Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Nov 13.
Published in final edited form as: Brain Res. 2008 Sep 10;1240:165–176. doi: 10.1016/j.brainres.2008.08.084

Impaired expression and function of group II metabotropic glutamate receptors in pilocarpine-treated chronically epileptic rats

Emilio R Garrido-Sanabria 1,2,*, Luis F Pacheco Otalora 1, Massoud F Arshadmansab 1, Berenice Herrera, Sebastian Francisco, Boris Ermolinsky 1
PMCID: PMC2644640  NIHMSID: NIHMS79821  PMID: 18804094

Abstract

Group II metabotropic (mGlu II) receptor subtypes mGlu2 and mGlu3 are important modulators of synaptic plasticity and glutamate release in the brain. Accordingly, several pharmacological ligands have been designed to target these receptors for the treatment of neurological disorders characterized by anomalous glutamate regulation including epilepsy. In this study, we examine whether the expression level and function of mGlu2 and mGlu3 are altered in experimental epilepsy by using immunohistochemistry, Western blot analysis, RT-PCR and extracellular recordings. A down-regulation of mGlu2/3 protein expression at the mossy fiber pathway was associated with a significant reduction in mGlu2/3 protein expression in the hippocampus and cortex of chronically epileptic rats. Moreover, a reduction in mGlu2 and mGlu3 transcripts levels was noticed as early as 24h after pilocarpine-induced status epilepticus (SE) and persisted during subsequent “latent” and chronic periods. In addition, a significant impairment of mGlu II-mediated depression of field excitatory postsynaptic potentials at mossy fiber-CA3 synapses was detected in chronically epileptic rats. Application of mGlu II agonists (2S,2'R,3'R)-2-(2',3'-dicarboxycyclopropyl)glycine (DCG-IV) induced a significant reduction of the fEPSP amplitude in control rats, but not in chronic epileptic rats. These data indicate a long-lasting impairment of mGlu2/3 expression that may contribute to abnormal presynaptic plasticity, exaggerate glutamate release and hyperexcitability in temporal lobe epilepsy.

Classification terms: THEME J: DISORDERS OF THE NERVOUS SYSTEM: Epilepsy: basic mechanisms, Epilepsy: human studies and animal models

Keywords: metabotropic glutamate receptors, mGlu2, mGlu3, pilocarpine, epilepsy, presynaptic, granule cells, long-term depression

1. Introduction

Mesial temporal lobe epilepsy (MTLE) is characterized by spontaneous and recurrent seizures as a result of chronic hyperexcitability of neuronal networks (Cavalheiro et al.,1991; Cavalheiro et al., 1992; Heinemann, 2004). It has been demonstrated that glutamate release is enhanced during seizures leading to an over-stimulation of glutamate receptors that results in excitotoxicity and neuronal death (Costa et al., 2004; Thomas, 1995). Therefore, abnormalities in the endogenous mechanisms regulating presynaptic glutamate release may play a major role in the pathogenesis of epilepsy (Costa et al., 2004; Malva et al., 2003; Pacheco Otalora et al., 2006).

In control hippocampus, presynaptic group II metabotropic (mGlu II) receptors, especially the subtype 2 (mGlu2) are located at presynaptic sites. During episodes of enhanced glutamate release, activation of mGlu II autoreceptors mediates a “feedback inhibition” of glutamate exocytosis (Scanziani et al., 1997a). Such depression of synaptic transmission has been considered a form of “protective neuroplasticity” (Alexander and Godwin, 2006). In some areas, prolonged low-frequency electrical stimulation may lead to a long-lasting reduction in synaptic strength also known as homosynaptic long-term depression (LTD) (for review, see (Bear and Abraham, 1996)). Compelling evidences indicate that LTD is generated via complex mechanisms involving presynaptic and/or postsynaptic changes in second messenger systems (Manabe, 1997). For instances, at mossy fiber-CA3 synapses LTD is associated with presynaptic decrease in cyclic AMP (Huang et al., 1994). Accordingly, several studies have described a chemical form (stimulus independent) of LTD induced by manipulations of the cAMP and cGMP second messenger systems (Bailey et al., 2003; Kameyama et al., 1998; Santschi et al., 1999; Santschi and Stanton, 2003; Stanton et al., 2001). Group II mGlus are located both presynaptically and postsynaptically, and their involvement in the induction of LTD has been described at the hippocampal mossy fiber-CA3 (Domenici et al., 1998; Santschi et al., 1999; Stanton et al., 2001; Tzounopoulos et al., 1998; Yokoi et al., 1996). Similar findings have been reported in other brain areas. For instances, in basolateral amygdala, activation of mGlu II by (2S,3S,4S)-2-(carboxycyclopropyl) glycine (L-CCG) induces an chemical LTD . L-CCG LTD is induced by presynaptically mGlu II-mediated inhibition of Ca2+-sensitive adenylyl cyclase, resulting in a decrease in cAMP formation and PKA activation, which leads to a long-lasting decrease in transmitter release (Lin et al., 2000).

Furthermore, mGlu II-mediated autoregulation of glutamate release has been proposed to act as an endogenous antiepileptic mechanism that can be targeted for the development of anticonvulsant and antiepileptic drugs (Malva et al., 2003; Marek, 2004). For instances, low doses of (2S.3S.4S)alpha-(carboxycyclopropyl)glycine L-CCG-I,mGlu2/3 agonist, protect against (RS)3.5-dihydroxyphenylglycine (3,5-DHPG)-induced convulsions (Tizzano et al., 1995). Furthermore, selective mGlu II receptor agonists 1S,3R-ACPD and DCG-IV have been shown to inhibit amydala-kindled seizures (Attwell et al., 1995; Attwell et al., 1998). Overall, mGlu II receptors, specifically mGlu2, are considered a strategic target for the treatment of both convulsive and non-convulsive seizures (Alexander and Godwin, 2006; Marek, 2004). However, this notion may not be valid if mGlu II autoreceptors expression and function are disrupted during epileptogenesis.

Compelling evidences indicate a long-lasting impairment of mGlu II receptors in epilepsy. For instances, a progressive down-regulation of mGlu II receptors has been described in the mossy fibers and perforant path projection areas in experimental and in human MTLE (Pacheco Otalora et al., 2006; Tang et al., 2004). We hypothesize that presynaptic release machinery in the “epileptic brain” is under a defective control by reduced mGlu II expression, which may provoke abnormal axonal and presynaptic hyperexcitability leading to recurrent seizures. Previous in situ hybridization study revealed a selective reduction of mGlu2 mRNA in granule cells of the dentate gyrus at 24 h following kainic acid-induced status epilepticus (SE) in both pup and adult rats (Aronica et al., 1997). However, it is unclear whether similar deficit in the expression mGlu II receptor transcripts persists during different phases of chronic epileptogenesis. Here, we quantitate the seizure-induced changes in the expression level of mGlu2 and mGlu3 transcripts by using quantitative real-time PCR (qrtPCR) assays in total RNA isolated from microdissected dentate gyrus in the pilocarpine model of temporal lobe epilepsy. In addition, by using extracellular recordings in hippocampal slices we assessed whether mGlu II receptors mediated depression of excitatory synaptic transmission at mossy fiber-CA3 synapses was affected in pilocarpine-treated chronically epileptic rats. Our data indicate a persistent and selective down-regulation of mGlu2 transcripts at different stages following pilocarpine-induced SE. A reduction in mGlu2 transcripts and protein expression is associated with a dramatic disruption of mGlu II receptors-mediated suppression of evoked responses at mossy fiber synapses. These abnormalities may underlie uncontrolled glutamate release, hippocampal excitability and neurodegeneration in MTLE. Furthermore, pervasive unavailability of molecular targets may render mGlu II agonists inefficient for the treatment of epilepsy.

2. Results

2.1. Pattern of mGlu2/3 immunoreactivity is disrupted in epileptic rats

A group of chronically epileptic rats experiencing recurrent spontaneous seizures (~three video-confirmed seizures per week) was selected for immunohistochemistry. These epileptic rats were sacrificed at 45–75 days following SE and the brains were processed in parallel with age-matched controls. Immunohistochemistry was performed with a polyclonal antibody that detect both mGlu2 and mGlu3 subtypes (mGlu2/3). It is considered that immunoreactivity for mGlu2/3 represent a mixed pattern of both receptors. In control brains, intense mGlu2/3 immunoreactivity was detected in the hilus of dentate gyrus (Fig. 1A, arrow 1) and in the stratum lucidum of CA3 area (Fig. 1A, arrow 2 and Fig. 1B, higher magnification) consistent with strong expression in the mossy fibers of granule cells. In addition, diffuse immunostaining was observed in the middle molecular layer of the dentate gyrus (Fig. 1A, arrow 3). Moreover, intense mGlu2/3 immunereactive band was also found in the area corresponding to the stratum lacunosum/molecular (Fig. 1A, arrow 4). In contrast, a marked reduction of mGlu2/3 immunoreactivity was detected in the areas corresponding to the mossy fiber pathway in epileptic rats (Fig. 1D, arrow 1 and 2 and Fig. 1E, at higher magnfication). A reduction of mGlu2/3 immunostaining was also evident in the stratum lacunosum/molecular, particularly in the more lateral portion close to the CA3 area (Fig. 1D, *). Moreover, diffuse mGlu2/3 immunoreactivity was apparently increased along the inner molecular layer of dentate gyrus while the level of immunostaining in the outer molecular layer was comparable to control tissue (compared Fig. 1C and Fig. 1F).

