Abstract
Sporulation of Saccharomyces cerevisiae is a developmental process in which four haploid spores are generated inside a diploid cell. Gip1, a sporulation-specific targeting subunit of protein phosphatase type 1, together with its catalytic subunit, Glc7, colocalizes with septins along the extending prospore membrane and is required for septin organization and spore wall formation. However, the mechanism by which Gip1-Glc7 phosphatase promotes these events is unclear. We show here that Ysw1, a sporulation-specific coiled-coil protein, has a functional relationship to Gip1-Glc7 phosphatase. Overexpression of YSW1 partially suppresses the sporulation defect of a temperature-sensitive allele of gip1. Ysw1 interacts with Gip1 in a two-hybrid assay, and this interaction is required for suppression. Ysw1 tagged with green fluorescent protein colocalizes with septins and Gip1 along the extending prospore membrane during spore formation. Sporulation is partially defective in ysw1Δ mutant, and cytological analysis revealed that septin structures are perturbed and prospore membrane extension is aberrant in ysw1Δ cells. These results suggest that Ysw1 functions with the Gip1-Glc7 phosphatase to promote proper septin organization and prospore membrane formation.
Diploid cells of Saccharomyces cerevisiae subjected to nitrogen limitation in the presence of a nonfermentable carbon source undergo the developmental process of sporulation (14, 23, 35). Four nuclei produced by two rounds of nuclear division, meiosis I and II, are encapsulated by newly formed double-membrane structures, called prospore membranes, and are finally packaged into spores covered with layered spore walls (35).
In this process, prospore membrane formation is one of the most dynamic events. Early in meiosis II, the cytoplasmic surface of the meiotic spindle pole body (SPB) is modified by the recruitment of sporulation-specific protein complex that acts as a site of vesicle recruitment (2, 22, 39). Post-Golgi secretory vesicles dock to the surface of the SPBs and fuse with each other, generating prospore membranes (33, 34). The prospore membranes then grow to engulf daughter nuclei through a series of stages that are categorized by the membranes' appearance in the fluorescence microscope (12). Initially, the membranes appear as small horseshoes that enlarge to become small round membrane structures. The prospore membranes then extend into a tube-like shape, engulfing the nucleus, as well as some cytosol and organelles (12). After this extension, prospore membrane undergoes a rapid change to a mature round form. This rounding of the membrane is coordinated with membrane closure (12). Spore wall materials are then deposited into the luminal space created by closure of the prospore membrane (9).
In addition to the meiotic plaque of the SPB, two protein complexes are associated with the prospore membrane as it forms. One is the leading edge protein complex, which exists at the lip of the prospore membranes and consists of three components: Ssp1, Ady3, and Don1 (27, 30, 38). Ssp1 is the most important of the three and is required for proper extension of the prospore membrane (30). The second complex is a sporulation-specific septin structure. The septins are a family of cytoskeletal proteins, which form filaments (18, 50). Septins are conserved from yeast to mammals. They were originally found and have been extensively studied in S. cerevisiae. In vegetatively growing S. cerevisiae cells, five septin proteins—Cdc3, Cdc10, Cdc11, Cdc12, and Shs1—form a ring at the bud neck that serves as a scaffold for many additional proteins, as well as a barrier to diffusion of proteins between the mother and the bud (19, 29, 50). In sporulating cells, the set of septin proteins is changed. Cdc3 and Cdc10, along with two sporulation-specific septins, Spr3 and Spr28, form a pair of parallel bars or sheets associated with each prospore membrane (11, 15, 29). Although deletion of sporulation-specific septins has only modest effects on sporulation (11, 15), their specific localization suggests that they have some function during prospore membrane formation. Septin organization in vegetatively growing cells is regulated by phosphorylation and dephosphorylation of septin components and septin-associated proteins (29). In sporulating cells, a sporulation-specific protein phosphatase type 1 (PP1) complex Gip1-Glc7 is required for the formation of septin structures (46), although whether this phosphatase acts directly on the septin proteins is unknown.
The PP1 catalytic subunit is highly conserved in eukaryotes and is involved in a variety of cellular processes (8, 44). In S. cerevisiae it is encoded by an essential gene, GLC7, and functions in glycogen synthesis, glucose repression, chromosome segregation, cell wall organization, endocytosis, mating, and sporulation (3, 17, 24, 42, 44, 47, 53). The specificity of this enzyme is determined by targeting subunits. GIP1 was originally isolated in a two-hybrid screen by using GLC7 as a bait, and this interaction was confirmed by coimmunoprecipitation of the two proteins (48). GIP1 is a sporulation-specific gene required for sporulation. Further analysis revealed that Gip1 and Glc7 colocalize with septins during sporulation and are required for both septin organization and spore wall formation (46). The specific targets or cofactors of this PP1 complex are unknown.
To elucidate the role of Gip1-Glc7 phosphatase, we screened for high-copy suppressors of a temperature-sensitive allele of gip1 and isolated YSW1. Ysw1 interacts with Gip1 and colocalizes with septins similar to Gip1. Furthermore, a ysw1Δ mutant displays aberrant septin structures and prospore membrane extension. These results suggest that Ysw1 may function with Gip1-Glc7 to regulate proper septin organization and prospore membrane formation.
MATERIALS AND METHODS
Strains and growth media.
Unless otherwise noted, standard media and genetic techniques were used (1, 20). The strains used in the present study are listed in Table 1. All strains are in the fast-sporulating SK-1 background except for AH109 (Clontech, Mountain View, CA) used for two-hybrid analysis. The primers used in the present study are listed in Table 2. To construct the YSW1-GFP haploid, NY19, HT21, and HT22 were used as primers to amplify the green fluorescent protein (GFP)-tagging cassette in pFA6a-yEGFP-HIS3MX6 (38), and the product was used to transform strain AN117-4B (36). The YSW1-HA haploid, NY21, was created in the same way using pFA6a-HA-His3MX6 (26) as a template. The SPR28-RFP diploid strain, TC522, was constructed by transformation of AN117-4B and AN117-16D (36) by a red fluorescent protein (RFP)-tagging cassette, amplified with oligonucleotides HT322 and HT323 from pFA6a-mRFP5-His3MX6 (40), followed by mating of resulting haploids. NY703 was constructed by PCR-mediated knockout of SPR28 in AN117-4B and AN117-16D using pFA6a-kanMX6 (26) as a template for PCR and oligonucleotides HT39 and HT40, and mating of the resulting haploids. Deletion of YSW1 in AN117-4B and AN117-16D was performed in the same way, using pFA6a-His3MX6 (26) as a template for PCR and oligonucleotides HT319 and HT22 to create TC7 and TC8. These strains were mated to create TC504. TC7 and TC8 were transformed with pRS304 (43) digested with Eco81I, pRS304-YSW1 digested with HindIII, and pRS304-YSW1*** digested with HindIII, followed by mating of the resulting haploids to generate TC551, TC552, and TC553, respectively. All deletions and fusions were confirmed by genomic PCR.
