. Since cis-regulatory elements for chorion gene amplification have been well studied for the gene cluster on the third chromosome, we turned to this cluster to further address this issue. 2-D gel analysis has mapped the predominant replication origin, ori-β, a sequence element of about 800 bp in the chorion gene cluster (Delidakis and Kafatos, 1989; Heck and Spradling, 1990). If the main function of RecQ4 were limited to its action at the origin, then one would expect to see a similar defect in amplification at and near the origin. In contrast, if the RecQ4 also had a critical function during elongation, then one would expect to observe a gradient in the decrease of amplification at the loci that are further away from the origin. We analyzed the amplification surrounding ori-β using real-time PCR with primer sets spanning a region of about 14-kb. The results showed that there is a uniform decrease of about 4–5 fold in amplification throughout this region, including ori-β, and sites distal to ori-β (Fig. 8G). This result thus suggests that the predominant function of RecQ4 is at the origin, and not during elongation.

Discussion

Different modes of programmed DNA replication can occur in an organism at specific developmental stages. Our data presented here demonstrate that RecQ4 plays essential roles in several modes of DNA replication during Drosophila development, including diploid cell chromosomal replication, endoreplication, and chorion gene amplification. These results suggest that RecQ4 has an important function in DNA replication in general.

We have isolated hypomorphic and null mutants of Drosophila RecQ4. The null mutation is lethal at the first instar stage. This is due to the reduced DNA replication in both diploid cells, and polyploid cells that undergo DNA endoreplication. The RecQ4 null mutants can develop into the larval stage relying on the maternal supply of RecQ4, since there is a large amount of maternally loaded protein in early embryos. While it is sufficient for embryogenesis, the stored RecQ4 can only support limited larval development.

The hypomorphic mutantions of RecQ4 specifically affect chorion gene amplification. Drosophila chorion gene amplification occurs via a specialized origin-dependent mechanism, following multiple rounds of endoreplication. It results from repeated firings of specific origins located on the X and third chromosomes, and this process requires cyclin E (Calvi et al., 1998), a G1 cyclin, suggesting that chorion origins are under cell cycle control similar to other origins. Given the fact that ORC1 and ORC2 have been implicated in chorion gene amplification (Asano and Wharton, 1999; Landis et al., 1997; Royzman et al., 1999), it has been proposed that chorion origins behave like a Pre-Replication Complex that requires cyclin E/CDK2, but escapes replication inhibition exerted by this kinase (Calvi et al., 1998). Therefore, chorion gene amplification could use some, if not all, of the general DNA replication machinery. We show that RecQ4 is essential for normal chorion gene amplification, and its function may be primarily at the replication origin. Like other components of DNA replication (Landis et al., 1997; Landis and Tower, 1999; Schwed et al., 2002; Whittaker et al., 2000), hypomorphic mutations of RecQ4 specifically reduce chorion gene amplification during oogenesis, resulting in eggshell defects. It has yet to be addressed why the hypomorphic mutation has a more drastic effect on chorion gene amplification. One possibility is that there are different threshold levels of RecQ4 necessary for normal chorion gene amplification vs. other modes of DNA replication. The expression levels of RecQ4 are reduced to between 6–10% of the wildtype levels in the hypomorphic mutants recq4EP and recq423. While this level of RecQ4 is sufficient to support most cellular DNA replication, it is not enough for the more specialized forms of replication like gene amplification, which requires multiple and rapid origin firings. The molecular basis of this differential requirement for RecQ4 levels, and the biochemical role of RecQ4 in gene amplification, will be an important focus for future investigations.