Figure 1.

Figure 1

Open in a new tab

Distribution of mGuR2/3 immunoreactivity in control (A–C) versus epileptic rat (D–F). A. In the hippocampal formation of control rat, neuropil mGlu2/3 immunostaining is intense along the mossy fiber pathway in the hilus (arrowhead 1) and CA3 stratum lucidum (sl) (arrowhead 2), and in the middle one-third of the molecular layer (mml) (arrow 3) of the dentate gyrus. Notice a strong mGlu2/3 immunopositive band along the stratum lacunosum/ moleculare (slm) (arrowhead 4). B. Higher magnification of CA3 area showing mGlu2/3 immunoreactivity in the mossy fiber termination zone (sl) (arrowhead). (C). Higher magnification of dentate gyrus to illustrate diffuse mGlu2/3 immunostaining in the mml and slm, and moderate staining in the outer one-third of the molecular layer (oml). Notice mGlu2/3 staining in the hilus (arrowhead 1). D. In the epileptic rat sacrificed at 45 days following pilocarpine-induced status epilepticus (SE), mGlu2/3 is almost completely reduced in the mossy fiber pathway (hilus of dentate gyrus and sl of CA3, arrows 1 and 2 respectively). Immunoreactivity at the slm was slightly reduced, specifically near the CA3 area (arrow 5, *). Notice a general reduction in background staining is noticed in the hippocampus and apparent increase in mGlu2/3 diffuse staining in the molecular layer of dentate gyrus (arrowhead 3). E. Loss of mGlu2/3 immunostaining at sl of CA3 is illustrate at higher magnification. F. A decrease of mGlu2/3 immunostaining was diffusely observed in the granule cell area (gc) of dentate gyrus. Photomicrographs of Sections that were processed omitting primary antibodies depicting hippocampal (G) and dentate gyrus areas (H). Magnification 25× for A, B, 200× for B–C and E–F and 100× for G and H

2.3. Western blot analysis of mGlu2 and mGlu3 protein expression in epileptic and control rats

To investigate whether reduced mGlu2/3 immunoreactivity correlate with similar deficits in protein expression, Western blots of protein extracts from epileptic and control hippocampi and cortices were probed with anti-mGlu2/3 and mGlu2 antibodies, visualized on film by chemiluminescence, and analyzed using band densitometry (Fig.2). Western immunoblot analysis was performed in protein extracts from hippocampus and cortex of rats sacrificed at 10 days after SE (n=4), at more than 2 month after SE (chronically epileptic, n=4) and from age-matched control rats (n=4). The membranes were probed with the same antibody used for immunohistochemistry that recognized both mGlu2 and mGlu3R (anti-mGlu2/3) and with a polyclonal antibody that selectively recognizes mGlu2. Both antibodies detected an immunoreactive band around 110KDa which is considered a monomeric version of the receptors (Figure 2A). Additional band of larger molecular weight (~230kDa) was also detected in both cortex and hippocampus (Figure 2A, arrows) consistent with multimeric aggregation (i.e. dimers) of the receptors as previously reported (Ohishi et al., 1994; Tamaru et al., 2001). We performed the analysis on the optical density (OD) % changes for both immunopositive bands in control versus epileptic group. Western blotting assays using anti-mGlu2/3 antibody show a statistically significant reduction in the signal corresponding to monomeric mGlu2/3 protein expression in both hippocampus (74.5±2.6, a 25% reduction, p < 0.05 Student's t test) and cortex (87.4±3% of controls, a 12.2% reduction, p < 0.05 Student's t test) of pilocarpine-treated chronically epileptic rat (Fig. 2A and 2B). Similarly, mGlu2 protein was significantly reduced in the hippocampus (58.1±12.3, a 42% reduction, p < 0.001 Student's t test) and cortex (71.7±9% of controls, a 28.2% reduction, p < 0.01 Student's t test) of epileptic rats when compared to control rats (Fig. 2B, Ca). Moreover, the epilepsy-associated decrease in mGlu2 immunoreactivity was significantly higher than the reduction detected for mGlu2/3 (Student’s t test, P<0.05). The analysis of the second (dimer) bands was performed in membranes immunoprobed with mGlu2/3 antibodies. A significant reduction (45.1±19.4 %, student t test, P<0.05) was observed at 10 days following SE when compared to control group in proteins extracted from hippocampus. Moreover, a significant 32.4±12.08% reduction was noticed in chronically epileptic rats (Student t-test, P<0.05) (Fig. 2Cb). These data indicate similar level of down-regulation in both monomer and dimer forms of the mGlu2/3 in epilepsy.

Figure 2.

Figure 2

Open in a new tab

Down-regulation of mGlu2 and mGlu3 protein expression in epileptic rats. A. Representative immunoblot probed with polyclonal anti-mGlu2/3 antibody (first row) reveals a reduction in both 110 kD and ~230 kD immunopositive bands in hippocampus of a rat sacrificed 10 days following SE and in chronically epileptic rat (sacrificed at 2 month post-SE period) compared to age-matched saline-injected control rat. Expression of mGlu2 expression was strongly reduced in hippocampus (second row) at 10 days following SE and in chronic epileptic rat. Defect is more evident for dimer (~230KD) form of the receptor (arrows). Third row is a loading control immunoblotted using GAPDH antibody (immunopositive band ~37 kD). B. Graph representation of grouped data for the analysis of the mean optical density (OD) of mGlu2/3 and mGlu2 immunopositive bands represented as percent (%) changes compared to control group. Notice a significant % reduction of OD in proteins extracted from cortex and hippocampus of epileptic rats. C. A significant percent reduction was detected at 10 days following SE and during the chronic period (>2 mnth after SE) for both monomer (a) and dimer (b) forms of mGlu2/3 (Student t-test compared to controls, * P<0.05, ** P<0.001).

Furthermore, we investigated whether epileptogenesis affected expression of other proteins in the brain. For this purpose, membranes with same samples from control and epileptic hippocampus were probed with anti-VGluT1 antibody and processed in parallel. As previously reported, Western immunoblotting revealed no changes in VGluT1 expression in cortex but an apparent increase (up-regulation) in hippocampal protein extracts from epileptic rats as reported elsewhere (Pacheco Otalora et al., 2008). Thus,the induction of epilepsy in the pilocarpine model produced a long-lasting down-regulation in mGlu2/3 protein expression in hippocampus and cortex.

3.1. mRNA expression of mGlu2 and mGlu3 in epileptic and control rats

We analyzed mRNA levels of mGlu2 and mGlu3 using gene-specific primers in total RNA extracted from microdissected dentate gyrus using RT-PCR. The qualitative assessment of mGlu2 and mGlu3 mRNA changes was performed at different time points after pilocarpine-induced SE (24h, 10 days, 1 month, more than two months). The data indicate that mGlu2 and mGlu3 transcript expressions are decreased as early as 24h following SE (Fig. 3A and Fig. 3B). Semi-quantitative analysis of band optical densities (arbitrary units) showed a significant difference in gene expression for mGlu2 as follows: control, 262.5±5.5; 24h after SE, 140±5 (46.6% reduction); 10 days after SE, 184±17 (28% reduction); 1 month after SE, 232±20 (11.5% reduction); more than two month after SE, 203.5±5.5 (18.7% reduction), Anova P<0.01, Fig. 3D. Similar pattern was observed for mGlu3 mRNA levels: control, 167±10; 24h after SE, 113.5±4.5 (32% reduction); 10 days after SE, 132.5±7.5 (21% reduction); 1 month after SE, 136±4 (18.5% reduction); more than two month after SE, 131±5 (21.6% reduction), five animal per group, Anova P<0.05, Fig. 3D.

Figure 3.