TABLE 1.
S. cerevisiae strains used in this study
| Strain | Genotype | Source or reference |
|---|---|---|
| AN117-4B | MATα ura3 leu2 trp1 his3ΔSK arg4-NspI lys2 ho::LYS2 rme1::LEU2 | 36 |
| AN117-16D | MATaura3 leu2 trp1 his3ΔSK lys2 ho::LYS2 | 36 |
| AN120 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG/trp1::hisG ura3/ura3 | 36 |
| NY501 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG/trp1::hisG ura3/ura3 gip1::HIS3/gip1::HIS3 | 46 |
| NY19 | MATα ura3 leu2 trp1 his3ΔSK arg4-NspI lys2 ho::LYS2 rme1::LEU2 YSW1-GFP::his5+ | This study |
| NY21 | MATα ura3 leu2 trp1 his3ΔSK arg4-NspI lys2 ho::LYS2 rme1::LEU2 YSW1-HA::his5+ | This study |
| NY528 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG/trp1::hisG ura3/ura3 spr3::his5+/spr3::his5+ | 46 |
| NY703 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG/trp1::hisG ura3/ura3 spr28::his5+/spr28::his5+ | This study |
| TC522 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG/trp1::hisG ura3/ura3 SPR28-RFP::his5+/SPR28-RFP::his5+ | This study |
| TC7 | MATα ura3 leu2 trp1 his3ΔSK arg4-NspI lys2 ho::LYS2 rme1::LEU2 ysw1::his5+ | This study |
| TC8 | MATaura3 leu2 trp1 his3ΔSK lys2 ho::LYS2 ysw1::his5+ | This study |
| TC504 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG/trp1::hisG ura3/ura3 ysw1::his5+/ysw1::his5+ | This study |
| TC551 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG::TRP1/trp1::hisG::TRP1 ura3/ura3 ysw1::his5+/ysw1::his5+ | This study |
| TC552 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG::TRP1-YSW1/trp1::hisG::TRP1-YSW1 ura3/ura3 ysw1::his5+/ysw1::his5+ | This study |
| TC553 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG::TRP1-ysw1***/trp1::hisG::TRP1-ysw1*** ura3/ura3 ysw1::his5+/ysw1::his5+ | This study |
| MIY101 | MATa/MATα ARG4/arg4-NspI his3ΔSK/his3ΔSK ho::LYS2/ho::LYS2 leu2/leu2 lys2/lys2 RME1/rme1::LEU2 trp1::hisG/trp1::hisG ura3/ura::URA3-gip1-7 gip1::HIS3/gip1::HIS3 | This study |
| AH109 | MATatrp1-901 leu2-3,112 ura3-52 his3-200 gal4Δ gal80 LYS2::GALUAS-GAL1TATA-HIS3 GAL2UAS-GAL2TATA-ADE2 URA3-MEL1UAS-MEL1TATA-lacZ MEL1 | Clontech |
TABLE 2.
Primers used in this study
| Name | Sequence (5′-3′) |
|---|---|
| HT21 | GTACAAAGTTGATAAAAGACAGCAAGAATGGCGCCTCCACCTTAACATCTCGGATCCCCGGGTTAATTAA |
| HT22 | AATAAACGAGTTTTTAAGCGATCTATAATATTTTTATTGAGTGATAGTTAGAATTCGAGCTCGTTTAAAC |
| HT32 | GAAGAACTCGAGCGAACAGATTAATTTACCTG |
| HT39 | CGATACAAAAAAAGAGCTACTATACGTACATAAAGTCAGTAAATAATCAACGGATCCCCGGGTTAATTAA |
| HT40 | AAATTTTATTTCATATGTATCTAACGCTAACAAGGCCGTATATTTATTTAGAATTCGAGCTCGTTTAAAC |
| HT66 | GAAGAATTCAGATCTATATTACCCTGTTATCC |
| HT66K | GAAGAAGGTACCAGATCTATATTACCCTGTTATCC |
| HT259 | AAGAGAAACGAGAAACAATG |
| HT306 | GAAGAACCGCGGTGATAGGCAAAAAATTGCACAG |
| HT315 | GAAGAACTCGAGTCAAAAAACATCCTCATCAAGC |
| HT319 | TATTGCACCGGTGTATTAACATATATAAGGATACGTACGAACATAACATCCGGATCCCCGGGTTAATTAA |
| HT322 | AGATTGATTTATTGGAGAAAATGTTGGCAGCTCCCCATCAAAATAAGGTCCGGATCCCCGGGTTAATTAA |
| HT323 | ATAGATTAAAAAAATTTTGCCTTATACTTTAGTGCACTTGAAAAAGCAATGAATTCGAGCTCGTTTAAAC |
| MAC1 | GAAGAAGGTACCCTGCTGACATAGAAAGTAGAAA |
| MAC6 | GAAGAACTCGAGCTGGCGTCTTAACAAGAGATTA |
| MAC7 | GAAGAATTCACCCAGGAAATGGCATTACTC |
| MAC15 | GAAGAAGGATCCATATGTCCAGCTTAGCCGATAC |
| MAC16 | GAAGAACTCGAGTTAAGATGTTAAGGTGGAGG |
| MAC18 | GAAGAAGGATCCAATTTTTGACATTACTGAAAAGC |
| MAC19 | GAAGAAGGATCCAAGACCACGTTATAGAAAGTATT |
| MAC20 | GAAGAACTCGAGCTGGTCGATAGTATATCTATT |
| MAC21 | GAAGAACTCGAGAGGACCCATATTGGATTTGGT |
| MAC22 | GAAGAACTCGAGGCTCAATTGGTCGAGCTCTTC |
| YSO155 | GAAGAAGGATCCATAAAAAGGAATATGAAAAAAG |
| YSO171 | AGCAGCCTCGAGTTTCAATGAGTTAATTTCCT |
| YSO177 | GAATGTTCTTGAAGGCCCTGCCAAAGCTGTGGCTCAGACACCAAACAC |
| YSO178 | GTGTTTGGTGTCTGAGCCACAGCTTTGGCAGGGCCTTCAAGAACATTC |
| YSO190 | TTCTTCCTCGAGCAGACCTTTATTCTTAGCGC |
| YSO191 | GAAGAAGGATCCATGGCATTTTAGAACTGAACGT |
| YSO319 | GAAGAACTCGAGGATGGAAACTATTTTGCAGCCAAAGGCTAGA |
Plasmids.