Consistent with its function in DNA replication is the cellular and subcellular localization of RecQ4. Drosophila RecQ4 is expressed in all examined tissues undergoing active DNA replication, and is undetectable in quiescent cells. During the cell cycle, this protein has the highest expression level and is associated with chromatin during S-phase, and dissociates from chromatin during metaphase and anaphase. In addition, the diminishment of RecQ4 occurs coincidently with the exit of DNA replication during spermatogenesis and salivary gland growth of third-instar larvae. In the eye imaginal disc, RecQ4 is tightly regulated during the cell cycle, with a high level of RecQ4 in the cells of the first and second mitotic waves and no RecQ4 detectable in the extended G1-phase cells, suggesting that there is a mechanism to destroy this protein at G2 or G1 phase during eye development. An immunoprecipitation experiment has demonstrated that RecQL4 in human cells is associated with ubiquitin ligases UBR1/UBR2 of the N-end rule pathway (Yin et al., 2004). It has yet to be established whether this pathway is used to regulate RecQ4 in Drosophila during cell cycles.

The published results on the subcellular distribution of RecQL4 in cultured human cells give a confusing and conflicting picture. For example, Petkovic et al. showed that RecQL4 was localized in the nuclei, without any apparent distribution in the cytoplasm (Petkovic et al., 2005), while Werner et al. had an opposite conclusion, that is, RecQL4 was primarily localized in the cytoplasm (Werner et al., 2006). The work of Yin et al. indicated that RecQL4 was distributed in both the nucleus and the cytoplasm (Yin et al., 2004). These discrepancies could be due to the specificity of the antibody used, or to a difference in the culturing conditions of the cells. Our results showed that there is a cell cycle-dependent distribution of RecQ4 between the nucleus and cytoplasm in either the syncytial or post-blastodermal stage during embryogenesis. The subcellular distribution of RecQ4 may indeed depend on both the cell cycle and developmental stage.

While RecQ4 has critical roles in the growth and development of metazoan organisms, its cellular and biochemical functions remain to be elucidated. We report here data demonstrating that Drosophila can be a useful model system to probe the functional aspects of the Rothmund-Thomson Syndrome protein. The null and hypomorphic mutants showed interesting phenotypes related to defects in many aspects of DNA replication during development from embryos to adults. They can be useful genetic tools for further dissection of cellular functions of this essential protein.

Supplementary Material

01. Supplementary Material.

Fig. S1. RecQ4-GFP was highly expressed in mitotically active brain optic lobes, neuroblasts, and imaginal discs. (A–C) The central nerve system (CNS) was dissected from third instar P{RecQ4-GFP} transgenic larvae, and stained with rabbit anti-GFP antibody and DAPI to visualize RecQ4-GFP (green) and DNA (blue), respectively. Optic lobe (ol), eye disc (ed) and leg disc (ld) are indicated. A neuroblast is indicated by an arrow. The brain portions outlined in (A–C) are shown with a higher magnification in (D–F) at a different focus, respectively. (G–I) RecQ4-GFP expression in the wing imaginal disc (anterior to the left). In the wing imaginal disc, at the dorsoventral boundary, the zone of non-proliferating cells (ZNC) is composed of three subdomains (Johnston and Edgar, 1998). Cells in the center of the anterior ZNC and posterior ZNC are arrested in G1 phase. Cells in the dorsal and ventral domains of the anterior ZNC are arrested in G2 phase. RecQ4-GFP has diminished expression in cells arrested in late G1 phase (arrow), but is completely absent in cells arrested in G2 phase (arrowheads). The disc was from wandering P{RecQ4-GFP} transgenic larvae. Scale bars, 50 µm.