Figure 3

Open in a new tab

Representative RT-PCR experiment showing the time course of reduction of mGlu2 and mGlu3 mRNA transcripts at different periods following pilocarpine-induced SE. A. When compared with control rats, expression of mGlu2 transcript is reduced as early as 24 h following SE and remains down-regulate through all different phases of epileptogenesis following SE. Although expression was variable, transient increase in mGlu2 transcript levels was noticed at 10 days and at one month of post-SE period. B. Notice similar pattern of down-regulation for mGlu3 transcripts following SE. C. No evident changes were noticed for transcripts of the housekeeping gene GAPDH. Lanes are representative two different samples for each group, L= 100 bp DNA ladder. Semi-qunatitative analysis of mGlu2 and mGlu3 mRNA expression at different periods after status epilepticus (*P<0.01, **P<0.05, post-hoc relative to controls)

An evident deficit in mGlu2 transcript expression persisted after 2 month of SE (Fig. 3A). Similar pattern of SE–associated reduction in transcript levels was noticed for mGlu3 (Fig. 3B) as early as 24h, although the compensatory increases in expression at 10 days and at 1 month were notably absent when compare to mGlu2 mRNA changes. GAPDH was considered as an appropriate gene to be used as housekeeping gene and remained unchanged across all the samples (Fig. 3C)

2.4. Electrophysiology recordings in brain slices

Electrophysiological analysis was performed in chronically epileptic rats (n=6) experiencing at least 2 month of post-SE period (4–5 seizures per week) and age-matched control rats (saline instead of pilocarpine). Mossy fiber stimulation evoked a single population spike in control slices (Fig. 4Aa). The majority of the slices from epileptic rats exhibited signs of hyperexcitability (>2 population spikes, 3.1±1.8; range, 2–5) (Fig. 4Ab, arrows). Analysis of fEPSP revealed no significant differences in the amplitude and slope parameters in fEPSP recorded from control (fEPSP amplitude: −2.42±0.3 mV; left slope: −3.5±0.8 mV/ms) and epileptic slices (fEPSP amplitude: −2.40±0.5 mV; left slope: −3.5±0.5 mV/ms, Student t-test, P>0.05, n=6). Moreover, we detected no differences in the paired-pulse ratio (control: 137±5.3% versus epileptic: 1.4±6.2%, Student t-test P>0.05).

Figure 4.

Figure 4

Open in a new tab

Hyperexcitability in the CA3 area and loss of DCG-IV mediated depression of mossy fiber transmission in chronically epileptic rats. A. Population spike recordings in CA3 stratum pyramidale revealing control responses in representative control rat (a) in contrast to different degrees of enhanced excitability (polyspiking activity) in six hippocampal slices (1–6) from different chronically epileptic rats (more than 45 days following pilocarpine-induced SE) (stimulus intensity was 200 µA). Additional spikes in epileptic slices are indicated by arrowheads. (b). B. Recordings from representative experiments illustrate a reduction of fEPSP amplitude 10 minutes after application of DCG- IV (5 µM) in control rat slice (compare i to ii) contrasting with no effect of similar treatment in slice from epileptic rat (b) (compare iii to iv). C. Graph representation of grouped and normalized data depicting the analysis of DCG-IV time-dependent effect on fEPSP amplitude (represented as % changes of baseline). Normalized fEPSP amplitude values were plotted as the percent change over the baseline values. Notice that DCG-IV induced depression of synaptic potentials in control slices (n=9) while was ineffective in reducing fEPSP amplitude in slices from chronic epileptic rats (n=6) (a). Statistical analysis performed at 10 minutes following DCG-IV application (arrow) revealed a significant reduction fEPSP amplitude in control group and minimal non-significant effect in epileptic group (b).

To assess whether mGlu II receptor-mediated presynaptic plasticity of mossy fiber synaptic transmission was affected in chronic epilepsy, we investigate the effect of mGlu II receptor agonist DCG-IV (Brabet et al., 1998) on evoked excitatory potentials. Application of DCG-IV (5 µM) induced a significant reduction (35.8±5.2% inhibition, paired t-test, P<0.01) in the amplitude of fEPSP in slices from control rats (n=6) when analyzed at 10 min after drug application (Fig. .4Ba). The depression of synaptic potentials exhibited persisted for about 45–60 min. In contrast, similar analysis revealed that DCG-IV treatment had negligible effects on fEPSPs (0.44±2.9% inhibition, paired t-test,P>0.05) recorded in slices from chronically epileptic rats (n=6) (Fig. 4Bb). Moreover, DCG-IV-induced inhibition of fEPSP was significantly higher in the control versus epileptic group (Student t-test, P<0.0001).

3. Discussion

At excitatory synapses, feedback activation of mGlu II receptors serves as a regulatory mechanism to control excessive glutamate release (Kamiya et al., 1996; Yokoi et al.,1996). Based in this notion, mGlu II receptors, specifically mGlu2 has been considered a promising therapeutic target for antiepileptic drugs (Alexander and Godwin, 2006). In the present study, we demonstrate a persistent down-regulation of mGlu2 and mGlu3 proteins and transcripts in the dentate gyrus and cortex of epileptic rats. Lack of mGlu2 has been previously associated with impairment of mossy fiber LTD (Yokoi et al., 1996). Thus, a long-lasting disruption of mGlu II receptor expression and function may contribute to exaggerate glutamate release and network hyperexcitability during epileptogenesis. Similar deficits in the mossy fiber release properties (metaplasticity) after kainate-induced SE have also been observed in the mossy fiber-CA3 synapses (Goussakov et al.,2000) and at GABAergic synapses in the hippocampal CA1 region (Hirsch et al., 1999). Moreover, epilepsy-associated deficit of these pharmacological targets (i.e. mGlu2 and mGlu3) may render mGlu II receptor-targeted drugs inefficient to control hyperexcitability and ultimately seizures in epilepsy.

We detected a differential reduction of mGlu2/3 immunostaining (most probably mGlu2) in mossy fibers of epileptic rats as previously reported (Pacheco Otalora et al., 2006; Tang et al., 2004). In addition, abnormal mGlu2/3 immunoreactivity correlates with similar reduction in mGlu2/3 and mGlu2 protein expression and with a persistent down-regulation of mGlu2 and mGlu3 transcripts after pilocarpine-induced SE. Reduction in transcripts levels was evident at 24 hours after pilocarpine-induced SE. These data is in agreement with previous study revealing that kainic acid-induced SE induces a reduction in expression of mGlu2 receptor mRNA in granule cells of the dentate gyrus of both pups and adult rats (Aronica et al., 1997). Although, apparent compensatory increase on mGlu2 transcripts was observed in some animals, overall levels of mGlu2 and mGlu3 mRNA remained down-regulated during the “latent” (10 days), early (1 month) and late phases (more than 2 month) of the pilocarpine-induced epileptogenic process. These data is in agreement with recent quantitative real-time PCR analysis of mGlu2 and mGlu3 gene expression in pilocarpine-treated epileptic rats (Ermolinsky et al., 2008).

Previous ultramicroscopy studies indicate that populations of mGlu2 and/or mGlu3 receptors are localized differentially in presynaptic and postsynaptic neuronal compartments (Petralia et al., 1996). Moreover, studies in mGlu2-knockout mice revealed that mGlu2 is differentially located at mossy fiber pathways (Tamaru et al., 2001). In contrast, mGlu3 receptors are considered to be located mostly at dentate gyrus outer molecular layers (Tamaru et al., 2001). Hence, the reduction in mGlu2/3 immunoreactivity at stratum lacunosum of CA3 area and the apparent increase of immunostaining in inner and middle molecular layer suggest a selective down-regulation of mGlu2 in the mossy fiber pathway of chronic epileptic rats and a possible preservation (“redistribution”) of mGlu3 at the terminal zone of the perforant path (Pacheco Otalora et al., 2006). In pilocarpine-treated epileptic rats, novel synaptic contacts are formed by aberrant mossy fiber collaterals onto the proximal dendrites of dentate granule cells (mossy fiber sprouting). Hence, intense mGlu2/3 immunostaining in the supragranular region and inner molecular layer, which are recipients of excitatory and inhibitory recurrent collaterals, may be determined by a compensatory redistribution of these receptors at the newly sprouted axons and synapses during anomalous neosynaptogenesis in temporal lobe epilepsy. Pharmacological activation of mGlu2/3 by DCG IV was found to almost completely depress glutamate release by presynaptic mechanisms in human dentate gyrus from surgically removed hippocampi for the treatment of temporal lobe epilepsy (Dietrich et al., 2002). These authors suggested that mGlu2/3-dependent modulation of glutamatergic transmission is functionally intact in the perforant path-granule cell synapse. However, DCG-IV-mediated reduction in the frequency of miniature EPSCs (mEPSCs) in granule cells in epileptic hippocampus can be also explained by inhibitory action of DCG-IV on presynaptic mGlu2/3 at the recurrent mossy fiber pathway terminating onto granule cells. Hence, functional mGlu II receptor modulation of excitatory recurrent sprouting and apparent increase in mGlu2/3 immunoreactivity at inner molecular layer in epileptic rats indicating that “retrodirected”granule cell axonal collaterals maintain similar “synaptic functional phenotype” as the main mossy fibre innervating CA3 pyramidal neurons.

