Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2009 Jan 9;284(2):1097–1105. doi: 10.1074/jbc.M805905200

Control of TANK-binding Kinase 1-mediated Signaling by the γ134.5 Protein of Herpes Simplex Virus 1*

Dustin Verpooten 1,1, Yijie Ma 1,1, Songwang Hou 1, Zhipeng Yan 1, Bin He 1,2
PMCID: PMC2613634  PMID: 19010780

Abstract

TANK-binding kinase 1 (TBK1) is a key component of Toll-like receptor-dependent and -independent signaling pathways. In response to microbial components, TBK1 activates interferon regulatory factor 3 (IRF3) and cytokine expression. Here we show that TBK1 is a novel target of the γ134.5 protein, a virulence factor whose expression is regulated in a temporal fashion. Remarkably, the γ134.5 protein is required to inhibit IRF3 phosphorylation, nuclear translocation, and the induction of antiviral genes in infected cells. When expressed in mammalian cells, the γ134.5 protein forms complexes with TBK1 and disrupts the interaction of TBK1 and IRF3, which prevents the induction of interferon and interferon-stimulated gene promoters. Down-regulation of TBK1 requires the amino-terminal domain. In addition, unlike wild type virus, a herpes simplex virus mutant lacking γ134.5 replicates efficiently in TBK1-/- cells but not in TBK1+/+ cells. Addition of exogenous interferon restores the antiviral activity in both TBK1-/- and TBK+/+ cells. Hence, control of TBK1-mediated cell signaling by the γ134.5 protein contributes to herpes simplex virus infection. These results reveal that TBK1 plays a pivotal role in limiting replication of a DNA virus.


Herpes simplex virus 1 (HSV-1)3 is a large DNA virus that establishes latent or lytic infection, in which the virus triggers innate immune responses. In HSV-infected cells, a number of antiviral mechanisms operate in a cell type- and time-dependent manner (1). In response to double-stranded RNA (dsRNA), Toll-like receptor 3 (TLR3) recruits an adaptor TIR domain-containing adaptor inducing IFN-β and stimulates cytokine expression (2, 3). In the cytoplasm, RNA helicases, RIG-I (retinoid acid-inducible gene-I), and MDA5 (melanoma differentiation associated gene 5) recognize intracellular viral 5′-triphosphate RNA or dsRNA (2, 4). Furthermore, a DNA-dependent activator of IFN-regulatory factor (DAI) senses double-stranded DNA in the cytoplasm and induces cytokine expression (5). There is also evidence that viral entry induces antiviral programs independent of TLR and RIG-I pathways (6). While recognizing distinct viral components, these innate immune pathways relay signals to the two IKK-related kinases, TANK-binding kinase 1 (TBK1) and inducible IκB kinase (IKKi) (2).

The IKK-related kinases function as essential components that phosphorylate IRF3 (interferon regulatory factor 3), as well as the closely related IRF7, which translocates to the nucleus and induces antiviral genes, such as interferon-α/β and ISG56 (interferon-stimulated gene 56) (7, 8). TBK1 is constitutively expressed, whereas IKKi is engaged as an inducible gene product of innate immune signaling (9, 10). IRF3 activation is attenuated in TBK1-deficient but not in IKKi-deficient cells (11, 12). Its activation is completely abolished in double-deficient cells (12), suggesting a partially redundant function of TBK1 and IKKi. Indeed, IKKi also negatively regulates the STAT-signaling pathway (13). TBK1/IKKi interacts with several proteins, such as TRAF family member-associated NF-κB activator (TANK), NAP1 (NAK-associated protein 1), similar to NAP1TBK1 adaptor (SINTBAD), DNA-dependent activator of IFN-regulatory factors (DAI), and secretory protein 5 (Sec5) in host cells (5, 14–18). These interactions are thought to regulate TBK1/IKKi, which delineates innate as well as adaptive immune responses.

Upon viral infection, expression of HSV proteins interferes with the induction of antiviral immunity. When treated with UV or cycloheximide, HSV induces an array of antiviral genes in human lung fibroblasts (19, 20). Furthermore, an HSV mutant, with deletion in immediate early protein ICP0, induces ISG56 expression (21). Accordingly, expression of ICP0 inhibits the induction of antiviral programs mediated by IRF3 or IRF7 (21–23). However, although ICP0 negatively regulates IFN-β expression, it is not essential for this effect (24). In HSV-infected human macrophages or dendritic cells, an immediate early protein ICP27 is required to suppress cytokine induction involving IRF3 (25). In this context, it is notable that an HSV mutant, lacking a leaky late gene γ134.5, replicates efficiently in cells devoid of IFN-α/β genes (26). Additionally, the γ134.5 null mutant induces differential cytokine expression as compared with wild type virus (27). Thus, HSV modulation of cytokine expression is a complex process that involves multiple viral components. Currently, the molecular mechanism governing this event is unclear. In this study, we show that HSV γ134.5 targets TBK1 and inhibits antiviral signaling. The data herein reveal a previously unrecognized mechanism by which γ134.5 facilitates HSV replication.