Acknowledgements

We thank Carrie Marean-Reardon for her competent technical assistance. The use of the Confocal Microscope Facility and microinjection by Model System Genomics Facility are gratefully appreciated. This work was supported by a National Institute of Health grant (GM29006).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Adams MD, McVey M, Sekelsky JJ. Drosophila BLM in double-strand break repair by synthesis-dependent strand annealing. Science. 2003;299:265–267. doi: 10.1126/science.1077198. [DOI] [PubMed] [Google Scholar]
  2. Asano M, Wharton RP. E2F mediates developmental and cell cycle regulation of ORC1 in Drosophila. Embo J. 1999;18:2435–2448. doi: 10.1093/emboj/18.9.2435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bachrati CZ, Hickson ID. RecQ helicases: suppressors of tumorigenesis and premature aging. Biochem J. 2003;374:577–606. doi: 10.1042/BJ20030491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bachrati CZ, Hickson ID. RecQ helicases: guardian angels of the DNA replication fork. Chromosoma. 2008;117:219–233. doi: 10.1007/s00412-007-0142-4. [DOI] [PubMed] [Google Scholar]
  5. Bender W, Spierer P, Hogness DS. Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and the bithorax complex in Drosophila melanogaster. J Mol Biol. 1983;168:17–33. doi: 10.1016/s0022-2836(83)80320-9. [DOI] [PubMed] [Google Scholar]
  6. Berendes HD. The Salivary Glands. In: Ashburner M, Wright TRF, editors. The Genetics and biology of Drosophila. Academic Press; 1978. pp. 453–498. [Google Scholar]
  7. Brosh RM, Jr, Bohr VA. Human premature aging, DNA repair and RecQ helicases. Nucleic Acids Res. 2007;35:7527–7544. doi: 10.1093/nar/gkm1008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bryant PJ, Levinson P. Intrinsic growth control in the imaginal primordial of Drosophila, and the autonomous action of a lethal mutation causing overgrowth. Dev Biol. 1985;107:355–363. doi: 10.1016/0012-1606(85)90317-3. [DOI] [PubMed] [Google Scholar]
  9. Calvi BR, Lilly MA, Spradling AC. Cell cycle control of chorion gene amplification. Genes Dev. 1998;12:734–744. doi: 10.1101/gad.12.5.734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Calvi BR, Spradling AC. Chorion gene amplification in Drosophila: A model for metazoan origins of DNA replication and S-phase control. Methods. 1999;18:407–417. doi: 10.1006/meth.1999.0799. [DOI] [PubMed] [Google Scholar]
  11. Claycomb JM, Benasutti M, Bosco G, Fenger DD, Orr-Weaver TL. Gene amplification as a developmental strategy: isolation of two developmental amplicons in Drosophila. Dev Cell. 2004;6:145–155. doi: 10.1016/s1534-5807(03)00398-8. [DOI] [PubMed] [Google Scholar]
  12. Delidakis C, Kafatos FC. Amplification enhancers and replication origins in the autosomal chorion gene cluster of Drosophila. Embo J. 1989;8:891–901. doi: 10.1002/j.1460-2075.1989.tb03450.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Deng W, Lin H. Spectrosomes and fusomes anchor mitotic spindles during asymmetric germ cell divisions and facilitate the formation of a polarized microtubule array for oocyte specification in Drosophila. Dev Biol. 1997;189:79–94. doi: 10.1006/dbio.1997.8669. [DOI] [PubMed] [Google Scholar]
  14. Drysdale RA, Crosby MA. FlyBase: genes and gene models. Nucleic Acids Res. 2005;33:D390–D395. doi: 10.1093/nar/gki046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Edgar BA, Orr-Weaver TL. Endoreplication cell cycles: more for less. Cell. 2001;105:297–306. doi: 10.1016/s0092-8674(01)00334-8. [DOI] [PubMed] [Google Scholar]
  16. Engels WR, Johnson-Schlitz DM, Eggleston WB, Sved J. High-frequency P element loss in Drosophila is homolog dependent. Cell. 1990;62:515–525. doi: 10.1016/0092-8674(90)90016-8. [DOI] [PubMed] [Google Scholar]
  17. Foe VE, Odell GM, Edgar BA. Motosis and morphogenesis in the Drosophila embryo: point and counterpoint. In: Bate M, Arias AM, editors. The Development of Drosophila melanogaster. Vol. 1. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 1993. pp. 149–300. [Google Scholar]