Loss of mGlu II receptor function at mossy fibers may indicate seizure-related disruption of the presynaptic release machinery in chronic epilepsy, a phenomenon that can affect both excitatory and inhibitory neurotransmission. Compelling evidences support now the notion that, in addition to glutamate, mossy fibers can also release GABA in the epileptic hippocampus. The ultimate anti-epileptic or pro-epileptic role of mGlu2/3 deregulation remains to be determined in this form of epilepsy. Presynaptic mGlu receptors are an important negative “feedback” mechanism that controls synaptic release of glutamate in the hippocampus (Dube and Marshall, 2000; Scanziani et al., 1997b). Several studies have explored the role of these receptors in epilepsy (Moldrich et al., 2001a; Moldrich et al., 2001b),(Lea and Sarvey, 2003). In another controversial study, mGlu2/3 agonist 2R,4,4R-4-aminopyrrolidine-2,4-dicarboxylate (2R,4R-APDC) acts as anti- and proconvulsant in DBA/2 mice when tested in epileptic seizures induced by sound or chemoconvulsants (Moldrich et al., 2001c). Supporting antiepileptic function, low doses of (2S.3S.4S)alpha-(carboxycyclopropyl)glycine L-CCG-I, mGlu2/3 agonist, protect against (RS)3.5-dihydroxyphenylglycine (3,5-DHPG)-induced convulsions(Tizzano et al., 1995). Selective mGlu2/3 agonists 1S,3R-ACPD and DCG-IV have been shown to inhibit amydala-kindled seizures (Attwell et al., 1995; Attwell et al., 1998). Another in vivo study has shown that agonist of mGlu3 attenuate seizures induced by homocysteic acid (Folbergrova et al., 2001). Furthermore, daily injection of mGlu3 antisense oligonucleotide produced suppression of afterdischarge in hippocampal kindling(Greenwood et al., 2000). Moreover, Attwell et al., (1995)) reported that mGlu2/3 activation inhibits kindled epilepsy(Attwell et al., 1995). They also confirmed that intracerebral infusion of mGlu2/3 agonist DCG-IV was 70-fold more potent than clinically effective anticonvulsant lamotrigine (Attwell et al., 1998). These authors proposed that mGlu II ability to control seizures is via modulatory action on glutamate release. Effect of mGlu II agonists may be different on seizure-remodeled networks as in chronic epilepsy. Interestingly, Okazaki & Nadler reported that DCG-IV reduced the duration and amplitude of epileptiform discharges evoked in dentate gyrus by stimulation of mossy fibers in pilocarpine-treated chronic epileptic rats (Okazaki and Nadler, 2001). Moreover, it has been demonstrated that systemically active agonists for mGlu II receptor such as (+)-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylic acid (LY354740) can reduce glutamate release exerting a neuroprotective an anticonvulsant effect in rats (Flor et al., 2002; Klodzinska et al., 1999; Moldrich et al., 2003). In a recent preclinical study, the antiepileptic effect of a novel mGlu II receptor agonist LY379268 was investigated while monitoring the concomitant alterations in the neurotransmitter levels (Imre, 2007). Data from this study support the hypothesis that mGlu II receptors actively prevent glutamate accumulation during high frequency events as previously reported (Cartmell and Schoepp, 2000; Imre et al., 2006) and that the anticonvulsant effect of LY379268 also involves GABAergic inhibition at least in the hippocampus (Imre, 2007) . However, chronic deficit on mGlu2 and mGlu3 may render pharmacological drugs acting on these receptors ineffective to ameliorate neurodegeneration and epileptogenesis in MTLE.

The mechanisms underlying seizure-dependent changes in gene and protein expression at presynaptic terminals are poorly unknown. It has been reported that recurrent seizures induce a progressive defect in expression and function of dendritic (post-synaptic) HCN channels (i.e. HCN1) conducting the hyperpolarization-activated current (Ih) (Dyhrfjeld-Johnsen and Soltesz, 2004; Jung et al., 2007). This “acquired channelopathy” has been implicated in the pathogenesis of temporal lobe epilepsy (Bernard and Shevell, 2008). The mechanisms triggering seizure-evoked HCN1 reduction involve calcium-permeable AMPA receptor-mediated calcium influx, and subsequent activation of calcium/calmodulin-dependent protein kinase II (Richichi et al., 2008). However, the mechanisms underlying “presynaptic” deficits in mGlu2 remain unknown. Our data also suggest that seizure-dependent reduction on mGlu2 and mGlu3 expression may underlie deficient regulation of transmitter release at at mossy fibers of epileptic rats. Deterioration of presynaptic machinery controlling glutamate exocytosis may result in enhanced axonal and presynaptic terminal excitability, and exaggerated glutamate release at mossy fiber-pyramidal CA3 synapses.

4. Material and methods

4.1. Animals and pilocarpine model of epilepsy

All experiments were performed in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and with the approval of The University of Texas at Brownsville Institutional Animal Care and Use Committee (Protocol# 2007-001-IACUC). Wistar rats were kept in acclimatized temperature-controlled vivarium with water and food ad libitum. All efforts were made to minimize the number of animals in the study. Chronically epileptic rats were obtained by the pilocarpine model of temporal lobe epilepsy following described procedures (Cavalheiro et al., 1991; Turski et al., 1983). At the time of inducing SE animals were approximately 20–30 days (180–250g). Methyl-scopolamine nitrate (0.1 mg/kg in saline, s.c.) (Sigma-Aldrich, St. Louis, MO) was administered 30 min prior pilocarpine to minimize the systemic side effects of cholinergic overstimulation (Turski et al., 1984). Animals were then injected with 4% pilocarpine hydrochloride (Sigma-Aldrich) (350 mg/kg in saline, i.p.). Controls included (a) animals that received methyl-scopolamine but were injected with saline instead of pilocarpine, (b) pilocarpine-injected animals that did not exhibit seizures. Behaviorally, SE was limited to ~3 hr by administering diazepam (10 mg/kg,s.c.). This procedure helps to increase the survival rate (Danzer and McNamara, 2004; Mello et al., 1993; Pacheco Otalora et al., 2006; Pacheco Otalora et al., 2008). All animals that suffered SE were given a subcutaneous injection of 20 ml Ringer-lactate solution and diet was enriched with Nutra-Gel® soft food (Bio-Serv, Frenchtown, NJ) for at least one week. After SE, rats were monitored for detection of at least two spontaneous seizures using a JVC MiniDV digital video-camera and researcher-assisted SeizureScan software (Clever Sys., Inc, Reston, VA). Seizures were confirmed off-line by a trained researcher. Only seizures graded ≥ 3 in the Racine's scale (Racine, 1972) per week were computed (according to sensitivity of the detection system). In average, SE-suffering rats experienced approximately 5–8 seizures per week regularly during the observation period. For isolation of total RNA pilocarpine-treated rats were sacrificed at 24h, 10 days, one month and at more than two month (late chronic period) following SE induction. For immunohistochemistry, immunoblotting and electrophysiology, epileptic rats were sacrificed after two month of post-SE period.

4.2. Tissue preparation and immunohistochemistry

Immunohistochemitry was performed in 50 µm-thick coronal sections obtained from the brains of rats that were previously anesthetized (50 mg/kg ketamine) and transaortically perfused as previously described (Pacheco Otalora et al., 2006; Pacheco Otalora et al., 2007; Pacheco Otalora et al., 2008). Briefly, corresponding free-floating sections were selected from both age-matched saline-injected control and epileptic groups and processed simultaneously. The sections were incubated in PBS–Triton X-100 (0.2%) solution containing 0.1% H2O2 for 30 min to block the endogenous peroxidase. After rinsing three times for 5 min in PBS and blocking with 2% normal goat serum (NGS) the sections were then incubated overnight at 4°C with affinity purified polyclonal rabbit anti-mGlu2/3 primary antibody (1:1000, kindly provided by Dr. Ryuichi Shigemoto, National Institute for Physiological Sciences, Japan). These antibodies have been extensively characterized in previous studies (Neki et al., 1996; Ohishi et al., 1994; Pacheco Otalora et al., 2006). In control incubations, adjacent sections were incubated in a medium omitting the primary antibodies. Subsequent antibody detection was carried out by using Vectastain ABC kit antimouse IgG (PK 4002, Vector Lab) with 3, 3-diaminobenzidine (DAB) as a peroxidase substrate. Results were visualized and acquired using a Zeiss Axioskop 2 microscope, AxioCam HR CCD 24-bit camera and AxioVision software (Zeiss, Oberkochen, Germany).