The plasmids used in the present study are listed in Table 3. To construct pRS306-GIP1, the GIP1 gene was amplified from genomic DNA of AN120 (36) with MAC1 and HT306 as primers and cloned into Asp718 and SacII sites of pRS306 (43). pRS306ΔPst was constructed by PstI digestion of pRS306, followed by self-ligation to delete part of URA3 coding sequence. To recover and sequence the gip1-7 allele, PstI digests of genomic DNA were first prepared from the gip1-7 mutant, MIY101. These digests were self-ligated and used to transform Escherichia coli DH5α to obtain an ampicillin-resistant clone, pRS306-gip1-7. pRS424-YSW1 and pRS304-YSW1 were constructed by cloning the BamHI-Asp718 fragment from one of the suppressor candidate clones into pRS424 (7) and pRS304. YBR147w was amplified by PCR using the same clone as a template and MAC6 and MAC7 as primers and cloned into pRS424 to generate pRS424-YBR147w. The YSW1-GFP fusion was amplified by PCR with NY19 genomic DNA as a template and HT32 and HT66 as primers. The fragment was cloned into XhoI and SmaI site of pRS314 (43) and pRS424 to create pRS314-YSW1-GFP and pRS424-YSW1-GFP, respectively. pRS304-YSW1*** was generated by using a site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the primers YSO177 and YSO178. A BamHI-Asp718 fragment from pRS304-YSW1*** was cloned into pRS424 to create pRS424-YSW1***. The 3′ region of YSW1-HA was amplified by PCR using HT259 and HT66K as primers and NY21 genomic DNA as a template. The amplified DNA was digested with ApaI and KpnI, and ligated to pRS424-YSW1 and pRS424-YSW1*** digested with the same enzymes to create pRS424-YSW1-HA and pRS424-YSW1***-HA.
TABLE 3.
Plasmids used in this study
| Plasmid | Description | Source or reference |
|---|---|---|
| pRS304 | Integration vector | 43 |
| pRS306 | Integration vector | 43 |
| pRS314 | Low-copy vector | 43 |
| pRS424 | Multicopy vector | 7 |
| pRS306-GIP1 | GIP1 | This study |
| pRS306ΔPst | pRS306 with a part of URA3 deleted | This study |
| pRS306-gip1-7 | gip1-7 | This study |
| pRS424-YSW1 | YSW1 | This study |
| pRS304-YSW1 | YSW1 | This study |
| pRS424-YBR147w | YBR147w | This study |
| pRS424-YSW1-GFP | YSW1-GFP | This study |
| pRS314-YSW1-GFP | YSW1-GFP | This study |
| pRS304-YSW1*** | ysw1*** | This study |
| pRS424-YSW1-HA | YSW1-HA | This study |
| pRS424-YSW1***-HA | ysw1***-HA | This study |
| pGBD-GIP1 | GIP1 | This study |
| pGAD-YSW1 series | See Fig. 4 | This study |
| pSB5 | HA-GIP1 | 46 |
| pSB6 | HA-GIP1 | 46 |
| pSB7 | SPR28-GFP | 46 |
| 424-G20 | GFP-SPO2051-91 | 32 |
The constructs used for two-hybrid analysis were made as follows. YSW1 residues were amplified from genomic DNA of AN120 for wild-type YSW1, or pRS304-YSW1*** for ysw1***, by using following pairs of oligonucleotides; MAC15 and MAC16 (YSW11-609 or YSW1***1-609), MAC15 and YSO190 (YSW11-200), YSO155 and MAC21 (YSW1201-400 or YSW1***201-400), YSO191 and MAC16 (YSW1401-609), MAC19 and MAC21 (YSW1298-400), YSO155 and YSO171 (YSW1201-350), YSO155 and MAC22 (YSW1201-297), MAC18 and MAC16 (YSW1474-609), and YSO191 and MAC20 (YSW1401-473). All of the PCR products were digested with BamHI and XhoI and cloned into BamHI-XhoI-digested pGAD-T7 (Clontech). To generate pGBD-GIP1, the GIP1 open reading frame was amplified from genomic DNA of AN120 with the primers YS319 and HT315 and cloned into XhoI site of pGBK-T7 (Clontech), which was digested with NcoI, filled in, and self-ligated to place the fusion in-frame.
Screening for temperature-sensitive sporulation-defective mutants.
A GIP1 mutation library was constructed as follows. Error-prone PCR (6) was performed to amplify a DNA fragment containing GIP1 and a part of URA3 using pRS306-GIP1 as a template and MAC1 and MAC2 as primers. The fragment was digested with Asp718 and PstI and ligated to pRS306ΔPst pretreated with the same enzymes. The resulting GIP1 mutation library was digested with PstI and used to transform NY501. Colonies were patched and subjected to sporulation at 22 and 30°C. Cells were replica plated onto yeast extract-peptone-dextrose (YPD) plates and exposed to ether vapor for 20 min by inversion over an ether-soaked paper filter. After incubation at 30°C for 1 day, colonies that sporulated on plates incubated at 22°C, but not those incubated at 30°C, were selected as candidates. One of them, which showed no survival when sporulated at 30°C, was named gip1-7.
Multicopy suppressor screening.
The gip1-7 cells were transformed with a DNA library constructed in the pTV3 vector (20) with genomic DNA from NY501 (46). Colonies on each plate were collected in bulk by scraping of the plate, sporulated at 34°C, and subjected to ethanol treatment. For this treatment, ∼106 cells from each plate were incubated in 540 μl of 28% ethanol for 40 min, and plated on synthetic dextrose minimal (SD) plates. Colonies formed on each plate were collected, and plasmids were isolated. These plasmids were used to transform the gip1-7 cells and subjected to another round of sporulation and ethanol treatment. Plasmids were isolated from each of the surviving colonies, and suppression of gip1-7 was confirmed by retransformation and sporulation, followed by observation under microscope.
Sporulation assays.
Cells were sporulated in liquid medium as described previously (34). Briefly, strains were grown at 30°C overnight in YPD or in SD medium when required. Cells were then precultured at 30°C overnight in yeast extract-peptone-acetate (YPA) medium. Cells were collected and resuspended in sporulation medium (2% potassium acetate) at an optical density of 1.5 at 600 nm, and these cultures were incubated at 30°C. For spore number analysis, more than 200 cells were counted.
Two-hybrid analysis.
Two-hybrid analysis was performed as described by the manufacturers (Clontech). AH109 was transformed with pGBD-GIP1 and pGAD-YSW1 fusions. Transformants were grown overnight on SD medium without tryptophan and leucine, and 10-fold dilutions were spotted onto SD plates without tryptophan, leucine, adenine, and histidine.
Immunoblotting.
For the Western blot analysis of Ysw1-HA, cells were induced for sporulation for 7.5 h, and total protein was prepared by using glass beads as described previously (1). Proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by Western blotting with anti-HA antibody (12CA5). Bands were visualized by horseradish peroxidase-conjugated goat anti-mouse immunoglobulin G antibody (Biosource International, Camarillo, CA).