EXPERIMENTAL PROCEDURES

Cells and Viruses—Vero, HEL, and 293T cells were from the American Type Culture Collection. TBK1+/+ and TBK1-/- MEF were gifts from Dr. Wen-Chen Yeh. Cells were propagated in Dulbecco's modified Eagle's medium supplemented with 5% (Vero and 293T) or 10% (MEF and HEL) fetal bovine serum. HSV-1(F) is a prototype HSV-1 strain used in this study (28). In recombinant virus R3616, a 1-kb fragment from the coding region of the γ134.5 gene was deleted (28). These viral strains were gifts from Dr. Bernard Roizman (University of Chicago).

Plasmids—Plasmids pcDNA3, pTK-Luc, and dN200 have been described elsewhere (29). The FLAG-γ134.5 plasmids, WT, Δ30, Δ72, Δ106, Δ146, and N159, were constructed by inserting PCR-amplified fragments into the BamHI and XhoI sites of pcDNA3. To construct GST-IRF3, a DNA fragment encoding amino acids 380–427 from IRF3 was ligated into the BamHI and EcoRI sites of pGEX4-T1. pISG56-Luc was a gift from Ganes Sen (Cleveland Clinical Research Foundation). Plasmids IFNB and FLAG-TBK1 were gifts from R. Lin, J. Hiscott (McGill University), and U. Siebenlist (National Institutes of Health). Plasmid GFP-IRF3 was a gift from Nancy Reich (State University of New York, Stony Brook). Plasmid HA-γ134.5 was a gift from Youjia Cao (Nankai University). To construct HA-TBK1, the TBK1 insert was PCR-amplified and cloned into the BamHI and XhoI sites of pcDNA3.

Viral Infections—Cells were infected with viruses at 0.05, 5, or 10 pfu per cell. At indicated time points, virus yields were determined on Vero cells (26). For interferon assays, cells were untreated or treated with mouse α-interferon (100 units/ml; Sigma) for 20 h. Cells were then infected with viruses. After adsorption for 2 h, the monolayers were overlaid with DMEM and incubated at 37 °C. At indicated time points post-infection, samples were harvested, and viruses were released by three cycles of freezing and thawing and then titrated on Vero cells. For radioisotope labeling, cells were labeled with [35S]methionine (50 μCi/ml; ICN) in DMEM lacking methionine but supplemented with 2% fetal bovine serum 1 h before harvest. At indicated time points, lysates of cell were subjected to electrophoresis and autoradiography (30).

RT-PCR and Reporter Assays—Cells were mock-infected or infected with viruses at 5 pfu per cell in serum-free DMEM. At 1 h after infection, cells were grown in DMEM with 1% fetal bovine serum. At the indicated time points, total RNA was harvested from cells using RNeasy kit (Qiagen). RT-PCR analysis was performed with one-step RT-PCR system according to the manufacturer's protocols (Invitrogen). Primers used were as follows: mouse ISG54, ATGAGTACAACGAGTAAG and CTAGTATTCAGCACCTGCTT; mouse ISG56, ATGGGAGAGAATGCTGATGG and TCAGAATGCAGGGTTCATTT; human ISG54, ATGAGTGAGAACAATAAGAA and TCATTCCCCATTCCAGCTTG; human ISG56, ATGAGTACAAATGGTGATGATCATCAG and ATTGCCTGCTTCTATATACATTCTTGC; and human or mouse 18 S rRNA, CGCAGCTAGGAATAATGGAA and TTATGACCGCACTTACTGG. Luciferase reporter assays were performed as described previously (29). Briefly, 293T cells grown on 12-well plates were transfected with a control plasmid or plasmid vector expressing TBK1 and γ134.5 variants, along with IFN-β or ISG56 reporter plasmid expressing firefly luciferase using Lipofectamine 2000 (Invitrogen). Total levels of transfected DNA were kept constant with empty vector plasmid. As a control for transfection efficiency, a plasmid containing the Renilla luciferase gene driven by the HSV-1 TK promoter was included. At 36 h after transfection, cells were harvested, and luciferase activities were measured using the dual luciferase assay system from Promega.

Immunoblotting and Immunoprecipitation Analyses—To analyze protein expression, cells were washed, harvested, and solubilized in disruption buffer containing 50 mm Tris-HCl (pH 7.0), 5% 2-mercaptoethanol, 2% SDS, and 2.75% sucrose. Samples were then sonicated, boiled, subjected to electrophoresis on denaturing 12% polyacrylamide gels, transferred to nitrocellulose membranes, blocked with 5% nonfat milk, and reacted with antibodies against eIF2α, phosphorylated eIF2α (Cell Signaling Technology, Inc.), β-actin (Sigma), HSV-1 (Dako Inc.), FLAG (Sigma), HA (Santa Cruz Biotechnology), IRF3 (Santa Cruz Biotechnology), phosphorylated IRF3 (Ser396) (Cell Signaling Technology, Inc.), and γ134.5. The membranes were rinsed in phosphate-buffered saline and reacted with donkey anti-rabbit immunoglobulin conjugated to horseradish peroxidase. Protein bands were detected by enhanced chemiluminescence (Amersham Biosciences). To examine protein interactions, 293T cells were transfected with the indicated amounts of pcDNA3, FLAG-TBK1, HA-γ13.45, FLAG-dN200, and IRF3. At 40 h after transfection, cells were harvested and lysed in 50 mm Tris-HCl (pH 7.4) buffer containing 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mm NaCl, 1 mm EDTA, 1 mm 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride, 1 μg/ml aprotinin/leupeptin/pepstatin,1 mm Na3VO4, 1 mm NaF. Lysates were incubated overnight at 4 °C with anti-FLAG M2 affinity gel (Sigma) or anti-HA antibody (Applied Biological Materials Inc.) plus protein A/G-agarose beads (Santa Cruz Biotechnology). Immunocomplexes captured on the affinity gel or protein A/G-agarose beads were subjected to electrophoresis and immunoblotting analysis (29).