3.3. Western blot analysis of mGlu2 and mGlu3 receptors

Protein was extracted from hippocampus and cortex of four sets of age-matched control and chronically epileptic rats as describe elsewhere (Pacheco Otalora et al., 2008). Briefly, the animals (75–90 days of age) were anesthetized with ketamine, decapitated and brains were rapidly removed from the skulls and the hippocampus and parietal cortex dissected. After homogenization in ice-cold standard radioimmunoprecipitation assay (RIPA) buffer (Pierce, Rockford, IL) containing 10 µl of Halt Protease Inhibitor Cocktails and 10 mM PMSF (phenylmethylsulfonyl fluoride) (Pierce) per 1 ml of buffer. Proteins were stored in 50 µl aliquots in vials at −80°C for further analysis. One aliquot was used for protein concentration determination was measured using Qubit™ fluorometer and Quant-iT™ Protein Kit (Invitrogen). The brain of each rat was coded and Western blot analysis was performed blindly. The expression of mGlu2 and mGlu3 receptor was estimated by Western blot analysis, using affinity-purified polyclonal antibodies anti-mGlu2/3 (same as immunohistochemistry) and mouse anti-mGlu2 kindly provided by Dr. Ryuichi Shigemoto. These affinity-purified antibodies have been widely characterized in previous studies (Ohishi et al., 1994; Ohishi et al., 1998; Shigemoto et al., 1997). Samples from paired control and epileptic brain were adjusted to a final protein concentration of 1.5 mg/ml, boiled for 5 min in Laemmli buffer and resolved on Tris-tricine buffered SDS-PAGE (1 hour, at 75 V). Proteins were electrotransferred (overnight, at 25 V) to a polyvinylidene difluoride (PVDF) membrane using Mini-PROTEAN 3 electrophoresis apparatus (Bio-Rad Lab, Mississauga, ON). Membranes were blocked for 2 hrs at room temperature in 0.01M Tris-buffered saline (TBS) containing 5% non-fat dry milk and 0.1% Tween-20. The membranes were then probed overnight at 4°C with the primary anti-body (mouse anti-mGlu2, 1:500; rabbit anti-mGlu2/3, 1:500; and guinea pig anti-VGlut1 from Chemicon, 1:2000) diluted at TBS containing 2% non-fat dry milk and 0.1% Tween-20. The membranes were washed in TBS with 0.1% Tween-20 then incubated for 2 hr in biotinylated secondary antibody (i.e. anti-mouse, anti-rabbit or anti-guinea pig) as recommended by vendor (Vector labs). After washing 3 times in 0.01M PBS, membranes were washed 3 times in 0.01M PBS and incubated 90 min in ABC (room temperature), rinsed 3 times (15 min each) in PBS and the proteins immunopositive bands visualized by chemiluminescent detection using ECL Plus Western Blotting Kits according to manufacturer's protocols (Pierce) and a Bio-Rad ChemiDoc XRS digital documentation system. Relative changes in protein expression was determined by measuring the optical density of specific mGlu2 and mGlu2/3reactive bands using Quantity One 1-D Analysis Software (Bio-Rad) as previously described (Pacheco Otalora et al., 2008).

4.4. Isolation of total RNA isolation and RT-PCR

Dentate gyrus RNA isolation

A set of age-matched control and epileptic rats were anesthetized as above and rapidly decapitated to prepare 600 µm hippocampal slices in ACSF (2–4°C). Epileptic rats were sacrificed at different post-SE survival times (24h, 10 days, 1 month, more than two months). The region of dentate gyrus was microdissected with 27 gauge needles assisted via stereomicroscope (10–20x) and cold light transillumination. A thin C-shaped dark line corresponding to the granule cell layer can be observed in the dentate gyrus. The dissection was performed along an imaginary line corresponding to the hippocampal fissure. A perpendicular cut to this line was performed at the level of the anterior border of dentate gyrus (C-shaped dark line) to separate the dentate gyrus from the Ca3 and part of the Ca4 area. This material also include some interneurons and other hilar neurons, however the majority of the cells are represented by granule cells. Sections were collected, weighed (~20 mg), homogenized, and processed for total RNA isolation using the RNAqueous®-4PCR Kit (Foster City, CA), following manufacture instructions. This kit produces RNA that is free of genomic DNA contamination from samples as small as 1 mg or 100 cells. The concentration and purity of total RNA for each sample was determined by the Quant-iT™ RNA Assay Kit and the Q32857 Qubit™ fluorometer (Carlsbad, Invitrogen, CA) and confirmed by optical density measurements at 260 and 280nm using a BioMate 5 UV-visible spectrophotometer (Thermo Spectronic, Waltham, Mass). For each sample, the RNA integrity was assessed clear, sharp bands for 28S:18S ribosomal RNA (rRNA) by RNA electrophoresis. Briefly, total RNA (5 µg) was denatured, and subjected to electrophoresis in 2.2 M formaldehyde-1% agarose gel in morpholinepropanesulfonic acid (MOPS) containing ethidium bromide (5 µg/ml). The agarose was prepared in RNase free ultrapure water (pH=7.0).

4.5. Reverse transcription and endpoint polymerase chain reaction (RT-PCR)

RNA reverse transcription

RNA samples from each set of control and epileptic rats where processed in parallel under the same conditions. RT and PCR reactions were performed on an iCycler Thermal Cycler PCR System (Bio-Rad Laboratories, Hercules, CA) with 96-well reaction module using the High Capacity cDNA Reverse Transcription Kit (P/N: 4368814, Applied Biosystems, CA, USA) for synthesis of single stranded cDNA. The cDNA synthesis was carried out by following manufacturer's protocol. Each RT reaction contained 1000 ng of extracted total RNA template, 50 nM random RT primer, 1 × RT buffer, 0.25 mM each of dNTPs, 3.33 U/µl Multiscribe reverse transcriptase and 0.25 U/µl RNase Inhibitor. The 20 µl reactions were incubated in the iCycler Thermocycler in thin-walled 0.2-µl PCR tubes for 10 min at 25°C, 120 min at 37°C, 5 sec at 85°C and then held at 4°C.

Determining the amount of input RNA

Exceeding the capacity of the RT reactions may lead to significant errors in the RNA quantification process. Hence, input amount of total RNA was set (normalized for each sample) to 1000 ng after determining the capacity, linearity and RT efficiency of the RT Kit using serial dilutions of input RNA. Briefly, each RNA concentration was reverse transcribed using the same RT reaction volume. The resulting cDNA was then transferred into the real-time PCR Master Mix and PCR reactions were amplified using the StepOne™ Real-Time PCR System (Applied Biosystems) using Taqman-based Applied Biosystems gene expression (100% efficiency) assays Hs99999901_s1 for eukaryotic 18S rRNA (standard RNA mass normalizer) and Rn99999916_s1 for endogenous control Glyceraldehyde 3 phosphate dehydrogenase 1 (GAPDH). The amount of input RNA (1000 ng) was comprised within the dynamic range of the amplification.

Primers design for mGlu2 and mGlu3 mRNA

Primers for qrtPCr analysis of mGlu2 and mGlu3 expression levels were designed using the Primer Express software v2.0 (Applied Biosystems) and/or vectorNTI Primer Design For PCR (Invitrogen). The primers for each amplicon were selected so as to contain minimal internal secondary structure (i.e. hairpins and primer–dimer formation) as determined by OligoAnalyzer 3.0 webserver available at IDT SciTools and to have compatible Tm values (60–65°C). Specific primers for the rat mGlu2 and mGlu3 mRNA related sequences were designed based in published data on Grm2 (mGlu2: Accession #: XM_343470) and Grm3 (mGlu3: Accession#: NM_001105712) gene products (Tanabe et al., 1992). The following sequences were used for amplification of rat mGlu2 transcripts: the specific sense primer, 5'-AGTCCTTAGCTGGGGAGCCT-3' (bases 3008–3027; the antisense primer, 5' -AACCATCCTCTCTATCCCAGAGTAAC -3' (bases 3211–3236), amplicon length 229 bp. The following sequences were used for amplification of rat mGlu3 transcripts: the specific sense primer, 5'-TAGGCTGTTAGACAAAGTGCTCA-3' (bases 2894–2916); the antisense primer, 5'- GAAGGGGCTGTTAATTAGGGCA -3' (bases -3060–3081), amplicon length 188 bp. The Housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), served as an internal control and simultaneously assessed in separate reaction tubes. GAPDH is a catalytic enzyme involved in glycolysis and is constitutively expressed in almost all tissues at high levels. Primers for the GAPDH sequence were as follows: GAPDH sense, 5’-CAGCACCAGCATCACCCCATTT-3’ and antisense 5’-CAAGATGGTGAAGGTCGGTGTGAA and produced a product of 275 bp.