  18. Fuller MT. Spermatogenesis. In: Bate M, Arias AM, editors. The Development of Drosophila melanogaster. Vol. 1. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 1993. pp. 71–147. [Google Scholar]
  19. Hanada K, Hickson ID. Molecular genetics of RecQ helicase disorders. Cell Mol Life Sci. 2007;64:2306–2322. doi: 10.1007/s00018-007-7121-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Heck MM, Spradling AC. Multiple replication origins are used during Drosophila chorion gene amplification. J Cell Biol. 1990;110:903–914. doi: 10.1083/jcb.110.4.903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hoki Y, Araki R, Fujimori A, Ohhata T, Koseki H, Fukumura R, Nakamura M, Takahashi H, Noda Y, Kito S, Abe M. Growth retardation and skin abnormalities of the Recql4-deficient mouse. Hum Mol Genet. 2003;12:2293–2299. doi: 10.1093/hmg/ddg254. [DOI] [PubMed] [Google Scholar]
  22. Ichikawa K, Noda T, Furuichi Y. [Preparation of the gene targeted knockout mice for human premature aging diseases, Werner syndrome, and Rothmund-Thomson syndrome caused by the mutation of DNA helicases] Nippon Yakurigaku Zasshi. 2002;119:219–226. doi: 10.1254/fpj.119.219. [DOI] [PubMed] [Google Scholar]
  23. Johnston LA, Edgar BA. Wingless and Notch regulate cell-cycle arrest in the developing Drosophila wing. Nature. 1998;394:82–84. doi: 10.1038/27925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Khakhar RR, Cobb JA, Bjergbaek L, Hickson ID, Gasser SM. RecQ helicases: multiple roles in genome maintenance. Trends Cell Biol. 2003;13:493–501. doi: 10.1016/s0962-8924(03)00171-5. [DOI] [PubMed] [Google Scholar]
  25. Kitao S, Ohsugi I, Ichikawa K, Goto M, Furuichi Y, Shimamoto A. Cloning of two new human helicase genes of the RecQ family: biological significance of multiple species in higher eukaryotes. Genomics. 1998;54:443–452. doi: 10.1006/geno.1998.5595. [DOI] [PubMed] [Google Scholar]
  26. Kitao S, Shimamoto A, Goto M, Miller RW, Smithson WA, Lindor NM, Furuichi Y. Mutations in RECQL4 cause a subset of cases of Rothmund-Thomson syndrome. Nat Genet. 1999;22:82–84. doi: 10.1038/8788. [DOI] [PubMed] [Google Scholar]
  27. Kusano K, Johnson-Schlitz DM, Engels WR. Sterility of Drosophila with mutations in the Bloom syndrome gene--complementation by Ku70. Science. 2001;291:2600–2602. doi: 10.1126/science.291.5513.2600. [DOI] [PubMed] [Google Scholar]
  28. Landis G, Kelley R, Spradling AC, Tower J. The k43 gene, required for chorion gene amplification and diploid cell chromosome replication, encodes the Drosophila homolog of yeast origin recognition complex subunit 2. Proc Natl Acad Sci U S A. 1997;94:3888–3892. doi: 10.1073/pnas.94.8.3888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Landis G, Tower J. The Drosophila chiffon gene is required for chorion gene amplification, and is related to the yeast Dbf4 regulator of DNA replication and cell cycle. Development. 1999;126:4281–4293. doi: 10.1242/dev.126.19.4281. [DOI] [PubMed] [Google Scholar]
  30. Larizza L, Magnani I, Roversi G. Rothmund-Thomson syndrome and RECQL4 defect: splitting and lumping. Cancer Lett. 2006;232:107–120. doi: 10.1016/j.canlet.2005.07.042. [DOI] [PubMed] [Google Scholar]
  31. Lilly MA, Spradling AC. The Drosophila endocycle is controlled by Cyclin E and lacks a checkpoint ensuring S-phase completion. Genes Dev. 1996;10:2514–2526. doi: 10.1101/gad.10.19.2514. [DOI] [PubMed] [Google Scholar]
  32. Lin H, Yue L, Spradling AC. The Drosophila fusome, a germline-specific organelle, contains membrane skeletal proteins and functions in cyst formation. Development. 1994;120:947–956. doi: 10.1242/dev.120.4.947. [DOI] [PubMed] [Google Scholar]
  33. Macris MA, Krejci L, Bussen W, Shimamoto A, Sung P. Biochemical characterization of the RECQ4 protein, mutated in Rothmund-Thomson syndrome. DNA Repair (Amst) 2006;5:172–180. doi: 10.1016/j.dnarep.2005.09.005. [DOI] [PubMed] [Google Scholar]