Kinase Assays—Recombinant GST-IRF3 fusion protein was purified from bacterial lysates by affinity chromatography. 293T cells were transfected with pcDNA3, FLAG-TBK1, and HA-γ134.5. At 40 h after transfection, cell lysates were prepared in 20 mm Tris-HCl (pH 7.4) containing 137 mm NaCl, 10% glycerol, 1% Triton X-100, 2 mm EDTA, 50 mm sodium glycerophosphate, 20 mm sodium pyrophosphate, 5 μg/ml aprotinin, 5 μg/ml leupeptin, 1 mm Na3VO4, and 5 mm benzamidine. TBK1 was immunoprecipitated with anti-FLAG affinity gel (Sigma). Immunocomplexes were incubated with recombinant GST-IRF3-(380–427) for 20 min at 30 °C in 25 mm Hepes buffer (pH 7.5) containing 10 mm MgCl2, 25 mm sodium-β-glycerophosphate, 5 mm benzamidine, 1 mm Na3VO4, 0.5 mm dithiothreitol, and 100 μm ATP. Samples were subjected to electrophoresis and immunoblotting analysis with rabbit antiphospho-IRF3 (Ser396).

Fluorescence Microscopy—After transfection or infection, cells were washed with phosphate-buffered saline and fixed with ice-cold methanol and acetone for 5 min. Following this step, cells were washed with phosphate-buffered saline and stained with 4′,6-diamidino-2-phenylindole (1.5 μg/ml) in the VECTASHIELD mounting medium. Samples were visualized under a fluorescent microscope, and images were captured with Zeiss AxioCam MRm camera.

Cell Fractionation Assays—Infected or transfected cells were lysed in phosphate-buffered saline containing 0.4% Nonidet P-40 and protease inhibitor mixtures (Sigma) and kept on ice with gentle inversion. After centrifugation for 3 min, the nuclei were pelleted, and supernatants were transferred to a tube. The nuclei were resuspended in phosphate-buffered saline with 0.4% Nonidet P-40 and frozen at -80 °C for 30 min. The cytoplasmic and nuclear fractions were then solubilized in disruption buffer. Samples were subjected to electrophoresis and Western blot analysis with antibodies against IRF3 (Santa Cruz Biotechnology), GRP78 (glucose-regulated protein 78) (BD Transduction Laboratories), and histone H3 (Cell Signaling), respectively.

RESULTS

γ134.5 Null Mutant Activates Antiviral Immunity Early in HSV Infection—Although expressed as a leaky late gene, γ134.5 is also detectable early in infection (31, 32). To explore the biological function of γ134.5, we measured the induction of ISG54 and ISG56 early in HSV-infected cells. MEF were either mock-infected or infected with viruses, and mRNA levels were determined by RT-PCR. As illustrated in Fig. 1A, the induction of ISG54 as well as ISG56 was seen in cells infected with the γ134.5 null mutant R3616. The mRNA levels of ISG54 and ISG56 increased as virus infection progressed from 3 to 6 h. This stimulation was not observed in cells mock-infected or infected with wild type HSV-1(F), although comparable levels of 18 S RNA were noted in all cells. In correlation, wild type virus, but not the γ134.5 null mutant, expressed the γ134.5 protein at 3 and 6 h after infection (Fig. 1C). Similar results were obtained in human lung fibroblasts (HEL), although there was a delay in the kinetics of ISG54 and ISG56 induction by R3616 (Fig. 1B). Because the onset of viral DNA replication triggers the shutoff of protein synthesis mediated by dsRNA-dependent protein kinase PKR (30), we next asked whether the induction of ISG54 and ISG56 by R3616 was linked to this event. As measured by [35S]methionine labeling, at 3 or 6 h after infection, profiles of protein synthesis were similar in HEL cells infected with HSV-1(F) or R3616 (data not shown). Although eIF-2α was constitutively expressed at comparable levels, there was no detectable eIF-2α phosphorylation regardless of γ134.5 expression (Fig. 1C), suggesting that PKR is not activated early in HSV infection. These phenotypes were also seen in MEF cells. Hence, the expression of γ134.5 abrogated the induction of ISG54 and ISG56 by HSV, which was independent of eIF2α phosphorylation and the shut-off of protein synthesis.

FIGURE 1.

FIGURE 1.

HSV-1 γ134. 5 inhibits the induction of ISG54 and ISG56 in infected mouse embryonic fibroblasts (A) and human lung embryonic fibroblasts (B). Cells were mock-infected, HSV-1(F), or R3616-infected (5 pfu/cell). At 3 and 6 h after infection, total RNA extracted from cells was subjected to RT-PCR amplification and electrophoresis for ISG54, ISG56, and 18 S rRNA. C, expression of phosphorylated eIF2α, eIF2α, γ134.5, and β-actin. Human lung embryonic fibroblasts were mock-infected or infected with viruses (5 pfu/cell). At indicated time points, samples were subjected to electrophoresis and Western blot analysis with antibodies against phosphorylated eIF2α, eIF2α, γ134.5, and β-actin, respectively.