End-point PCR analysis

Each PCR amplification (20 µl of final volume) contained 10µM of sense and antisense transcript-specific primers, 10mM deoxynucleotides (dNTP), 10X PCR buffer, 50mM MgCl2, 1 unit of AmpliTaq Gold® DNA Polymerase (P/N 4338857, Applied Biosystems), and 0.25µl of cDNA template. PCR was initiated with a denaturation step at 95°C (for 10 min) followed by 30 cycles at 95°C (for 30 s), 60°C for 30s (annealing), and 72°C for 30s (polymerization). Sequence of primers for mGlu2, mGlu3 and GAPDH are listed above. PCR amplification conditions and protocols were the same for these primer sets. cDNAs generated in the presence or absence of reverse transcriptase underwent amplification with primers of the housekeeping gene GAPDH (amplified using 30 cycles of PCR). The results of this amplification were used to ensure successful mRNA isolation without genomic DNA contamination. The PCR-amplified products (10 µL) were electrophoresed on a 2.0% agarose gel at 80 V for 1.5 hrs and visualized with ethidium bromide staining. Images were digitally acquired using Bio-Rad ChemiDoc XRS. Product bands were identified according to DNA ladders and reported product size.

4.6. Electrophysiology recordings in brain slices

Horizontal slices (400 µm thick) of hippocampi and associated entorhinal cortices were prepared from anesthetized (50 mg/kg ketamine) chronic epileptic and age-matched control rats. Slicing procedures were performed in cold (4°C) sucrose-based artificial cerebrospinal fluid (ACSF) containing (in mM): 124 sucrose, 3 KCl, 2 CaCl2, 5 MgSO4, 0.15 BES (N,N-bis(2-hydroxyethyl)2-aminoethanesulfonic acid), NaHCO3, and 25 glucose, aerated with 95% O2-5% CO2 (pH 7.4; 310 mOsm) using a vibratome OTS-4000 sectioning device (Electron Microscopy Sciences, Fort Washington, PA). The sucrose ACSF enhanced the viability of slices. Slices were allowed to recover in standard ACSF at room temperature before being placed in the recording chamber. Recordings were carried out in a modified Haas-type interface chamber at 30°C on slices continuously perfused with pre-warmed (33°C) artificial cerebrospinal fluid: 125 mM NaCl, 26 mM NaHCO3, 5 mM BES, 3 mM KCl, 2 mM CaCl2, 2 mM MgSO4, and 15 mM D-glucose, gassed with 95% O2/5% CO2 (pH 7.3–7.4) at 2 ml/min. Bipolar tungsten stimulating electrodes (World Precision Instruments) were placed in or just on the hilar side of the upper blade of the dentate granule cell layer. The mossy fiber pathway was stimulated (150-µs square pulses) every 20–30 s using a paired-pulse protocol (inter-stimulus interval=50 ms). Extracellular recordings were performed using a 4–8 MΩ glass micropipettes (filled with 1M NaCl). Prior pharmacological experiments, field potential population spike were briefly recorded with the electrode positioned at the stratum pyramidale to assess slices excitability. Field excitatory postsynaptic potentials (fEPSP) were recorded in the stratum lucidum of the CA3 area. In our study, mossy fibre-associated fEPSPs were identified by the magnitude of the paired pulse facilitation (PPF),which is much larger for the mossy fibre input than the collateral (associated/commisural) fibre input to this area (Salin et al., 1996; Scanziani et al., 1997a). PPF of more than 130% was set as criterion for mossy fiber fEPSPs (Sanabria et al., 2004). Baseline stimulus strength (10–100 µA) was adjusted to elicit a response ~50% of fEPSP threshold amplitude without evoking polysynaptic activity. Slices with more than 10% drift in baseline recordings were excluded from the analysis. After establishing a stable baseline of at least 10 min, 5 µM DCG-IV (Tocris-Cookson, UK) was applied in the perfusate to assess mGlu II receptor-mediated depression of fEPSP.

4.7. Statistical analysis of data

The statistical significance of the differences was assessed using paired, non-paired Student's t-test or one-way ANOVA, as indicated. Statistics and graphs were prepared using the software package Statistica (Statsoft, Inc) and Sigmaplot (Systat Software, Inc. San Jose, CA). The level of statistical significance was set as p<0.05. Changes in synaptic strength (amplitude of fEPSP) were normalized to pre-treatment baseline levels in the same slice before averaging across slices.

Acknowledgements

This work was supported by grants from National Institute of Health as follows: P20MD001091, 1SC1GM081109-01, R21NS056160 and MBRS-RISE grant #1R25GM06592501A1.