  34. Madhavan MM, Schneiderman HA. Histological analysis of the dynamics of growth of imaginal discs and histoblast nests during larval development of Drosophila melanogaster. Wilhelm Roux's Archives of developmental biology. 1977;183:269–305. doi: 10.1007/BF00848459. [DOI] [PubMed] [Google Scholar]
  35. Mann MB, Hodges CA, Barnes E, Vogel H, Hassold TJ, Luo G. Defective sister-chromatid cohesion, aneuploidy and cancer predisposition in a mouse model of type II Rothmund-Thomson syndrome. Hum Mol Genet. 2005;14:813–825. doi: 10.1093/hmg/ddi075. [DOI] [PubMed] [Google Scholar]
  36. Masumoto H, Muramatsu S, Kamimura Y, Araki H. S-Cdk-dependent phosphorylation of Sld2 essential for chromosomal DNA replication in budding yeast. Nature. 2002;415:651–655. doi: 10.1038/nature713. [DOI] [PubMed] [Google Scholar]
  37. Matsuno K, Kumano M, Kubota Y, Hashimoto Y, Takisawa H. The N-terminal noncatalytic region of Xenopus RecQ4 is required for chromatin binding of DNA polymerase alpha in the initiation of DNA replication. Mol Cell Biol. 2006;26:4843–4852. doi: 10.1128/MCB.02267-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. McVey M, Andersen SL, Broze Y, Sekelsky J. Multiple functions of Drosophila BLM helicase in maintenance of genome stability. Genetics. 2007;176:1979–1992. doi: 10.1534/genetics.106.070052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Noguchi E, Shanahan P, Noguchi C, Russell P. CDK phosphorylation of Drc1 regulates DNA replication in fission yeast. Curr Biol. 2002;12:599–605. doi: 10.1016/s0960-9822(02)00739-x. [DOI] [PubMed] [Google Scholar]
  40. Orr-Weaver TL. Drosophila chorion genes: cracking the eggshell's secrets. Bioessays. 1991;13:97–105. doi: 10.1002/bies.950130302. [DOI] [PubMed] [Google Scholar]
  41. Ozsoy AZ, Ragonese HM, Matson SW. Analysis of helicase activity and substrate specificity of Drosophila RECQ5. Nucleic Acids Res. 2003;31:1554–1564. doi: 10.1093/nar/gkg243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Petkovic M, Dietschy T, Freire R, Jiao R, Stagljar I. The human Rothmund-Thomson syndrome gene product, RECQL4, localizes to distinct nuclear foci that coincide with proteins involved in the maintenance of genome stability. J Cell Sci. 2005;118:4261–4269. doi: 10.1242/jcs.02556. [DOI] [PubMed] [Google Scholar]
  43. Pflumm MF, Botchan MR. Orc mutants arrest in metaphase with abnormally condensed chromosomes. Development. 2001;128:1697–1707. doi: 10.1242/dev.128.9.1697. [DOI] [PubMed] [Google Scholar]
  44. Pimpinelli S, Bonaccorsi S, Fanti L, Gatti M. Preparation and analysis of Drosophila mitotic chromosomes. In: Sullivan w, Ashburner M, Hawley RS., editors. Drosophila Protocols. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 2000. pp. 3–23. [Google Scholar]
  45. Royzman I, Austin RJ, Bosco G, Bell SP, Orr-Weaver TL. ORC localization in Drosophila follicle cells and the effects of mutations in dE2F and dDP. Genes Dev. 1999;13:827–840. doi: 10.1101/gad.13.7.827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Rubin GM, Spradling AC. Genetic transformation of Drosophila with transposable element vectors. Science. 1982;218:348–353. doi: 10.1126/science.6289436. [DOI] [PubMed] [Google Scholar]
  47. Sander M, Hsieh T. Double strand DNA cleavage by type II DNA topoisomerase from Drosophila melanogaster. J Biol Chem. 1983;258:8421–8428. [PubMed] [Google Scholar]
  48. Sangrithi MN, Bernal JA, Madine M, Philpott A, Lee J, Dunphy WG, Venkitaraman AR. Initiation of DNA replication requires the RECQL4 protein mutated in Rothmund-Thomson syndrome. Cell. 2005;121:887–898. doi: 10.1016/j.cell.2005.05.015. [DOI] [PubMed] [Google Scholar]
  49. Schwed G, May N, Pechersky Y, Calvi BR. Drosophila minichromosome maintenance 6 is required for chorion gene amplification and genomic replication. Mol Biol Cell. 2002;13:607–620. doi: 10.1091/mbc.01-08-0400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Sekelsky JJ, Brodsky MH, Rubin GM, Hawley RS. Drosophila and human RecQ5 exist in different isoforms generated by alternative splicing. Nucleic Acids Res. 1999;27:3762–3769. doi: 10.1093/nar/27.18.3762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Siitonen HA, Kopra O, Kaariainen H, Haravuori H, Winter RM, Saamanen AM, Peltonen L, Kestila M. Molecular defect of RAPADILINO syndrome expands the phenotype spectrum of RECQL diseases. Hum Mol Genet. 2003;12:2837–2844. doi: 10.1093/hmg/ddg306. [DOI] [PubMed] [Google Scholar]