Previous work has demonstrated that IRF3 activation stimulates ISG56 expression in HSV-infected cells (33). We further evaluated phosphorylation of endogenous IRF3 in infected cells. As revealed by immunoblotting analysis (Fig. 2A), IRF3 was constitutively expressed in HEL cells. Unlike HSV-1(F), R3616 infection resulted in an appearance of the IRF3 phosphoserine 396 isoform at 3 h after infection (Fig. 2A, lane 3). This response became evident at 6 h after infection (Fig. 2A, lane 6). To monitor the cellular localization of IRF3, 293T cells expressing a GFP-IRF3 fusion protein were infected with viruses (Fig. 2, B and C). GFP-IRF3 predominantly localized to the cytoplasm in cells mock-infected or infected with HSV-1(F). However, as viral infection proceeded, a significant portion of IRF3 was redistributed to the nucleus in cells infected with R3616 at 6 h after infection. These phenotypes were also seen in cell fractionation analysis. As shown in Fig. 2D, GFP-IRF3 was present in the cytoplasmic fraction of mock-infected or virus infected cells. However, little GFP-IRF3 was seen in the nuclear fraction of mock-infected cells. In virus-infected cells, R3616 stimulated more nuclear translocation of GFP-IRF3 than HSV-1(F). As expected, control proteins GRP78 and histone H3 were detected in the cytoplasmic and nuclear fractions, respectively. Together, these results indicate that early expression of γ134.5 is required to suppress phosphorylation and nuclear translocation of IRF3 in HSV infection.

FIGURE 2.

FIGURE 2.

A, γ134.5 protein inhibits phosphorylation of endogenous IRF3 in infected cells. Lysates of HEL cells mock-infected or infected with viruses (5 pfu/cell), as described in Fig. 1C, were subjected to immunoblotting analysis with antibodies against IRF3 and phosphorylated IRF3(Ser396), respectively. B, γ134.5 protein blocks nuclear translocation of IRF3 in infected cells. 293T cells were transfected with GFP-IRF3. At 24 h after transfection, cells were mock-infected, infected with either HSV-1(F) or R3616. At indicated time points, distribution of GFP-IRF3 was visualized under a fluorescence microscope. C, quantitation of IRF3 nuclear translocation. A total of 600 GFP-IRF3-positive cells from different fields in B were counted. Results are expressed as means ± S.D. from three independent experiments. D, cell fractionation. Cells were treated as in B, and the cytoplasmic and nuclear fractions were prepared as described under “Experimental Procedures.” Samples were subjected to Western blot analysis with antibodies against IRF3 (Santa Cruz Biotechnology), GRP78 (BD Transduction Laboratories), and histone H3 (Cell Signaling), respectively. The protein bands were quantified using NIH Image J software. The ratio represents the relative amount of GFP-IRF3 in the nuclear and cytoplasmic fractions normalized to histone H3 or GRP78, with the mock group arbitrarily set to 1.0. GFP, green fluorescent protein; DAPI, 4′,6-diamidino-2-phenylindole.

γ134.5 Null Mutant Replicates More Efficiently in TBK1-/- Cells than in TBK1+/+ Cells—Although HSV induction of antiviral responses involves different components, this process requires TBK1 (6). We hypothesized whether there is a possible link between γ134.5 and the TBK1 pathway. To test this, we investigated viral growth properties in TBK1+/+ and TBK1-/- MEF cells. Specifically, cells were infected with either HSV-1(F) or R3616. At 24 h post-infection, virus yields were determined. As shown in Fig. 3A, HSV-1(F) replicated efficiently in both TBK1+/+ and TBK1-/- cells, reaching titers of 4.6 × 106 and 1 × 106 pfu/ml, respectively. In striking contrast, R3616 replicated poorly in TBK1+/+ cells, with a virus yield less than 10 pfu/ml. There was approximately 105-fold decrease in viral growth as compared with HSV-1(F). This reduction was attributable to the lack of γ134.5 in R3616. Strikingly, R3616 replicated more efficiently in TBK1-/- cells, with a titer reaching 6.6 × 103 pfu/ml. There was approximately103-fold restoration in viral yield. This increase was partial but significant when compared with the replication seen in TBK1+/+ cells. These phenotypes were mirrored by cytopathic effects after viral infection. As illustrated in Fig. 3E, mock-infected cells formed a monolayer, with most cells displaying spindle morphology. HSV-1(F) induced morphological changes in both TBK1+/+ and TBK1-/- cells, where cells formed clumps, indicative of viral replication. In contrast, R3616 induced cytopathic effects only in TBK1-/- cells. Immunoblot analysis revealed that HSV-1(F) produced high levels of viral polypeptides in both TBK1+/+ and TBK1-/- cells, whereas R3616 produced a substantial amount of viral polypeptides only in TBK1-/- cells (Fig. 3B). Collectively, these results show that HSV infection invokes host responses via TBK1 which restricts viral replication in the absence of a γ134.5 blockade.

FIGURE 3.

FIGURE 3.