Abbreviations

mGlu2

metabotropic glutamate receptor type 2

mGlu3

metabotropic glutamate receptor type 3

mGlu II receptors

group II metabotropic glutamate receptors

MTLE

Mesial temporal lobe epilepsy

SE

Status epilepticus

dNTP

deoxynucleotides

GAPDH

gene for glyceraldehyde-3-phosphate dehydrogenase

Footnotes

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Alexander GM, Godwin DW. Metabotropic glutamate receptors as a strategic target for the treatment of epilepsy. Epilepsy Res. 2006;71:1–22. doi: 10.1016/j.eplepsyres.2006.05.012. [DOI] [PubMed] [Google Scholar]
  2. Aronica EM, Gorter JA, Paupard MC, Grooms SY, Bennett MV, Zukin RS. Status epilepticus-induced alterations in metabotropic glutamate receptor expression in young and adult rats. J Neurosci. 1997;17:8588–8595. doi: 10.1523/JNEUROSCI.17-21-08588.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Attwell PJ, Kaura S, Sigala G, Bradford HF, Croucher MJ, Jane DE, Watkins JC. Blockade of both epileptogenesis and glutamate release by (1S,3S)-ACPD, a presynaptic glutamate receptor agonist. Brain Res. 1995;698:155–162. doi: 10.1016/0006-8993(95)00886-u. [DOI] [PubMed] [Google Scholar]
  4. Attwell PJ, Koumentaki A, Abdul-Ghani AS, Croucher MJ, Bradford HF. Specific group II metabotropic glutamate receptor activation inhibits the development of kindled epilepsy in rats. Brain Res. 1998;787:286–291. doi: 10.1016/s0006-8993(97)01500-x. [DOI] [PubMed] [Google Scholar]
  5. Bailey CP, Trejos JA, Schanne FA, Stanton PK. Pairing elevation of [cyclic GMP] with inhibition of PKA produces long-term depression of glutamate release from isolated rat hippocampal presynaptic terminals. Eur J Neurosci. 2003;17:903–908. doi: 10.1046/j.1460-9568.2003.02507.x. [DOI] [PubMed] [Google Scholar]
  6. Bear MF, Abraham WC. Long-term depression in hippocampus. Annu Rev Neurosci. 1996;19:437–462. doi: 10.1146/annurev.ne.19.030196.002253. [DOI] [PubMed] [Google Scholar]
  7. Bernard G, Shevell MI. Channelopathies: a review. Pediatr Neurol. 2008;38:73–85. doi: 10.1016/j.pediatrneurol.2007.09.007. [DOI] [PubMed] [Google Scholar]
  8. Brabet I, Parmentier ML, De Colle C, Bockaert J, Acher F, Pin JP. Comparative effect of L-CCG-I, DCG-IV and gamma-carboxy-L-glutamate on all cloned metabotropic glutamate receptor subtypes. Neuropharmacology. 1998;37:1043–1051. doi: 10.1016/s0028-3908(98)00091-4. [DOI] [PubMed] [Google Scholar]
  9. Cartmell J, Schoepp DD. Regulation of neurotransmitter release by metabotropic glutamate receptors. J Neurochem. 2000;75:889–907. doi: 10.1046/j.1471-4159.2000.0750889.x. [DOI] [PubMed] [Google Scholar]
  10. Cavalheiro EA, Leite JP, Bortolotto ZA, Turski WA, Ikonomidou C, Turski L. Long-term effects of pilocarpine in rats: structural damage of the brain triggers kindling and spontaneous recurrent seizures. Epilepsia. 1991;32:778–782. doi: 10.1111/j.1528-1157.1991.tb05533.x. [DOI] [PubMed] [Google Scholar]
  11. Cavalheiro EA, Fernandes MJ, Turski L, Mazzacoratti MG. Neurochemical changes in the hippocampus of rats with spontaneous recurrent seizures. Epilepsy Res Suppl. 1992;9:239–247. discussion 247–248. [PubMed] [Google Scholar]
  12. Costa MS, Rocha JB, Perosa SR, Cavalheiro EA, Naffah-Mazzacoratti Mda G. Pilocarpine-induced status epilepticus increases glutamate release in rat hippocampal synaptosomes. Neurosci Lett. 2004;356:41–44. doi: 10.1016/j.neulet.2003.11.019. [DOI] [PubMed] [Google Scholar]
  13. Danzer SC, McNamara JO. Localization of brain-derived neurotrophic factor to distinct terminals of mossy fiber axons implies regulation of both excitation and feedforward inhibition of CA3 pyramidal cells. J Neurosci. 2004;24:11346–11355. doi: 10.1523/JNEUROSCI.3846-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dietrich D, Kral T, Clusmann H, Friedl M, Schramm J. Presynaptic group II metabotropic glutamate receptors reduce stimulated and spontaneous transmitter release in human dentate gyrus. Neuropharmacology. 2002;42:297–305. doi: 10.1016/s0028-3908(01)00193-9. [DOI] [PubMed] [Google Scholar]
  15. Domenici MR, Berretta N, Cherubini E. Two distinct forms of long-term depression coexist at the mossy fiber-CA3 synapse in the hippocampus during development. Proc Natl Acad Sci U S A. 1998;95:8310–8315. doi: 10.1073/pnas.95.14.8310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dube GR, Marshall KC. Activity-dependent activation of presynaptic metabotropic glutamate receptors in locus coeruleus. J Neurophysiol. 2000;83:1141–1149. doi: 10.1152/jn.2000.83.3.1141. [DOI] [PubMed] [Google Scholar]
  17. Dyhrfjeld-Johnsen J, Soltesz I. Dendritic h channelopathy in epileptogenesis. Neuron. 2004;44:402–403. doi: 10.1016/j.neuron.2004.10.018. [DOI] [PubMed] [Google Scholar]
  18. Ermolinsky B, Pacheco Otalora LF, Arshadmansab MF, Zarei MM, Garrido-Sanabria ER. Differential changes in mGlu2 and mGlu3 gene expression following pilocarpine-induced status epilepticus: A comparative real-time PCR analysis. Brain Res. 2008;1226:173–180. doi: 10.1016/j.brainres.2008.05.073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Flor PJ, Battaglia G, Nicoletti F, Gasparini F, Bruno V. Neuroprotective activity of metabotropic glutamate receptor ligands. Adv Exp Med Biol. 2002;513:197–223. doi: 10.1007/978-1-4615-0123-7_7. [DOI] [PubMed] [Google Scholar]
  20. Folbergrova J, Haugvicova R, Mares P. Attenuation of seizures induced by homocysteic acid in immature rats by metabotropic glutamate group II and group III receptor agonists. Brain Res. 2001;908:120–129. doi: 10.1016/s0006-8993(01)02620-8. [DOI] [PubMed] [Google Scholar]
  21. Goussakov IV, Fink K, Elger CE, Beck H. Metaplasticity of mossy fiber synaptic transmission involves altered release probability. J Neurosci. 2000;20:3434–3441. doi: 10.1523/JNEUROSCI.20-09-03434.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Greenwood RS, Fan Z, McHugh R, Meeker R. Inhibition of hippocampal kindling by metabotropic glutamate receptor antisense oligonucleotides. Mol Cell Neurosci. 2000;16:233–243. doi: 10.1006/mcne.2000.0862. [DOI] [PubMed] [Google Scholar]
  23. Heinemann U. Basic mechanisms of partial epilepsies. Curr Opin Neurol. 2004;17:155–159. doi: 10.1097/00019052-200404000-00012. [DOI] [PubMed] [Google Scholar]
  24. Hirsch JC, Agassandian C, Merchan-Perez A, Ben-Ari Y, DeFelipe J, Esclapez M, Bernard C. Deficit of quantal release of GABA in experimental models of temporal lobe epilepsy. Nat Neurosci. 1999;2:499–500. doi: 10.1038/9142. [DOI] [PubMed] [Google Scholar]
  25. Huang YY, Li XC, Kandel ER. cAMP contributes to mossy fiber LTP by initiating both a covalently mediated early phase and macromolecular synthesis-dependent late phase. Cell. 1994;79:69–79. doi: 10.1016/0092-8674(94)90401-4. [DOI] [PubMed] [Google Scholar]
  26. Imre G, Salomons A, Jongsma M, Fokkema DS, Den Boer JA, Ter Horst GJ. Effects of the mGluR2/3 agonist LY379268 on ketamine-evoked behaviours and neurochemical changes in the dentate gyrus of the rat. Pharmacol Biochem Behav. 2006;84:392–399. doi: 10.1016/j.pbb.2006.05.021. [DOI] [PubMed] [Google Scholar]
  27. Imre G. The preclinical properties of a novel group II metabotropic glutamate receptor agonist LY379268. CNS Drug Rev. 2007;13:444–464. doi: 10.1111/j.1527-3458.2007.00024.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jung S, Jones TD, Lugo JN, Jr, Sheerin AH, Miller JW, D'Ambrosio R, Anderson AE, Poolos NP. Progressive dendritic HCN channelopathy during epileptogenesis in the rat pilocarpine model of epilepsy. J Neurosci. 2007;27:13012–13021. doi: 10.1523/JNEUROSCI.3605-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kameyama K, Lee HK, Bear MF, Huganir RL. Involvement of a postsynaptic protein kinase A substrate in the expression of homosynaptic long-term depression. Neuron. 1998;21:1163–1175. doi: 10.1016/s0896-6273(00)80633-9. [DOI] [PubMed] [Google Scholar]
  30. Kamiya H, Shinozaki H, Yamamoto C. Activation of metabotropic glutamate receptor type 2/3 suppresses transmission at rat hippocampal mossy fibre synapses. J Physiol. 1996;493(Pt 2):447–455. doi: 10.1113/jphysiol.1996.sp021395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Klodzinska A, Chojnacka-Wojcik E, Pilc A. Selective group II glutamate metabotropic receptor agonist LY354740 attenuates pentetrazole- and picrotoxin-induced seizures. Pol J Pharmacol. 1999;51:543–545. [PubMed] [Google Scholar]
  32. Lea PMt, Sarvey JM. Modulation of epileptiform burst frequency by the metabotropic glutamate receptor subtype mGluR3. Epilepsy Res. 2003;53:207–215. doi: 10.1016/s0920-1211(03)00021-4. [DOI] [PubMed] [Google Scholar]
  33. Lin HC, Wang SJ, Luo MZ, Gean PW. Activation of group II metabotropic glutamate receptors induces long-term depression of synaptic transmission in the rat amygdala. J Neurosci. 2000;20:9017–9024. doi: 10.1523/JNEUROSCI.20-24-09017.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Malva JO, Silva AP, Cunha RA. Presynaptic modulation controlling neuronal excitability and epileptogenesis: role of kainate, adenosine and neuropeptide Y receptors. Neurochem Res. 2003;28:1501–1515. doi: 10.1023/a:1025618324593. [DOI] [PubMed] [Google Scholar]