Microscopy.
Differential interference contrast (DIC) images were obtained by using a BX70 microscope and DP Controller soft ware (Olympus, Tokyo, Japan). Fluorescence and immunofluorescence microscopy was performed as described previously (46) using a BX70 or a Zeiss Axioplan2 microscope (Carl Zeiss, Thornwood, NY) with a Zeiss mRM Axiocam and processed using Zeiss Axiovision 4.7 software. Cells were fixed with 3.7% formaldehyde when required. Chromatin was stained with DAPI (4′,6′-diamidino-2-phenylindole). Time-lapse imaging was done as follows. Sporulation medium containing 1.5% Agarose-S was dropped on the glass surface of a glass-bottom dish. Solidified medium was removed from the dish, and cells were spotted onto a flat surface of the medium and put again on a dish to sandwich cells between the glass and the medium. Images were captured on a Zeiss Axiovert 100 microscope at 2-min intervals using IPLab 3.6.5a software (Scanalytics, Rockville, MD). Temperature was held at 28°C during image collection. Deconvolution was performed using an EPR system (Scanalytics) and 3D stacks using IPLab 3.6.5a.
RESULTS
Isolation of a temperature-sensitive gip1 mutant.
Gip1 is a sporulation-specific targeting subunit of Glc7, the yeast PP1 catalytic subunit, and is required for sporulation (46). However, targets and cofactors of this Gip1-Glc7 phosphatase complex are not known. To isolate genes that have a functional relationship to GIP1, we took a genetic approach. Temperature-sensitive sporulation-defective mutants of gip1 were isolated by introduction of randomly mutagenized GIP1 gene into the gip1 deletion mutant, followed by screening of transformants for those that formed ether-resistant spores at 22°C and not at 30°C. Of 1,000 colonies tested, four colonies showed temperature sensitivity. Among those, gip1-7 showed a complete sporulation defect at 30°C (Fig. 1A and B), which was ideal for suppressor screening. The gip1-7 cells subjected to sporulation at 22°C sporulated well, although the asci formed are predominantly monads and dyads (Fig. 1A and B). In contrast, at 30°C, the gip1-7 cells were indistinguishable to those in gip1Δ cells (Fig. 1A). In addition, spores formed at 22°C were aberrant in their shape; oval or football-like spores were observed (Fig. 1A). DNA sequence analysis of gip1-7 revealed that it has three mutations that affect the amino acid sequence of the encoded protein (K399R, D481G, and L500P). The interaction of gip1-7 with GLC7 was assessed by two-hybrid analysis and was comparable to that of wild-type GIP1 (data not shown).
FIG. 1.
Temperature-sensitive sporulation defect of the gip1-7 mutant and partial suppression of it by YSW1. (A) MIY101 (gip1-7) was sporulated at 22 and 30°C and analyzed by DIC microscopy (lower panels). As controls, AN120 (wild-type) and NY501 (gip1Δ) sporulated at 30°C are shown (upper panels). (B) The number of spores in asci of MIY101 (gip1-7) and AN120 (wild-type) sporulated at 22 and 30°C were counted. (C) MIY101 (gip1-7) harboring pRS424-YSW1 (lower panel), or pRS424 (upper panel) as a control, was sporulated at 30°C and analyzed by DIC microscopy. (D) MIY101 (gip1-7) carrying pRS424, pRS424-YBR147w, pRS424-YSW1, and pRS424-YSW1-GFP, respectively, were sporulated. The distribution of ascal types is shown. Bars in panels A and C, 5 μm.
Isolation of YSW1 as a multicopy suppressor of a temperature-sensitive gip1 mutant.
A screen was performed to isolate multicopy suppressor genes of the gip1-7 temperature-sensitive sporulation defect. The gip1-7 strain was transformed with a genomic library constructed using gip1Δ genomic DNA, sporulated at 34°C, and clones that formed ethanol-resistant spores were isolated. A total of 2 × 104 colonies were subjected to screening and four plasmids were isolated as multicopy suppressors. All four plasmids contained a genomic region, which encompasses YBR147w and YSW1 (YBR148w). Therefore, YBR147w and YSW1 were cloned separately into multicopy vectors, introduced into the gip1-7 mutant, and sporulation was examined at restrictive temperature. YSW1, not YBR147w, restored sporulation, although sporulation efficiency was low and the asci formed were mostly monads and dyads (Fig. 1C and D). Expression of Ysw1 from low copy vector suppressed gip1-7 at a level comparative to that of Ysw1 expression from multicopy plasmid (data not shown). Suppression was not observed when YSW1 was introduced into gip1Δ cells (data not shown). These results indicate that overexpression of YSW1 partially suppresses the temperature-sensitive sporulation-defective phenotype of the gip1-7 mutant and that YSW1 has a genetic interaction with GIP1.
A conserved region of Ysw1 is required for interaction with Gip1 and suppression of gip1-7.
YSW1 encodes a predicted protein of 609 amino acids (aa) that contains two coiled-coil domains. It was originally isolated in a large-scale analysis of gene expression and protein localization as a protein induced during meiosis and sporulation (4). A truncated form of Ysw1 fused to lacZ localized to the prospore membrane. The genetic interaction between YSW1 and GIP1 led us to examine whether Ysw1 can physically interact with Gip1. A two-hybrid analysis was performed, and Ysw1 was found to interact with Gip1 (Fig. 2A). To identify the region of Ysw1 involved in the interaction with Gip1, we constructed deletion series of Ysw1 and tested for interaction with full-length Gip1. Surprisingly, we found that two separate regions of Ysw1 interact with Gip1 (Fig. 2A). The first region includes aa 201 to 297, and the second region spans aa 401 to 473, which encompasses the second coiled-coil domain of Ysw1.
FIG. 2.
Ysw1 interacts with Gip1 and a conserved region of Ysw1 is important for this interaction. (A) Ysw1 residues and Ysw1*** tested for two-hybrid analysis with GBD-Gip1 are indicated at the left. The various pGAD-YSW1 plasmids were introduced into AH109 with pGBD-GIP1 and strains were assayed for growth by plating 10-fold dilutions on SD His−, Ade−, Trp−, Leu− plates. (B) Multiple alignment of conserved region in Ysw1 is shown. (C) Distribution of ascal types in MIY101 (gip1-7) harboring pRS424 or pRS424-YSW1-HA or pRS424-YSW1***-HA, respectively, is shown. (D) A Western blot analysis of strains in panel C sporulated for 7.5 h was performed with anti-HA antibody.