Viral replication in TBK1+/+ or TBK1-/- cells. A, cells were infected with HSV-1(F) or R3616 (0.05 pfu/cell). At 24 h after infection, virus yields were titrated on Vero cells. Data are an average of three independent experiments with standard deviations. B, synthesis of viral proteins in TBK1+/+ or TBK1-/- cells. Cells were either mock-infected or infected with the indicated viruses (5 pfu/cell). At 18 h after infection, lysates of cells were subjected to electrophoresis and reacted with polyclonal antibodies against HSV-1 antigens. C, viral responses to interferon in TBK1+/+ cells. Cells were left untreated or treated with IFN-α (100 units/ml; Sigma) for 20 h. Cells were then infected with HSV-1(F) or R3616 (0.05 pfu/cell). At 24 h after infection, virus yields were determined on Vero cells. Data are average of two independent experiments with standard deviations. D, viral responses to interferon in TBK1-/- cells. Assay conditions are same as in C. E, cytopathic effects in TBK1+/+ and TBK1-/- cells. Viral infections were carried out as in A, and images were taken under the microscope.

To examine whether interferon was able to restore the antiviral activity in the absence of TBK1, we assessed viral responses to IFN-α. As indicated in Fig. 3, C and D, HSV-1(F) replicated well in both TBK1+/+ and TBK1-/- cells, with titers ranging from 3.2 × 106 to 3.9 × 106 pfu/ml at 24 h after infection. Treatment with IFN-α had a marginal effect on viral replication. As expected, R3616 replicated more efficiently in untreated TBK1-/- than in TBK1+/+ cells, with a titer of 2.8 × 103 pfu/ml. When cells were treated with IFN-α, R3616 barely replicated, with minimal infectious virus produced. Thus, addition of IFN-α in TBK1-/- cells restored the antiviral activity to R3616. The growth pattern of R3616 resembled that seen in TBK1+/+ cells. Thus, TBK1-induced downstream antiviral molecules likely contribute to the inhibitory effect on viral replication.

γ134.5 Protein Associates with TBK1 and Inhibits Activation of IFN-β and ISG56 Promoters—The functional link between TBK1 and γ134.5 raised a possibility that γ134.5 may interact with TBK1 and suppress its activity. To test this hypothesis, we carried out coimmunoprecipitation experiments in 293T cells transfected with a vector, HA-γ134.5, FLAG-TBK1, and FLAG-dN200, a truncated form of Ebola VP35. As shown in Fig. 4A, the γ134.5 protein was coimmunoprecipitated with TBK1 but not with the control protein dN200. Levels of protein expression were comparable in lysates of transfected cells. These data indicate that the γ134.5 protein specifically associates with TBK1. As TBK1 activates the expression of ISG56 and IFN-β, we also performed luciferase reporter assays in 293T cells. As indicated in Fig. 4B, the expression of TBK1 activated the IFN-β promoter by ∼90-fold. However, coexpression of γ134.5 inhibited this induction in a dose-dependent manner. Likewise, the γ134.5 protein suppressed the induction of the ISG56 promoter by TBK1 (Fig. 4C). We conclude that in the absence of any other HSV proteins, the γ134.5 protein associates with TBK1 and prevents the activation of ISG56 and IFN-β promoters.

FIGURE 4.

FIGURE 4.

A, γ134.5 protein associates with TBK1. 293T cells were cotransfected with HA-γ134.5 along with an empty vector, FLAG-TBK1, or FLAG-dN200 (a truncated form of Ebola VP35). At 40 h after transfection, lysates of cells were immunoprecipitated (IP) with anti-FLAG antibody. Samples from both cell lysates and immunoprecipitates were processed for Western blot (WB) analysis with antibodies against FLAG or HA, and β-actin, respectively. B and C, γ134.5 protein inhibits the activation of IFN-β and ISG56 promoters. 293T cells were transfected with an empty vector or plasmids expressing FLAG-TBK1 and FLAG-γ134.5 along with an IFN-β or ISG56 reporter gene expressing firefly luciferase using Lipofectamine 2000 (Invitrogen). A plasmid containing the Renilla luciferase gene driven by the HSV-1 TK promoter was included for normalization. At 36 h post-transfection, cells were harvested for luciferase assays. Results are expressed as fold of activation with standard deviations among triplicate samples.