  52. Spradling AC, Mahowald AP. Amplification of genes for chorion proteins during oogenesis in Drosophila melanogaster. Proc Natl Acad Sci U S A. 1980;77:1096–1100. doi: 10.1073/pnas.77.2.1096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Tanaka S, Umemori T, Hirai K, Muramatsu S, Kamimura Y, Araki H. CDK-dependent phosphorylation of Sld2 and Sld3 initiates DNA replication in budding yeast. Nature. 2007;445:328–332. doi: 10.1038/nature05465. [DOI] [PubMed] [Google Scholar]
  54. Thummel CS, Boulet AM, Lipshitz HD. Vectors for Drosophila P-element-mediated transformation and tissue culture transfection. Gene. 1988;74:445–456. doi: 10.1016/0378-1119(88)90177-1. [DOI] [PubMed] [Google Scholar]
  55. Van Maldergem L, Siitonen HA, Jalkh N, Chouery E, De Roy M, Delague V, Muenke M, Jabs EW, Cai J, Wang LL, Plon SE, Fourneau C, Kestila M, Gillerot Y, Megarbane A, Verloes A. Revisiting the craniosynostosis-radial ray hypoplasia association: Baller-Gerold syndrome caused by mutations in the RECQL4 gene. J Med Genet. 2006;43:148–152. doi: 10.1136/jmg.2005.031781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Vennos EM, James WD. Rothmund-Thomson syndrome. Dermatol Clin. 1995;13:143–150. [PubMed] [Google Scholar]
  57. Wang LL, Gannavarapu A, Kozinetz CA, Levy ML, Lewis RA, Chintagumpala MM, Ruiz-Maldanado R, Contreras-Ruiz J, Cunniff C, Erickson RP, Lev D, Rogers M, Zackai EH, Plon SE. Association between osteosarcoma and deleterious mutations in the RECQL4 gene in Rothmund-Thomson syndrome. J Natl Cancer Inst. 2003;95:669–674. doi: 10.1093/jnci/95.9.669. [DOI] [PubMed] [Google Scholar]
  58. Werner SR, Prahalad AK, Yang J, Hock JM. RECQL4-deficient cells are hypersensitive to oxidative stress/damage: Insights for osteosarcoma prevalence and heterogeneity in Rothmund-Thomson syndrome. Biochem Biophys Res Commun. 2006;345:403–409. doi: 10.1016/j.bbrc.2006.04.093. [DOI] [PubMed] [Google Scholar]
  59. Whittaker AJ, Royzman I, Orr-Weaver TL. Drosophila double parked: a conserved, essential replication protein that colocalizes with the origin recognition complex and links DNA replication with mitosis and the down-regulation of S phase transcripts. Genes Dev. 2000;14:1765–1776. [PMC free article] [PubMed] [Google Scholar]
  60. Wolff T, Ready DF. Pattern formation in the Drosophila retina. In: Bate M, Arias AM, editors. The Development of Drosophila melanogaster. Vol. II. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 1993. pp. 1277–1325. [Google Scholar]
  61. Wu J, Hou JH, Hsieh TS. A new Drosophila gene wh (wuho) with WD40 repeats is essential for spermatogenesis and has maximal expression in hub cells. Dev Biol. 2006;296:219–230. doi: 10.1016/j.ydbio.2006.04.459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Xu T, Rubin GM. Analysis of genetic mosaics in developing and adult Drosophila tissues. Development. 1993;117:1223–1237. doi: 10.1242/dev.117.4.1223. [DOI] [PubMed] [Google Scholar]
  63. Yin J, Kwon YT, Varshavsky A, Wang W. RECQL4, mutated in the Rothmund-Thomson and RAPADILINO syndromes, interacts with ubiquitin ligases UBR1 and UBR2 of the N-end rule pathway. Hum Mol Genet. 2004;13:2421–2430. doi: 10.1093/hmg/ddh269. [DOI] [PubMed] [Google Scholar]
  64. Zegerman P, Diffley JF. Phosphorylation of Sld2 and Sld3 by cyclin-dependent kinases promotes DNA replication in budding yeast. Nature. 2007;445:281–285. doi: 10.1038/nature05432. [DOI] [PubMed] [Google Scholar]
  65. Zhang CX, Lee MP, Chen AD, Brown SD, Hsieh T. Isolation and characterization of a Drosophila gene essential for early embryonic development and formation of cortical cleavage furrows. J Cell Biol. 1996;134:923–934. doi: 10.1083/jcb.134.4.923. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01. Supplementary Material.