Comparative genomic studies have revealed that a whole-genome duplication occurred in the evolution of hemiascomycetes, S. cerevisiae being one of the postduplication species (52). Duplicated genes are referred to as ohnologs. It is reported that YSW1 is the ohnolog of SPO21, which encodes a meiosis-specific component of the SPB, although they have only 13% identity and do not hit each other in the basic local alignment tool for protein sequences (BLASTP) (51). Based on this report, we compared the YSW1 sequence with the SPO21/YSW1 genes of preduplication yeast species and found a small region (aa 230 to 240) of Ysw1, amino terminal to the first coiled-coil domain, that is conserved at the analogous position in the Spo21/Ysw1 orthologs of Kluyveromyces lactis, Ashbya gossypii, and Kluyveromyces waltii (Fig. 2B). This region is not conserved in S. cerevisiae Spo21. The motif resides in the first Gip1-interacting region of Ysw1 defined in our deletion studies. Therefore, to examine whether the motif was important for the interaction, we introduced the three point mutations Y233A, F235A, and F237A into conserved residues of Ysw1 (hereafter referred to as Ysw1***; Fig. 2A). Neither the full-length Ysw1*** nor aa 201 to 400 of Ysw1*** alone interacted with Gip1 in two-hybrid assay, indicating the importance of this conserved motif for binding of Ysw1 to Gip1. To examine whether Ysw1*** is functional or not, we expressed Ysw1***-HA in the gip1-7 mutant. The gip1-7 cells expressing Ysw1-HA sporulated to ca. 20% at a nonpermissive temperature (Fig. 2C). However, at 30°C the gip1-7 cells expressing Ysw1***-HA were completely defective in sporulation, as was the case with gip1-7 cells harboring vector alone (Fig. 2C). A Western blot with anti-HA antibody confirmed that Ysw1***-HA is expressed at a level similar to that of Ysw1-HA during sporulation (Fig. 2D). These results strongly indicate that interaction of Ysw1 with Gip1 through this conserved region is required for suppression of gip1-7 by YSW1.
Ysw1 colocalizes with septins and Gip1 along the extending prospore membrane.
To investigate the localization of full-length Ysw1 protein during sporulation, we tagged the Ysw1 protein with GFP at its C terminus and examined the protein by fluorescence microscopy. Ysw1-GFP was at least partially functional, because overexpression of YSW1-GFP allowed the gip1-7 strain to sporulate at only a slightly lower level compared to the same strain overexpressing YSW1 (Fig. 1D). Ysw1-GFP was seen as four small rings or four pairs of short bars around the nucleus in early meiosis II, and four pairs of long bars along prospore membrane in late meiosis II (Fig. 3A). The Ysw1-GFP signal disappeared in postmeiotic cells, and no specific localization pattern was observed (data not shown). The localization pattern of Ysw1-GFP during meiosis II was similar to that reported for septins and Gip1 (46), although the absence of Ysw1 in postmeiotic cells was quite different from the spore periphery pattern seen for septins and Gip1 at this later stage (15, 46).
FIG. 3.
Ysw1 colocalizes with septins and Gip1 during sporulation. (A) AN120 (wild-type) harboring pRS314-YSW1-GFP was sporulated for 7.5 h and analyzed by fluorescence microscopy. Nuclei were visualized with DAPI. (B) TC522 (SPR28-RFP) harboring pRS314-YSW1-GFP was sporulated and analyzed. (C) AN120 (wild-type) carrying pRS314-YSW1-GFP and pSB6 (HA-GIP1) was sporulated and analyzed by immunofluorescence with anti-HA antibody. (D) pRS314-YSW1-GFP was introduced into AN120 (wild-type), NY528 (spr3Δ), and NY703 (spr28Δ), and the resulting strains were sporulated and analyzed. Scale bars, 5 μm.
To confirm that Ysw1 colocalizes with septins and Gip1 in meiosis II, a YSW1-GFP plasmid was introduced into strains expressing Spr28-RFP and HA-Gip1, respectively. Colocalization of Ysw1-GFP with Spr28-RFP and HA-Gip1 was observed in meiosis II cells (Fig. 3B and C). These results suggest that Ysw1, Gip1, and Glc7 colocalize on septin structure along the extending prospore membranes.
Given that septins form filaments and function as a scaffold for many proteins at the bud neck in vegetatively growing cells, we reasoned that the Ysw1 localization pattern would be septin dependent. Therefore, we analyzed Ysw1-GFP localization in septin mutants. Deletion of either of the sporulation-specific septins SPR3 or SPR28 disrupts the organization of the remaining septin proteins (41). Loss of SPR28 causes the remaining septins to localize uniformly around the prospore membrane rather than in bars, while the loss of SPR3 leads to a failure of the remaining septins to associate with the prospore membrane at all. In the case of Ysw1-GFP, deletion of either SPR3 or SPR28 caused the same phenotype, an even distribution around the prospore membrane rather than a bar-like pattern (Fig. 3D). These observations indicate that localization of Ysw1 into bars, although not its association with the prospore membrane, is septin dependent.
Septins structures are aberrant in the ysw1Δ mutant.
To examine the role of Ysw1 during sporulation, a ysw1Δ mutant was constructed and analyzed for sporulation. As reported in genomewide analysis (28), the ysw1Δ mutant asci had a reduced number of spores, and many dyads and triads were observed (Fig. 4A and B) . Using DAPI staining, the meiotic progression of the ysw1Δ mutant was monitored and found to be wild type (data not shown). These observations suggest that Ysw1 functions in spore formation rather than in meiosis. Expression of Ysw1*** did not rescue the sporulation defect of the ysw1Δ mutant (Fig. 4B), suggesting that interaction between Ysw1 and Gip1 is required for the function of Ysw1.
FIG. 4.
Sporulation is aberrant in the ysw1Δ mutant. (A) TC504 (ysw1Δ) was sporulated and analyzed by DIC microscopy. (B) AN120 (wild-type), TC551 (ysw1Δ pRS304), TC552 (ysw1Δ, pRS304-YSW1), and TC553 (ysw1Δ, pRS304-ysw1***) were sporulated, and the distribution of the spore number is represented. (C) AN120 (wild-type) and TC504 (ysw1Δ) harboring pSB7 (SPR28-GFP) were analyzed by fluorescence microscopy. (D) AN120 (wild-type) and TC504 (ysw1Δ) harboring pSB5 (HA-GIP1) were analyzed by immunofluorescence with anti-HA antibody. Arrowheads in panels C and D indicate cells showing aberrant pattern. Scale bars (A, C, and D), 5 μm.
The involvement of Ysw1 in spore formation, together with its relationship to septins and Gip1, prompted us to examine the localization of septins and Gip1 in the ysw1Δ mutant. Spr28-GFP and HA-Gip1 were expressed in the mutant, and their localization during sporulation was determined by fluorescence microscopy. Septin structures were formed during sporulation in the ysw1Δ mutant (Fig. 4C). Both bars in meiosis II cells and distribution of proteins around the spore periphery in postmeiotic cells were observed. However, the bars in the ysw1Δ cells were abnormal and appeared excessively bent or twisted. A similar localization defect of Gip1 was observed in ysw1Δ cells (Fig. 4D), indicating that HA-Gip1 can localize to the septin structure in the ysw1Δ cells. These results suggest that Ysw1 is required for proper septin organization.