γ134.5 Protein Is Sufficient to Block Phosphorylation and Nuclear Translocation of IRF3—When bound to IRF3, TBK1 phosphorylates the carboxyl terminus of IRF3, which permits nuclear translocation and activation of IRF3 (7, 34). To gain insight into γ134.5 function, we examined whether the γ134.5 protein directly disrupted this process. Lysates of 293T cells transfected with FLAG-TBK1 and HA-γ134.5 were immunoprecipitated with anti-FLAG antibody. Immunocomplexes were subjected to in vitro kinase assays with recombinant GST-IRF3 (Fig. 5A). It is notable that there were some variations in TBK1 expression. Nonetheless, as the expression of γ134.5 was elevated, IRF3 phosphorylation was reduced, indicating that the γ134.5 protein inhibits IRF3 activation. A simple explanation for the inhibitory effect of the γ134.5 protein is that it sequesters TBK1 in an inactive complex and blocks the access of IRF3. To test this idea, we analyzed the TBK1 complex by immunoprecipitation. 293T cells were transfected with FLAG-TBK1, IRF3, and HA-γ134.5. Protein expression was detected in cell lysates (Fig. 5B, upper panels). In parallel, the TBK1 complex was immunoprecipitated with anti-FLAG antibody and subsequently analyzed for the presence of TBK1, γ134.5, and IRF3 (Fig. 5B, lower panels). Although TBK1 remained at similar levels in immunoprecipitates, IRF3 and γ134.5 displayed different patterns. In the absence of γ134.5, IRF3 associated with TBK1 (Fig. 5B, lane 3). As the level of γ134.5 increased, the amount of IRF3 associated with TBK1 diminished (Fig. 5B, lanes 4–7). Thus, expression of the γ134.5 protein displaced IRF3 in the TBK1 complex. To determine whether γ134.5 blocked nuclear translocation of IRF3 stimulated by TBK1, a cellular localization experiment was performed in 293T cells expressing GFP-IRF3 or in combination with TBK1 and γ134.5 (Fig. 5C). When expressed alone, IRF3 remained in the cytoplasm. Addition of TBK1 induced IRF3 redistribution to the nucleus in ∼30% of GFP-IRF3-positive cells. This response was suppressed to less than 10% upon expression of the γ134.5 protein as illustrated among cells from different fields (Fig. 5D). Further analysis by cell fractionation revealed similar phenotypes. As illustrated in Fig. 5E, TBK1 strongly stimulated nuclear translocation of GFP-IRF3. However, addition of γ134.5 drastically reduced nuclear accumulation of GFP-IRF3. Control proteins GRP78 and histone H3 remained in the cytoplasmic and nuclear fractions, respectively. These results suggest that the γ134.5 protein blocks IRF3 phosphorylation and nuclear translocation.

FIGURE 5.

FIGURE 5.

A, γ134.5 protein inhibits phosphorylation of IRF3 by TBK1. 293T cells were transfected with FLAG-TBK1 and increasing amounts of HA-γ134.5. At 40 h after transfection, aliquots of cell lysates were processed for protein expression with antibodies against FLAG and HA. In parallel, lysates were immunoprecipitated (IP) with anti-FLAG antibody. The immunoprecipitates were incubated with GST-IRF3 (amino acids 380–427) and ATP for kinase assays. Samples were subjected to electrophoresis and probed with antibodies against phosphorylated IRF3, FLAG, and HA, respectively. B, γ134.5 protein disrupts the interaction of TBK1 and IRF3. FLAG-TBK1, HA-γ134.5, and IRF3 were transfected into 293T cells, and immunoprecipitation was carried out with anti-FLAG antibody as in A. Proteins in both lysates and precipitates were then analyzed by immunoblotting with anti-FLAG, anti-IRF3, and anti-HA antibodies, respectively. C, γ134.5 protein blocks nuclear translocation of IRF3. 293T cells were cotransfected with GFP-IRF3, FLAG-TBK1, HA-γ134.5, and an empty vector. At 36 h after transfection, cells were visualized for GFP-IRF3 localization under a fluorescence microscope. GFP, green fluorescent protein; DAPI,4′,6-diamidino-2-phenylindole. D, quantitation of IRF3 nuclear translocation. A total of 600 GFP-IRF3 positive cells from different fields in C were counted. Results are expressed as means ± S.D. from three independent experiments. E, cell fractionation. Cells were treated as in C, and the cytoplasmic and nuclear fractions were prepared as described under “Experimental Procedures.” Samples were subjected to Western blot (WB) analysis with antibodies against IRF3 (Santa Cruz Biotechnology), GRP78 (BD Transduction Laboratories), and histone H3 (Cell Signaling), respectively. The protein bands were quantified using NIH ImageJ software. The ratio represents the relative amount of GFP-IRF3 in the nuclear and cytoplasmic fractions normalized to histone H3 or GRP78, with the GFP-IRF3 group arbitrarily set to 1.0.

Deletions in the Amino Terminus of γ134.5 Disrupt Its Activity on TBK1—The γ134.5 protein consists of 263 amino acids, with a large amino-terminal domain, a linker of triplet repeats, and a carboxyl-terminal domain (35). To map the functional domain, we constructed a series of γ134.5 variants with deletions in either the amino terminus or the carboxyl terminus (Fig. 6A). N159 has a deletion in the region spanning amino acids 159–263, whereas Δ30, Δ72, Δ106, and Δ146 have deletions in regions encompassing amino acids 1–30, 30–72, 72–106, and 106–146, respectively. We first evaluated these mutants in reporter assays with an IFN-β promoter construct (Fig. 6B). Like wild type γ134.5, N159 suppressed the induction of IFN-β by TBK1 efficiently, indicating that deletion of the carboxyl-terminal domain has no effect. Similarly, Δ30, Δ72, and Δ146 inhibited the IFN-β promoter activity to different degrees. Hence, deletions from amino acids 1 to 72 or from 106 to 146 had little effect on the γ134.5 activity. In contrast, Δ106 failed to inhibit TBK1 effectively (Fig. 6B). Therefore, deletion of amino acids 72–106 in γ134.5 substantially relieved its inhibitory effect. We next assessed the ability of γ134.5 to bind TBK1 by immunoprecipitation. As illustrated in Fig. 6C, all γ134.5 variants, except Δ106, coprecipitated with TBK1. These activities paralleled the phenotypes seen in reporter assays. These results indicate that the region spanning amino acids 72–106 in the γ134.5 protein is indispensable to inhibit TBK1.

FIGURE 6.

FIGURE 6.