Fig. S1. RecQ4-GFP was highly expressed in mitotically active brain optic lobes, neuroblasts, and imaginal discs. (A–C) The central nerve system (CNS) was dissected from third instar P{RecQ4-GFP} transgenic larvae, and stained with rabbit anti-GFP antibody and DAPI to visualize RecQ4-GFP (green) and DNA (blue), respectively. Optic lobe (ol), eye disc (ed) and leg disc (ld) are indicated. A neuroblast is indicated by an arrow. The brain portions outlined in (A–C) are shown with a higher magnification in (D–F) at a different focus, respectively. (G–I) RecQ4-GFP expression in the wing imaginal disc (anterior to the left). In the wing imaginal disc, at the dorsoventral boundary, the zone of non-proliferating cells (ZNC) is composed of three subdomains (Johnston and Edgar, 1998). Cells in the center of the anterior ZNC and posterior ZNC are arrested in G1 phase. Cells in the dorsal and ventral domains of the anterior ZNC are arrested in G2 phase. RecQ4-GFP has diminished expression in cells arrested in late G1 phase (arrow), but is completely absent in cells arrested in G2 phase (arrowheads). The disc was from wandering P{RecQ4-GFP} transgenic larvae. Scale bars, 50 µm.

NIHMS77203-supplement-01.tif (1.9MB, tif)

RESOURCES