Ysw1 is required for proper prospore membrane formation.
The bar-like structures containing Gip1, Ysw1, and septins form along the prospore membrane (15, 46). Therefore, we examined whether prospore membranes are properly formed in the ysw1Δ mutant. A fragment of the Spo20 protein fused to GFP (32) was used to visualize prospore membranes. In wild-type cells, as the cells go through meiosis II, prospore membranes progressively display horseshoe-like, tubular, and round morphologies (12) (Fig. 5A). In addition, all four prospore membranes forming within a wild-type cell appear to grow at similar rates. In the ysw1Δ cells, prospore membranes were also formed but appeared somewhat uncoordinated in their size (Fig. 5A). Strikingly, counting of prospore membranes in early- and post-meiosis II cells revealed that number of mature round prospore membrane per ascus was reduced, about half of the asci contained only two prospore membranes (Fig. 5B). This correlated well with distribution of spore number in mature asci. Very small prospore membranes and/or remnants of them were frequently observed in the ysw1Δ asci. These results suggest that the ysw1Δ cells are defective in prospore membrane growth.
FIG. 5.
Prospore membrane growth is defective in ysw1Δ mutant. (A) AN120 (wild-type) and TC504 (ysw1Δ) were transformed with 424-G20 (GFP-SPO2051-91), and prospore membranes were visualized during sporulation. (B) The numbers of small prospore membranes per cell (left) and mature prospore membranes per cell (middle) or spores per ascus (right) were counted. These categories correspond to cells in early meiosis II, late meiosis II, and postmeiosis, respectively. (C) AN120 (wild-type) and TC504 (ysw1Δ) carrying 424-G20 (GFP-SPO2051-91) were sporulated and analyzed by time-lapse fluorescence microscopy. Each image is a projection through a deconvolved image stack. The numbers indicate the time elapsed, in minutes. Scale bars (A and C), 5 μm.
To further analyze the defect of ysw1Δ cells in prospore membrane formation, we performed time-lapse imaging. In wild-type cells, the extension of the four prospore membranes appeared coordinated (Fig. 5C and see Movie S1 in the supplemental material). In contrast, prospore membrane extension was slower and looked less coordinated in ysw1Δ cells (Fig. 5C and see Movies S2 to S5 in the supplemental material). Fewer than four prospore membranes extended in many asci, with the remaining prospore membranes stopped at the small round phase or earlier. These results indicate that Ysw1 is required for proper prospore membrane growth.
DISCUSSION
In Saccharomyces cerevisiae, the sporulation-specific PP1 complex Gip1-Glc7 is essential for sporulation (46). However, its cofactors or downstream targets are unknown. In the present study, we identified Ysw1 as a new factor that functions with Gip1-Glc7 during sporulation. Ysw1 genetically and physically interacts with Gip1 and colocalizes with Gip1 and septins during meiosis II. Deletion of the YSW1 gene affects septin organization and prospore membrane formation. Thus, Ysw1 may work with the Gip1-Glc7 phosphatase to control proper septin assembly and prospore membrane growth.
Overexpression of YSW1 partially suppressed gip1-7, but not gip1Δ, indicating that Ysw1 requires partially functional Gip1 for suppression. Taken together with the physical interaction of Ysw1 with Gip1 and the requirement of this interaction for suppression, Ysw1 does not substitute for, but may function in the same pathway as, Gip1. Because the sporulation defect of ysw1Δ is not as severe as that of gip1Δ, we favor the idea that Ysw1 is a cofactor of Gip1-Glc7. Western blot analysis of Ysw1-HA expressed in wild-type and the gip1Δ mutant cells showed no obvious mobility difference (data not shown), although we cannot rule out the possibility that Ysw1 is also a target of the Gip1-Glc7 phosphatase.
Ysw1 localizes with septins along the extending prospore membrane in wild-type cells, but it localizes evenly on the prospore membrane in both spr3Δ and spr28Δ cells, indicating that Ysw1 can localize to the prospore membrane in the absence of septin structures. Because Spr3 is required for the association of other septins with the prospore membrane (41), we suggest that Ysw1 localization to prospore membrane is not dependent on interaction with septins but rather with Gip1 or some other protein(s) on prospore membrane.
Septins form hetero-oligomeric complexes and filaments are formed by polymerization of the complexes (29, 50). In vegetatively growing cells, they are organized into higher-order structures that appear as patches, collars, or rings coordinated with cell cycle (16). Septin subunits in these cells are phosphorylated and dephosphorylated coordinated with cell cycle, so it is likely that this phosphorylation and dephosphorylation is involved in the regulation of septin organization. Septin-associated kinases and phosphatases are responsible for the modification of septin subunits (13, 21, 25, 31, 49). In sporulating cells, the formation of the sporulation-specific structure of septins requires Gip1-Glc7 phosphatase (46), suggesting the existence of similar regulatory mechanisms. In the ysw1Δ mutant, septin structures are perturbed during prospore membrane formation. Considering that Ysw1 interacts with Gip1-Glc7 phosphatase, it is possible that the absence of Ysw1 may cause subtle changes in Gip1-Glc7 phosphatase localization or activity that may, in turn, affect septin organization. The Gip1-Glc7 phosphatase may dephosphorylate septins and/or septin-associated proteins, and Ysw1 may help regulate septin organization through interaction with Gip1. Further analysis of the organization and modification of septins during sporulation is required to elucidate the mechanism by which Gip1-Glc7 and Ysw1 function.
In addition to the defect in septin organization, the ysw1Δ mutant displays defects in prospore membrane extension, indicating that Ysw1 is involved in proper prospore membrane growth. Our recent analysis of the gip1Δ mutant revealed that prospore membranes formed in this mutant are smaller than those in wild-type cells (I. Inoue and H. Tachikawa, unpublished observations). Thus, Ysw1 may function in proper prospore membrane formation through interaction with Gip1.
There are many reports of sporulation-defective mutants that form predominantly dyads. Most of these mutants have defects in SPB modification or stability, leading to the generation of less than four prospore membranes (2, 10, 22, 37, 39). The ady3Δ mutant defines a different class in which there is a defect in spore wall formation but no defect in prospore membrane formation (38, 45). The ysw1Δ mutant also forms dyads; however, it cannot be placed in either of these classes. It initially forms four prospore membranes, but coordination of the extension is defective, resulting in the formation of fewer than four mature prospore membranes and mature spores. Thus, the ysw1Δ mutant represents a new type of dyad-forming mutant that has defects in coordinated prospore membrane extension.