A, schematic diagram of γ134.5 variants. B, effect of γ134.5 variants on the IFN-β promoter activity. 293T cells were cotransfected with an empty vector, FLAG-TBK1 (50 ng), FLAG-γ134.5 variants (900 ng), and an IFN-β luciferase reporter. A plasmid containing the Renilla luciferase gene driven by the HSV-1 TK promoter was included for normalization. At 36 h post-transfection, the cells were harvested, and luciferase activities were assayed. Results are expressed as fold of activation with standard deviations among triplicate samples. C, interaction of γ134.5 variants with TBK1. 293T cells were cotransfected with HA-TBK1 and FLAG-γ134.5 variants. At 40 h after transfection, lysates were immunoprecipitated (IP) with anti-HA antibody. Proteins in the lysates and precipitates were analyzed by immunoblotting with anti-HA and anti-FLAG antibodies, respectively. WB, Western blot.

DISCUSSION

Here we provide evidence that the γ134.5 protein inhibits the induction of antiviral signaling exerted by TBK1. Relevant to this is the finding that γ134.5 is essential to promote viral virulence (28). In infected cells, the γ134.5 protein prevents translational arrest mediated by the double-stranded PKR (36). In doing so, it forms a high molecular complex with protein phosphatase 1 that dephosphorylates eIF2α (36), which contributes to HSV replication in vivo (37). This model is generally used to explain the role of γ134.5 in HSV infection. Paradoxically, a γ134.5 null mutant with secondary-site mutations in the viral genome inhibits PKR activity but remains attenuated (38), suggesting that elements in addition to inhibition of translation shutoff contribute to viral virulence. In support of this notion, we found that TBK1 is a novel target of HSV γ134.5, which blocked IRF3 activation and the induction of antiviral genes early in HSV infection. This activity was independent of eIF-2α phosphorylation and the shutoff of protein synthesis. Indeed, the γ134.5 protein associated with TBK1 suppressed the expression of antiviral genes. Notably, unlike wild type virus, the γ134.5 null mutant replicated more efficiently in TBK1-/- cells than in TBK1+/+ cells. Therefore, in addition to the PKR pathway, γ134.5 interrupts the TBK1 pathway. These results may partly explain why inhibition of PKR alone does not restore HSV replication.

The requirement of γ134.5 underscores the vital role of TBK1 against HSV infection, which suggests that TBK1 contributes to the evolutionary maintenance of γ134.5 in HSV. TBK1 is at the center of TLR-dependent and -independent pathways (2). It is engaged with multiple sentinel proteins, which include NAP1, TANK, SINTBAD, DAI, and Sec5 (5, 15–18). NAP1, TANK, SINTBAD, and Sec5 activate TBK1 in response to RNA from the cytoplasmic or TLR3 pathways, whereas DAI stimulates TBK1 through double-stranded DNA in the cytoplasm. Nonetheless, TBK1 binds to and phosphorylates IRF3 (7, 34), which stimulates a spectrum of antiviral genes. Because the γ134.5 protein associates with and suppresses the TBK1 activity, it is reasonable to propose that this viral protein interferes with cell signaling initiated from TLR3, TLR4, RIG-I/MDA5, or DAI pathways during HSV infection. In this context, it is notable that individuals with TLR3 deficiency are more susceptible to herpes simplex virus 1 encephalitis (3), suggesting a link between HSV and the TLR3 pathway.

The interaction of γ134.5 and TBK1 suggests two nonmutually exclusive models. One possibility is that the γ134.5 protein may disrupt interactions of TBK1 with one or more of the TBK1 adaptors and block upstream signaling. Another possibility is that the γ134.5 protein may prevent the access of a downstream target to the TBK1 complex. Consequently, the γ134.5 protein inhibits TBK1-mediated innate immunity. We noted that IRF3 was dislodged from TBK1 as the level of γ134.5 increased in TBK1 immunoprecipitates. Additionally, the γ134.5 protein blocked nuclear translocation of IRF3. These experimental data argue γ134.5 acts as a competitor of IRF3 for TBK1 binding. TBK1 bears a ubiquitin-like domain that regulates the kinase activity (39). When this domain is in close proximity with the kinase domain, TBK1 is in an active state and interacts with IRF3. Hence, binding of the γ134.5 protein likely disrupted this active conformation. Recent studies demonstrate that TBK1 binds to and phosphorylates DEAD box protein 3 (40, 41). Although the underlying mechanism remains unknown, this protein activates the IFN-β promoter upon translocation into the nucleus. These observations suggest that activation of antiviral responses by TBK1 relies on the cooperation of IRF3 and DEAD box protein 3. It is possible that γ134.5 may also interfere with the activity of DEAD box protein 3.

Previous studies indicated that the carboxyl-terminal domain of γ134.5 binds to protein phosphatase 1 and mediates eIF-2α dephosphorylation (42). This raises the possibility that the γ134.5-PP1 complex may regulate the TBK1 activity. However, the data present in this study do not support this contention because the amino-terminal domain is sufficient to exert its inhibitory effect on TBK1. We noted that deletion in the region spanning amino acids 70–106 impaired the ability of γ134.5 to bind and inhibit TBK1, which suggests that this region may represent a functional element. The crystal structure of γ134.5 has not been resolved. This region, conserved in γ134.5 from both HSV-1 and HSV-2, is predicted to form an α-helix followed by a flexible region. It is noteworthy that a cluster of conserved residues centers on this region, with a stretch of leucines and aspartic acids. We speculate that these conserved amino acids are required for protein-protein interactions. Alternatively, they may serve as structural elements. Because deletions in other regions had minimum effects, this latter possibility is less likely. Work is in progress to understand the molecular basis of the γ134.5-TBK1 interaction. Nevertheless, our results demonstrate that the γ134.5 protein employs different domains to modulate PKR and TBK1 activities.