  35. Manabe T. Two forms of hippocampal long-term depression, the counterpart of long-term potentiation. Rev Neurosci. 1997;8:179–193. doi: 10.1515/revneuro.1997.8.3-4.179. [DOI] [PubMed] [Google Scholar]
  36. Marek GJ. Metabotropic glutamate 2/3 receptors as drug targets. Curr Opin Pharmacol. 2004;4:18–22. doi: 10.1016/j.coph.2003.10.003. [DOI] [PubMed] [Google Scholar]
  37. Mello LE, Cavalheiro EA, Tan AM, Kupfer WR, Pretorius JK, Babb TL, Finch DM. Circuit mechanisms of seizures in the pilocarpine model of chronic epilepsy: cell loss and mossy fiber sprouting. Epilepsia. 1993;34:985–995. doi: 10.1111/j.1528-1157.1993.tb02123.x. [DOI] [PubMed] [Google Scholar]
  38. Moldrich RX, Giardina SF, Beart PM. Group II mGlu receptor agonists fail to protect against various neurotoxic insults induced in murine cortical, striatal and cerebellar granular pure neuronal cultures. Neuropharmacology. 2001a;41:19–31. doi: 10.1016/s0028-3908(01)00045-4. [DOI] [PubMed] [Google Scholar]
  39. Moldrich RX, Jeffrey M, Talebi A, Beart PM, Chapman AG, Meldrum BS. Anti-epileptic activity of group II metabotropic glutamate receptor agonists (--)-2-oxa-4-aminobicyclo[3.1.0]hexane-4,6-dicarboxylate ( LY379268) and (--)-2-thia-4-aminobicyclo[3.1.0]hexane-4,6-dicarboxylate ( LY389795) Neuropharmacology. 2001b;41:8–18. doi: 10.1016/s0028-3908(01)00044-2. [DOI] [PubMed] [Google Scholar]
  40. Moldrich RX, Talebi A, Beart PM, Chapman AG, Meldrum BS. The mGlu(2/3) agonist 2R,4R-4-aminopyrrolidine-2,4-dicarboxylate, is anti- and proconvulsant in DBA/2 mice. Neurosci Lett. 2001c;299:125–129. doi: 10.1016/s0304-3940(00)01732-8. [DOI] [PubMed] [Google Scholar]
  41. Moldrich RX, Chapman AG, De Sarro G, Meldrum BS. Glutamate metabotropic receptors as targets for drug therapy in epilepsy. Eur J Pharmacol. 2003;476:3–16. doi: 10.1016/s0014-2999(03)02149-6. [DOI] [PubMed] [Google Scholar]
  42. Neki A, Ohishi H, Kaneko T, Shigemoto R, Nakanishi S, Mizuno N. Pre- and postsynaptic localization of a metabotropic glutamate receptor, mGluR2, in the rat brain: an immunohistochemical study with a monoclonal antibody. Neurosci Lett. 1996;202:197–200. doi: 10.1016/0304-3940(95)12248-6. [DOI] [PubMed] [Google Scholar]
  43. Ohishi H, Ogawa-Meguro R, Shigemoto R, Kaneko T, Nakanishi S, Mizuno N. Immunohistochemical localization of metabotropic glutamate receptors, mGluR2 and mGluR3, in rat cerebellar cortex. Neuron. 1994;13:55–66. doi: 10.1016/0896-6273(94)90459-6. [DOI] [PubMed] [Google Scholar]
  44. Ohishi H, Neki A, Mizuno N. Distribution of a metabotropic glutamate receptor, mGluR2, in the central nervous system of the rat and mouse: an immunohistochemical study with a monoclonal antibody. Neurosci Res. 1998;30:65–82. doi: 10.1016/s0168-0102(97)00120-x. [DOI] [PubMed] [Google Scholar]
  45. Okazaki MM, Nadler JV. Glutamate receptor involvement in dentate granule cell epileptiform activity evoked by mossy fiber stimulation. Brain Res. 2001;915:58–69. doi: 10.1016/s0006-8993(01)02824-4. [DOI] [PubMed] [Google Scholar]
  46. Pacheco Otalora LF, Couoh J, Shigamoto R, Zarei MM, Garrido Sanabria ER. Abnormal mGluR2/3 expression in the perforant path termination zones and mossy fibers of chronically epileptic rats. Brain Res. 2006;1098:170–185. doi: 10.1016/j.brainres.2006.04.124. [DOI] [PubMed] [Google Scholar]
  47. Pacheco Otalora LF, Moffett JR, Garrido-Sanabria ER. Selective vulnerability of hippocampal NAAGergic neurons in experimental temporal lobe epilepsy. Brain Res. 2007;1144:219–230. doi: 10.1016/j.brainres.2007.01.112. [DOI] [PubMed] [Google Scholar]
  48. Pacheco Otalora LF, Hernandez EF, Arshadmansab MF, Francisco S, Willis M, Ermolinsky B, Zarei M, Knaus HG, Garrido-Sanabria ER. Down-regulation of BK channel expression in the pilocarpine model of temporal lobe epilepsy. Brain Res. 2008 doi: 10.1016/j.brainres.2008.01.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Petralia RS, Wang YX, Niedzielski AS, Wenthold RJ. The metabotropic glutamate receptors, mGluR2 and mGluR3, show unique postsynaptic, presynaptic and glial localizations. Neuroscience. 1996;71:949–976. doi: 10.1016/0306-4522(95)00533-1. [DOI] [PubMed] [Google Scholar]
  50. Racine RJ. Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalogr Clin Neurophysiol. 1972;32:281–294. doi: 10.1016/0013-4694(72)90177-0. [DOI] [PubMed] [Google Scholar]
  51. Richichi C, Brewster AL, Bender RA, Simeone TA, Zha Q, Yin HZ, Weiss JH, Baram TZ. Mechanisms of seizure-induced 'transcriptional channelopathy' of hyperpolarization-activated cyclic nucleotide gated (HCN) channels. Neurobiol Dis. 2008;29:297–305. doi: 10.1016/j.nbd.2007.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Salin PA, Scanziani M, Malenka RC, Nicoll RA. Distinct short-term plasticity at two excitatory synapses in the hippocampus. Proc Natl Acad Sci U S A. 1996;93:13304–13309. doi: 10.1073/pnas.93.23.13304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sanabria ER, Wozniak KM, Slusher BS, Keller A. GCP II (NAALADase) inhibition suppresses mossy fiber-CA3 synaptic neurotransmission by a presynaptic mechanism. J Neurophysiol. 2004;91:182–193. doi: 10.1152/jn.00465.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Santschi L, Reyes-Harde M, Stanton PK. Chemically induced, activity-independent LTD elicited by simultaneous activation of PKG and inhibition of PKA. J Neurophysiol. 1999;82:1577–1589. doi: 10.1152/jn.1999.82.3.1577. [DOI] [PubMed] [Google Scholar]
  55. Santschi LA, Stanton PK. A paired-pulse facilitation analysis of long-term synaptic depression at excitatory synapses in rat hippocampal CA1 and CA3 regions. Brain Res. 2003;962:78–91. doi: 10.1016/s0006-8993(02)03846-5. [DOI] [PubMed] [Google Scholar]
  56. Scanziani M, Salin PA, Vogt KE, Malenka RC, Nicoll RA. Use-dependent increases in glutamate concentration activate presynaptic metabotropic glutamate receptors. Nature. 1997a;385:630–634. doi: 10.1038/385630a0. [DOI] [PubMed] [Google Scholar]
  57. Scanziani M, Salin PA, Vogt KE, Malenka RC, Nicoll RA. Use-dependent increases in glutamate concentration activate presynaptic metabotropic glutamate receptors. Nature. 1997b;385:630–634. doi: 10.1038/385630a0. [DOI] [PubMed] [Google Scholar]
  58. Shigemoto R, Kinoshita A, Wada E, Nomura S, Ohishi H, Takada M, Flor PJ, Neki A, Abe T, Nakanishi S, Mizuno N. Differential presynaptic localization of metabotropic glutamate receptor subtypes in the rat hippocampus. J Neurosci. 1997;17:7503–7522. doi: 10.1523/JNEUROSCI.17-19-07503.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Stanton PK, Heinemann U, Muller W. FM1-43 imaging reveals cGMP-dependent long-term depression of presynaptic transmitter release. J Neurosci. 2001;21:RC167. doi: 10.1523/JNEUROSCI.21-19-j0002.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Tamaru Y, Nomura S, Mizuno N, Shigemoto R. Distribution of metabotropic glutamate receptor mGluR3 in the mouse CNS: differential location relative to pre- and postsynaptic sites. Neuroscience. 2001;106:481–503. doi: 10.1016/s0306-4522(01)00305-0. [DOI] [PubMed] [Google Scholar]
  61. Tanabe Y, Masu M, Ishii T, Shigemoto R, Nakanishi S. A family of metabotropic glutamate receptors. Neuron. 1992;8:169–179. doi: 10.1016/0896-6273(92)90118-w. [DOI] [PubMed] [Google Scholar]
  62. Tang FR, Chia SC, Chen PM, Gao H, Lee WL, Yeo TS, Burgunder JM, Probst A, Sim MK, Ling EA. Metabotropic glutamate receptor 2/3 in the hippocampus of patients with mesial temporal lobe epilepsy, and of rats and mice after pilocarpine-induced status epilepticus. Epilepsy Res. 2004;59:167–180. doi: 10.1016/j.eplepsyres.2004.04.002. [DOI] [PubMed] [Google Scholar]
  63. Thomas RJ. Excitatory amino acids in health and disease. J Am Geriatr Soc. 1995;43:1279–1289. doi: 10.1111/j.1532-5415.1995.tb07407.x. [DOI] [PubMed] [Google Scholar]
  64. Tizzano JP, Griffey KI, Schoepp DD. Receptor subtypes linked to metabotropic glutamate receptor agonist-mediated limbic seizures in mice. Ann N Y Acad Sci. 1995;765:230–235. doi: 10.1111/j.1749-6632.1995.tb16579.x. discussion 248. [DOI] [PubMed] [Google Scholar]
  65. Turski WA, Cavalheiro EA, Schwarz M, Czuczwar SJ, Kleinrok Z, Turski L. Limbic seizures produced by pilocarpine in rats: behavioural, electroencephalographic and neuropathological study. Behav Brain Res. 1983;9:315–335. doi: 10.1016/0166-4328(83)90136-5. [DOI] [PubMed] [Google Scholar]
  66. Turski WA, Cavalheiro EA, Bortolotto ZA, Mello LM, Schwarz M, Turski L. Seizures produced by pilocarpine in mice: a behavioral, electroencephalographic and morphological analysis. Brain Res. 1984;321:237–253. doi: 10.1016/0006-8993(84)90177-x. [DOI] [PubMed] [Google Scholar]
  67. Tzounopoulos T, Janz R, Sudhof TC, Nicoll RA, Malenka RC. A role for cAMP in long-term depression at hippocampal mossy fiber synapses. Neuron. 1998;21:837–845. doi: 10.1016/s0896-6273(00)80599-1. [DOI] [PubMed] [Google Scholar]
  68. Yokoi M, Kobayashi K, Manabe T, Takahashi T, Sakaguchi I, Katsuura G, Shigemoto R, Ohishi H, Nomura S, Nakamura K, Nakao K, Katsuki M, Nakanishi S. Impairment of hippocampal mossy fiber LTD in mice lacking mGluR2. Science. 1996;273:645–647. doi: 10.1126/science.273.5275.645. [DOI] [PubMed] [Google Scholar]

RESOURCES