Ysw1 and a meiosis-specific component of the SPB, Spo21, are ohnologs, that is, a paralogous S. cerevisiae gene pair formed by gene duplication (51). It is noteworthy that Ady3, which is a component of leading edge complex is also the ohnolog of Cnm67, another component of SPB (5). Therefore, it is tempting to speculate that genome duplication in ascomycetes may have produced prospore membrane-associated proteins from SPB components. Spo21 interacts with Cnm67 (30); thus, from evolutionary point of view, it would be interesting to test whether Ysw1 interacts with Ady3.
Glc7, Gip1, septins, and Ysw1 colocalize in bars during prospore membrane extension. After closure, however, the proteins appear to dissociate. While septins and Gip1 remain at the spore periphery, Glc7 relocalizes to the nucleus and Ysw1 disappears (15, 46). Closure of the prospore membrane is coordinated with the end of meiosis by the anaphase-promoting complex-dependent removal of the leading edge component Ssp1 (12). The disappearance of Ysw1 also appears to correlate well with the time of prospore membrane closure. It may be that Ysw1 is also a target of anaphase-promoting complex-mediated removal or degradation at the end of meiosis II, and the turnover of Ysw1 may contribute to the dissociation of the septin structures after cytokinesis.
Supplementary Material
Acknowledgments
We thank Takehiko Yoko-o (National Institute of Advanced Industrial Science and Technology) and Junichi Nikawa (Kyushu Institute of Technology) for plasmids.
This study was supported in part by a grant from Elizabeth Arnold Fuji Foundation to H.T. and NIH grant GM72540 to A.M.N.
Footnotes
Published ahead of print on 22 May 2009.
Supplemental material for this article may be found at http://ec.asm.org/.
REFERENCES
- 1.Adams, A. E., D. E. Gottschling, C. A. Kaiser, and T. Stearns. 1997. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 2.Bajgier, B. K., M. Malzone, M. Nickas, and A. M. Neiman. 2001. SPO21 is required for meiosis-specific modification of the spindle pole body in yeast. Mol. Biol. Cell 121611-1621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bharucha, J. P., J. R. Larson, J. B. Konopka, and K. Tatchell. 2008. Saccharomyces cerevisiae Afr1 protein is a protein phosphatase 1/Glc7-targeting subunit that regulates the septin cytoskeleton during mating. Eukaryot. Cell 71246-1255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Burns, N., B. Grimwade, P. B. Ross-Macdonald, E. Y. Choi, K. Finberg, G. S. Roeder, and M. Snyder. 1994. Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae. Genes Dev. 81087-1105. [DOI] [PubMed] [Google Scholar]
- 5.Byrne, K. P., and K. H. Wolfe. 2005. The yeast gene order browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res. 151456-1461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Cadwell, R. C., and G. F. Joyce. 1992. Randomization of genes by PCR mutagenesis. PCR Methods Appl. 228-33. [DOI] [PubMed] [Google Scholar]
- 7.Christianson, T. W., R. S. Sikorski, M. Dante, J. H. Shero, and P. Hieter. 1992. Multifunctional yeast high-copy-number shuttle vectors. Gene 110119-122. [DOI] [PubMed] [Google Scholar]
- 8.Cohen, P. T. 2002. Protein phosphatase 1: targeted in many directions. J. Cell Sci. 115241-256. [DOI] [PubMed] [Google Scholar]
- 9.Coluccio, A., E. Bogengruber, M. N. Conrad, M. E. Dresser, P. Briza, and A. M. Neiman. 2004. Morphogenetic pathway of spore wall assembly in Saccharomyces cerevisiae. Eukaryot. Cell 31464-1475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Deng, C., and W. S. Saunders. 2001. ADY1, a novel gene required for prospore membrane formation at selected spindle poles in Saccharomyces cerevisiae. Mol. Biol. Cell 122646-2659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.De Virgilio, C., D. J. DeMarini, and J. R. Pringle. 1996. SPR28, a sixth member of the septin gene family in Saccharomyces cerevisiae that is expressed specifically in sporulating cells. Microbiology 142(Pt. 10)2897-2905. [DOI] [PubMed] [Google Scholar]
- 12.Diamond, A. E., J. S. Park, I. Inoue, H. Tachikawa, and A. M. Neiman. 2009. The anaphase promoting complex targeting subunit Ama1 links meiotic exit to cytokinesis during sporulation in Saccharomyces cerevisiae. Mol. Biol. Cell 20134-145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Dobbelaere, J., M. S. Gentry, R. L. Hallberg, and Y. Barral. 2003. Phosphorylation-dependent regulation of septin dynamics during the cell cycle. Dev. Cell 4345-357. [DOI] [PubMed] [Google Scholar]
- 14.Esposito, R. E., and S. Klapholz. 1981. Meiosis and ascospore development, p. 211-287. In J. N. Strathern, E. W. Jones, and J. R. Broach (ed.), The molecular biology of the yeast Saccharomyces: life cycle and inheritance. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 15.Fares, H., L. Goetsch, and J. R. Pringle. 1996. Identification of a developmentally regulated septin and involvement of the septins in spore formation in Saccharomyces cerevisiae. J. Cell Biol. 132399-411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Finger, F. P. 2005. Reining in cytokinesis with a septin corral. Bioessays 275-8. [DOI] [PubMed] [Google Scholar]
- 17.Francisco, L., W. Wang, and C. S. Chan. 1994. Type 1 protein phosphatase acts in opposition to IpL1 protein kinase in regulating yeast chromosome segregation. Mol. Cell. Biol. 144731-4740. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Frazier, J. A., M. L. Wong, M. S. Longtine, J. R. Pringle, M. Mann, T. J. Mitchison, and C. Field. 1998. Polymerization of purified yeast septins: evidence that organized filament arrays may not be required for septin function. J. Cell Biol. 143737-749. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Gladfelter, A. S., J. R. Pringle, and D. J. Lew. 2001. The septin cortex at the yeast mother-bud neck. Curr. Opin. Microbiol. 4681-689. [DOI] [PubMed] [Google Scholar]
- 20.Guthire, C., and G. R. Fink. 1991. Guide to yeast genetics and molecular biology. Methods Enzymol. 1941-270. [PubMed] [Google Scholar]
- 21.Kadota, J., T. Yamamoto, S. Yoshiuchi, E. Bi, and K. Tanaka. 2004. Septin ring assembly requires concerted action of polarisome components, a PAK kinase Cla4p, and the actin cytoskeleton in Saccharomyces cerevisiae. Mol. Biol. Cell 155329-5345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Knop, M., and K. Strasser. 2000. Role of the spindle pole body of yeast in mediating assembly of the prospore membrane during meiosis. EMBO J. 193657-3667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kupiec, M., B. Byers, R. E. Esposito, and A. P. Mitchell. 1997. Meiosis and sporulation in Saccharomyces cerevisiae, p. 889-1036. In J. R. Pringle, J. R. Broach, and E. W. Jones (ed.), The molecular and cellular biology of the yeast Saccharomyces, vol. 3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
- 24.Larson, J. R., J. P. Bharucha, S. Ceaser, J. Salamon, C. J. Richardson, S. M. Rivera, and K. Tatchell. 2008. Protein phosphatase type 1 directs chitin synthesis at the bud neck in Saccharomyces cerevisiae. Mol. Biol. Cell 193040-3051. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Longtine, M. S., H. Fares, and J. R. Pringle. 1998. Role of the yeast Gin4p protein kinase in septin assembly and the relationship between septin assembly and septin function. J. Cell Biol. 143719-736. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Longtine, M. S., A. McKenzie III, D. J. Demarini, N. G. Shah, A. Wach, A. Brachat, P. Philippsen, and J. R. Pringle. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14953-961. [DOI] [PubMed] [Google Scholar]
- 27.Maier, P., N. Rathfelder, M. G. Finkbeiner, C. Taxis, M. Mazza, S. Le Panse, R. Haguenauer-Tsapis, and M. Knop. 2007. Cytokinesis in yeast meiosis depends on the regulated removal of Ssp1p from the prospore membrane. EMBO J. 261843-1852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Marston, A. L., W. H. Tham, H. Shah, and A. Amon. 2004. A genome-wide screen identifies genes required for centromeric cohesion. Science 3031367-1370. [DOI] [PubMed] [Google Scholar]
- 29.McMurray, M. A., and J. Thorner. 2009. Reuse, replace, recycle. Specificity in subunit inheritance and assembly of higher-order septin structures during mitotic and meiotic division in budding yeast. Cell Cycle 8195-203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Moreno-Borchart, A. C., K. Strasser, M. G. Finkbeiner, A. Shevchenko, A. Shevchenko, and M. Knop. 2001. Prospore membrane formation linked to the leading edge protein (LEP) coat assembly. EMBO J. 206946-6957. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Mortensen, E. M., H. McDonald, J. Yates III, and D. R. Kellogg. 2002. Cell cycle-dependent assembly of a Gin4-septin complex. Mol. Biol. Cell 132091-2105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Nakanishi, H., P. de los Santos, and A. M. Neiman. 2004. Positive and negative regulation of a SNARE protein by control of intracellular localization. Mol. Biol. Cell 151802-1815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Nakanishi, H., M. Morishita, C. L. Schwartz, A. Coluccio, J. Engebrecht, and A. M. Neiman. 2006. Phospholipase D and the SNARE Sso1p are necessary for vesicle fusion during sporulation in yeast. J. Cell Sci. 1191406-1415. [DOI] [PubMed] [Google Scholar]
- 34.Neiman, A. M. 1998. Prospore membrane formation defines a developmentally regulated branch of the secretory pathway in yeast. J. Cell Biol. 14029-37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Neiman, A. M. 2005. Ascospore formation in the yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 69565-584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Neiman, A. M., L. Katz, and P. J. Brennwald. 2000. Identification of domains required for developmentally regulated SNARE function in Saccharomyces cerevisiae. Genetics 1551643-1655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Nickas, M. E., A. E. Diamond, M. J. Yang, and A. M. Neiman. 2004. Regulation of spindle pole function by an intermediary metabolite. Mol. Biol. Cell 152606-2616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Nickas, M. E., and A. M. Neiman. 2002. Ady3p links spindle pole body function to spore wall synthesis in Saccharomyces cerevisiae. Genetics 1601439-1450. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Nickas, M. E., C. Schwartz, and A. M. Neiman. 2003. Ady4p and Spo74p are components of the meiotic spindle pole body that promote growth of the prospore membrane in Saccharomyces cerevisiae. Eukaryot. Cell 2431-445. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Okamoto, M., T. Yoko-o, T. Miyakawa, and Y. Jigami. 2008. The cytoplasmic region of α-1,6-mannosyltransferase Mnn9p is crucial for retrograde transport from the Golgi apparatus to the endoplasmic reticulum in Saccharomyces cerevisiae. Eukaryot. Cell 7310-318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Pablo-Hernando, M. E., Y. Arnaiz-Pita, H. Tachikawa, F. del Rey, A. M. Neiman, and C. R. Vazquez de Aldana. 2008. Septins localize to microtubules during nutritional limitation in Saccharomyces cerevisiae. BMC Cell Biol. 955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Ramaswamy, N. T., L. Li, M. Khalil, and J. F. Cannon. 1998. Regulation of yeast glycogen metabolism and sporulation by Glc7p protein phosphatase. Genetics 14957-72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 12219-27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Stark, M. J. 1996. Yeast protein serine/threonine phosphatases: multiple roles and diverse regulation. Yeast 121647-1675. [DOI] [PubMed] [Google Scholar]
- 45.Suda, Y., H. Nakanishi, E. M. Mathieson, and A. M. Neiman. 2007. Alternative modes of organellar segregation during sporulation in Saccharomyces cerevisiae. Eukaryot. Cell 62009-2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Tachikawa, H., A. Bloecher, K. Tatchell, and A. M. Neiman. 2001. A Gip1p-Glc7p phosphatase complex regulates septin organization and spore wall formation. J. Cell Biol. 155797-808. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Tu, J., and M. Carlson. 1995. REG1 binds to protein phosphatase type 1 and regulates glucose repression in Saccharomyces cerevisiae. EMBO J. 145939-5946. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Tu, J., W. Song, and M. Carlson. 1996. Protein phosphatase type 1 interacts with proteins required for meiosis and other cellular processes in Saccharomyces cerevisiae. Mol. Cell. Biol. 164199-4206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Versele, M., and J. Thorner. 2004. Septin collar formation in budding yeast requires GTP binding and direct phosphorylation by the PAK, Cla4. J. Cell Biol. 164701-715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Versele, M., and J. Thorner. 2005. Some assembly required: yeast septins provide the instruction manual. Trends Cell Biol. 15414-424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Wolfe, K. 2004. Evolutionary genomics: yeasts accelerate beyond BLAST. Curr. Biol. 14R392-R394. [DOI] [PubMed] [Google Scholar]
- 52.Wong, S., G. Butler, and K. H. Wolfe. 2002. Gene order evolution and paleopolyploidy in hemiascomycete yeasts. Proc. Natl. Acad. Sci. USA 999272-9277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Zeng, G., B. Huang, S. P. Neo, J. Wang, and M. Cai. 2007. Scd5p mediates phosphoregulation of actin and endocytosis by the type 1 phosphatase Glc7p in yeast. Mol. Biol. Cell 184885-4898. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.