The γ134.5 protein is essential in the pathogenesis of HSV infection (28). Early studies show that γ134.5 is a leaky late gene (31). Its expression is low in early infection (2–4 h) but increases and reaches a plateau later in infection (8–24 h) (32). However, the biological basis for such kinetics has remained obscure. In infected cells, HSV DNA replication triggers the shutoff of protein synthesis mediated by PKR, which occurs around 9 h after infection (30). At this stage, the expression of γ134.5 acts to prevent the PKR response. It has been reported that during HSV infection the γ134.5 protein facilitates viral egress (43, 44). Furthermore, the γ134.5 protein interacts with proliferation of cell nuclear antigen, a nuclear protein involved in DNA replication and cell cycle regulation (45). This interaction is postulated to promote viral DNA replication (45). In addition, the γ134.5 protein inhibits autophagy (46). It also blocks the surface expression of major histocompatibility complex class II molecules in HSV-infected cells, which is thought to inhibit the functions of CD4+ T cells (47). Intriguingly, the γ134.5 protein shuttles dynamically between the nucleus and cytoplasm (48, 49), which is likely required to perform these different functions. Given these observations, it is possible that the γ134.5 protein functions differentially in a temporal fashion during HSV infection. In this respect, this study provided the mechanistic explanation for the early expression of γ134.5. Notably, the γ134.5 protein suppressed the induction of ISG54 and ISG56 at 3 h after infection. Consistently, the γ134.5 protein inhibited IRF3 phosphorylation and nuclear translocation mediated by TBK1. Therefore, at the early stages of HSV infection, it acts to inhibit or alleviate the induction of antiviral immunity. This idea is in line with the observation that a γ134.5 null mutant induced differential gene expression as compared with wild type HSV-1 (27). These results lend support to the hypothesis that inhibition of the induction of antiviral immunity by the γ134.5 protein contributes to the pathogenesis of HSV infection.

HSV-1 is a large DNA virus that interacts with innate immune systems in a complex way. In addition to γ134.5, Us11 inhibits PKR activation by its RNA binding domain (50). This viral protein further inhibits 2′,5′-oligoadenylate synthetase, a cellular protein critical for the antiviral action of interferon (51). Moreover, an immediate early protein ICP0 confers viral resistance to IFN by disseminating promyelocytic leukemia protein (52, 53). Notably, ICP0 also inhibits the induction of IFN-responsive genes, where it sequesters or promotes partial IRF3 degradation (21–23). Recent studies show that another immediate early protein ICP27 is required to suppress cytokine induction mediated by IRF3 in macrophage dendritic cells and embryonic fibroblasts (1, 25). This effect is speculated to result from the regulation of mRNA processing or transport by ICP27 (25). Notably, ICP27 also blocks type I IFN signaling by down-regulating STAT-1 phosphorylation (54). Our observations with γ134.5 indicate that it is essential to suppress the induction of IFN-responsive genes mediated by TBK1. These activities are likely to create a favorable environment for HSV infection. Thus, a question arises as to why HSV employs more than one viral protein to inhibit the induction of antiviral genes. Because HSV replication is regulated in a cascade fashion (55), it is possible that the coordinated action of ICP0, ICP27, and γ134.5 is required to efficiently thwart host defenses. Alternatively, one or more of these viral proteins may function differentially in different cells or tissues in vivo. In this regard, it is interesting that HSV induces innate immune responses in a cell type- and time-dependent manner (1). The molecular interplay between the immune systems and ICP0, ICP27, and γ134.5 awaits further investigation. Nonetheless, our work suggests that the interaction of the γ134.5 protein and TBK1 is a critical determinant of viral replication.

Acknowledgments

We thank Bernard Roizman, Wen-Chen Yeh, Ganes Sen, Rongtuan Lin, John Hiscott, Ulrich Siebenlist, Youjia Cao, Michael David, and Nancy Reich for providing valuable reagents. We also thank Zongdi Feng for helpful discussion and suggestions.

*

This work was supported, in whole or in part, by National Institutes of Health Grant AI46665 (NIAID) (to B. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Footnotes

3

The abbreviations used are: HSV-1, herpes simplex virus 1; dsRNA, double-stranded RNA; TLR, Toll-like receptor; IFN, interferon; RIG-I, retinoid acid-inducible gene-I; TBK1, TANK-binding kinase 1; IKKi, inducible IκB kinase; IRF, interferon regulatory factor; ISG, interferon stimulated gene; SINTBAD, NAP1TBK1 adaptor; DAI, DNA-dependent activator of IFN-regulatory factors; eIF2α, the α subunit of translation initiation factor 2; PKR, dsRNA-dependent protein kinase; RT, reverse transcription; DMEM, Dulbecco's modified Eagle's medium; pfu, plaque-forming unit; MEF, mouse embryonic fibroblast; HA, hemagglutinin.

References


Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES