Abstract
Salmonella enterica serotype Enteritidis is a major cause of nontyphoidal salmonellosis from ingestion of contaminated raw or undercooked shell eggs. Current techniques used to identify Salmonella serotype Enteritidis in eggs are extremely laborious and time-consuming. In this study, a novel eukaryotic cell culture system was combined with real-time PCR analysis to rapidly identify Salmonella serotype Enteritidis in raw shell eggs. The system was compared to the standard microbiological method of the International Organization for Standardization (Anonymous, Microbiology of food and animal feeding stuffs—horizontal method for the detection of Salmonella, 2002). The novel technique utilizes a mouse macrophage cell line (RAW 264.7) as the host for the isolation and intracellular replication of Salmonella serotype Enteritidis. Exposure of macrophages to Salmonella serotype Enteritidis-contaminated eggs results in uptake and intracellular replication of the bacterium, which can subsequently be detected by real-time PCR analysis of the DNA released after disruption of infected macrophages. Macrophage monolayers were exposed to eggs contaminated with various quantities of Salmonella serotype Enteritidis. As few as 10 CFU/ml was detected in cell lysates from infected macrophages after 10 h by real-time PCR using primer and probe sets specific for DNA segments located on the Salmonella serotype Enteritidis genes sefA and orgC. Salmonella serotype Enteritidis could also be distinguished from other non-serogroup D Salmonella serotypes by using the sefA- and orgC-specific primer and probe sets. Confirmatory identification of Salmonella serotype Enteritidis in eggs was also achieved by isolation of intracellular bacteria from lysates of infected macrophages on xylose lysine deoxycholate medium. This method identifies Salmonella serotype Enteritidis from eggs in less than 10 h compared to the more than 5 days required for the standard reference microbiological method of the International Organization for Standardization (Microbiology of food and animal feeding stuffs—horizontal method for the detection of Salmonella, 2002).
Nontyphoidal salmonellosis is an invasive intestinal disease contracted predominately by ingestion of food contaminated with serotypes of the gram-negative bacterial species Salmonella enterica. Gastroenteritis caused by Salmonella spp. represents a large portion of the natural food-borne illnesses that occur worldwide each year. Bacterial virulence is established in part by the bacterium's ability to invade and survive within host cells (20). S. enterica is capable of survival within a wide array of host cells, including epithelial cells, dendritic cells, and macrophages in both animal and cell culture models (16, 17, 18, 19). However, survival in macrophages is required for initiation of systemic infection (24). Two chromosomal pathogenicity islands, SPI-1 and SPI-2, which are present in all Salmonella enterica serotypes, are essential for the invasion of epithelial cells and intracellular replication in macrophages, respectively (13, 14).
There are currently over 2,500 distinct serotypes of S. enterica (http://www.pasteur.fr/sante/clre/cadrecnr/salmoms/WKLM_2007.pdf). Of these, Salmonella enterica serovar Enteritidis and Salmonella enterica serovar Typhimurium are most commonly associated with food-borne illness in humans (4). Raw and undercooked shell eggs have been implicated as vehicles for the transmission of both of these serotypes of Salmonella enterica (9, 38). However, Salmonella serotype Enteritidis infection has been more frequently linked to shell egg consumption, whereas Salmonella serotype Typhimurium infection is more often associated with the consumption of contaminated chicken meat (8). Of the 309 documented outbreaks of Salmonella serotype Enteritidis in the United States from 1990 to 2001, 241 were attributed to the consumption of raw or undercooked eggs (6). Salmonella serotype Enteritidis phage types 4, 8, and 13 have been implicated in the majority of salmonellosis cases from the consumption of egg products (5). In addition, Salmonella serotype Enteritidis is able to colonize laying hen reproductive organs and developing eggs and has been shown to persist in eggs after they have been laid (23).
A variety of methods have been developed in order to expedite the detection of salmonellae in eggs, including GeneQuence DNA hybridization, PCR analysis, and enzyme-linked immunosorbent assay (3, 27, 37). However, these methods require lengthy enrichment steps prior to the application of the respective methods. Real-time PCR (RT-PCR) is a promising new method currently used for detection of a wide variety of bacterial pathogens in food matrices (12, 15, 22, 34, 40). However, this technique can be ineffective for the detection of Salmonella serotype Enteritidis in foods such as eggs due to the presence of PCR-inhibitory components (41).
In this study, we developed a novel detection system to allow for the specific identification of viable Salmonella serotype Enteritidis in raw shell eggs. The method developed is based on the ability of Salmonella to invade and replicate within macrophages as part of its life cycle within a host. In theory, cultured eukaryotic cell lines exposed to Salmonella-contaminated foods will allow the penetration and replication of Salmonella while confining food particles and noninvasive bacteria to the extracellular environment, allowing the isolation and enrichment of intracellular Salmonella for subsequent detection by commercially available techniques, such as RT-PCR. In practice, a suitable mammalian cell monolayer is exposed to a particular food matrix suspected of harboring salmonellae. The exposure is promoted for sufficient time to allow cell contact and engulfment of salmonellae. The mammalian cell monolayer is then washed sufficiently to remove the food matrix and extracellular microorganisms. The infected cell monolayer is reconstituted with fresh medium and further incubated to allow for intracellular multiplication of Salmonella (postinfection). After the infection is terminated, the culture medium is discarded, the infected cells are disrupted, and the DNA present in the resultant lysates is analyzed by RT-PCR using primers and probes specific for unique Salmonella DNA sequences. We utilized this method for the presumptive and confirmatory identification of Salmonella serotype Enteritidis in raw shell eggs.
MATERIALS AND METHODS
Bacterial strains and growth conditions.
Salmonella serotype Typhimurium (phage type DT104) and Salmonella serotype Enteritidis (phage types 4, 8, and 13) were used in cell culture infection experiments and routinely grown on modified Luria-Bertani (LB) broth or agar and xylose lysine deoxycholate (XLD) agar at 37°C. All Salmonella strains used (see Table 2) were obtained from the FDA facility (College Park, MD) and grown on modified LB agar at 37°C and used for primer and probe specificity testing. Yersinia, Listeria, Vibrio, Enterobacter, and Escherichia strains (see Table 3) were grown in heart infusion broth at 37°C and used for primer and probe specificity testing. Clostridium botulinum, Francisella tularensis, and Shigella species genomic DNAs were obtained from the FDA facility and used for primer and probe specificity testing.
TABLE 2.
Salmonella enterica serotypes used to determine the specificity of the orgC and sefA primer and probe set
| Salmonella enterica serotype or subspecies | No. of strains tested | RT-PCR result for indicated primer/probe seta
|
|
|---|---|---|---|
| orgC | sefA | ||
| Enteritidis | 16 | + | + |
| Typhimurium | 8 | + | − |
| Java | 1 | + | − |
| Anatum | 1 | + | − |
| Newington | 1 | + | − |
| Newport | 1 | + | − |
| Infantis | 1 | + | − |
| Arizonae | 1 | + | − |
| Pullorum | 1 | + | − |
| Gallinarum | 1 | + | − |
| Poona | 1 | + | − |
| Chester | 1 | + | − |
| Havana | 1 | + | − |
| Derby | 1 | + | − |
| Johannesburg | 1 | + | − |
| Ohio | 1 | + | − |
| Braenderup | 1 | + | − |
| Tennessee | 1 | + | − |
| Istanbul | 1 | + | − |
| Cerro | 1 | + | − |
| Thompson | 1 | + | − |
| Worthington | 1 | + | − |
| Schwarzengrund | 1 | + | − |
| Agona | 1 | + | − |
| Senftenberg | 1 | + | − |
| Mbandaka | 1 | + | − |
| Montevideo | 1 | + | − |
| Hadar | 1 | + | − |
| Kentucky | 1 | + | − |
| Heidelberg | 1 | + | − |
| Saintpaul | 1 | + | − |
| Virchow | 1 | + | − |
| Choleraesuis | 1 | + | − |
+, positive PCR result; −, negative PCR result.
TABLE 3.
Salmonella and non-Salmonella strains used to determine the specificity of the orgC and sefA primer and probe set
| Organism | No. of strains tested | RT-PCR result for indicated primer/probe seta
|
|
|---|---|---|---|
| orgC | sefA | ||
| Salmonella serotype Typhimurium | 1 | + | − |
| Salmonella serotype Enteritidis | 1 | + | + |
| Yersinia pestis | 2 | − | − |
| Yersinia enterocolitica | 4 | − | − |
| Yersinia pseudotuberculosis | 4 | − | − |
| Francisella tularensis subsp. holarctica | 1 | − | − |
| Francisella novicida | 1 | − | − |
| Listeria monocytogenes | 1 | − | − |
| Vibrio parahaemolyticus | 9 | − | − |
| Vibrio cholera | 5 | − | − |
| Enterobacter sakazakii | 9 | − | − |
| Clostridium botulinum | 4 | − | − |
| Shigella dysenteriae | 1 | − | − |
| Shigella sonnei | 1 | − | − |
| Shigella boydii | 1 | − | − |
| Escherichia coli O157:H7 | 1 | − | − |
+, positive PCR result; −, negative PCR result.
Food products.
Shell eggs were purchased from local supermarkets and kept at 4°C until use.
Sample preparation.
Salmonella strains were grown overnight on LB agar plates at 37°C. Salmonella strains from LB plates were inoculated into 50 ml of LB broth and grown standing overnight at 37°C. Cultures were harvested by centrifugation at 16,000 × g for 10 min at room temperature and washed once with phosphate-buffered saline (PBS), pH 7.4. For the preparation of artificially contaminated shell eggs, the cell suspension of the pure culture was added to shell eggs at a final population density of 108 CFU/ml. These cell suspensions were then blended for 5 s and 10-fold serially diluted in preblended raw shell eggs to obtain a range of samples containing approximately 107 to 101 CFU/ml. Uninoculated samples of shell eggs were also prepared as negative controls. A final volume of 2 ml of the corresponding sample dilutions was used immediately for infection of RAW 264.7 cell monolayers. Appropriate dilutions of salmonellae cells in the raw shell eggs were spread plated onto XLD agar and grown for at least 24 h in a 37°C incubator to determine accurate amounts of the initial inocula.
Tissue culture infections.
RAW 264.7 macrophages (no. TIB-71; ATCC, Manassas, VA) were routinely grown at 37°C and 5% CO2 in macrophage growth medium (Dulbecco's modified Eagle's medium [ATCC, Manassas, VA] containing 10% [vol/vol] fetal calf serum) supplemented with 100 μg/ml penicillin and streptomycin. RAW 264.7 macrophages were seeded into six-well tissue culture plates containing 2 ml of macrophage growth medium per well at a density of 1.5 × 106 cells per well and cultured to confluence for 24 h prior to use. Prior to infection, cultured cells were washed once with PBS. In two replicate experiments, cell monolayers were infected in duplicate with Salmonella in shell eggs or macrophage growth medium at population densities of 107 to 101 CFU/ml. Uninoculated shell eggs and macrophage growth medium were also added as negative controls. Plates were centrifuged at 600 × g for 5 min to promote bacterium-macrophage cell contact and incubated for 2 h at 37°C in 5% CO2. Infected cell monolayers were then washed three times with PBS and reconstituted with macrophage growth medium alone and incubated for 5 h (postinfection) at 37°C in 5% CO2. All macrophage monolayers were then transferred to microcentrifuge tubes and centrifuged at 600 × g for 10 min. Supernatants were removed, and macrophages were washed once with PBS. Macrophages were then resuspended in 30 μl of distilled H2O. Macrophages were then boiled for 10 min, cooled for 5 min, and centrifuged at 16,000 × g for 10 min. The supernatants were used for RT-PCR analysis.
RT-PCR.
All reactions were run at a final volume of 25 μl using the SmartCycler II apparatus (Cepheid, Sunnyvale, CA). The primers SEF14-F and SEF14-R and probe SEF14-P were previously designed and shown to specifically target a sequence found on the Salmonella serotype Enteritidis gene sefA (37). This fluorogenic probe contains a 5′ Cy3 fluorophore and a 3′ black hole quencher. The primers ORGC-F and ORGC-R and probe ORGC-P were designed to specifically target a sequence found on the Salmonella gene orgC (Table 1). That fluorogenic probe contains a 5′ Cy5 fluorophore and a 3′ black hole quencher. The reaction components and final concentrations used were 6 mM MgCl2, 200 μM deoxynucleoside triphosphates, 1 U of Takara Ex Taq Hot Start polymerase (Takara Bio, Inc., Madison, WI), 1× Ex Taq buffer, and 3 μl of each template DNA (primer and probe concentrations are shown in Table 1). Thermal cycling parameters were set for an initial 90-s denaturation step at 94°C, followed by 45 cycles at 94°C for 10 s for DNA denaturation with subsequent annealing and extension at 60°C for 15 s. The orgC and sefA RT-PCR analyses were run independently, and positive results were recorded as the measurement of at least 30 fluorescent units above the baseline occurring before the completion of 45 cycles.
TABLE 1.
Primers and probes used in this study
| Primer or probe name | Sequence (5′ to 3′) | Final reaction mixture concn (nM) | Source or reference |
|---|---|---|---|
| SEFA-F (forward) | GGCTTCGGTATCTGGTGGTGTG | 50 | 37 |
| SEFA-R (reverse) | GTCATTAATATTGGCTCCCTGAATA | 900 | 37 |
| SEFA-P (probe) | CCACTGTCCCGTTCGTTGATGGACA | 250 | 37 |
| ORGC-F (forward) | CTTTATGATGCATTCTACCAACGACTG | 100 | This work |
| ORGC-R (reverse) | CCGAATCACCACTGTTAGGA | 100 | This work |
| ORGC-P (probe) | CGCTTCCTGAGTCAGCCTCTTCTGAAACG | 100 | This work |
Confirmatory identification.
Shell eggs and macrophage growth medium contaminated with Salmonella serotype Enteritidis were prepared, and RAW 264.7 cell monolayers were infected as described above. At 5 h postinfection, RAW 264.7 cells were washed once with PBS and lysed by the addition of 80 μl of 0.1% sodium deoxycholate in PBS for approximately 2 min. The released bacteria were serial diluted 10-fold in PBS, plated onto XLD agar plates, and incubated at 37°C for at least 24 h or until the appearance of suspected Salmonella colonies. Suspected Salmonella colonies were streaked onto fresh XLD plates and incubated for at least 24 h at 37°C. Colonies were isolated and suspended in 30 μl of distilled H2O in microcentrifuge tubes, boiled for 10 min, and centrifuged for 10 min, and 3 μl of the supernatant was used for RT-PCR identification with the sefA- and orgC-specific primers and probes. Positive confirmatory reactions were recorded as the measurement of at least 30 fluorescent units above the baseline occurring before the completion of 45 cycles.
Traditional culture method for detection of Salmonella phage types.
The macrophage cell culture method for detection of Salmonella serotype Enteritidis phage types was run in parallel with the standard microbiological method performed according to the International Organization for Standardization (2). Briefly, spiked egg samples were inoculated into buffered peptone water (BPW) and grown for 18 h at 37°C. A 0.1-ml sample of growth in BPW was inoculated into 10 ml of Rappaport-Vassiliadis soya peptone broth and grown for 24 h at 41.5°C. A 1-ml sample of growth in BPW was also inoculated into 10 ml of tetrathionate broth and grown for 24 h at 37°C. Samples of Salmonella colony growth from Rappaport-Vassiliadis soya peptone and tetrathionate broth were streaked onto XLD and brilliant green agar plates and incubated at 37°C for 24 h. Presumptive Salmonella colonies from XLD and brilliant green agar plates were subcultured onto tryptic soy agar (TSA) and incubated for 24 h at 37°C. Confirmation of Salmonella colonies from tryptic soy agar plates was achieved by using RT-PCR with the sefA primer and probe set.
RESULTS
RT-PCR primer and probe set specificity.
The sefA primer and probe set (Table 1) was previously developed and shown to be specific for Salmonella serotype Enteritidis strains (37). The sefA gene encodes a subunit of the fimbrial antigen SEF14, which is essential for Salmonella cell binding to macrophages (11). The DNA sequence encoding SefA is unique to serogroup D members of salmonellae, including Salmonella serotype Enteritidis, and is absent from other Salmonella strains, including Salmonella serotype Typhimurium and non-Salmonella sp. food-borne bacterial pathogens (37). We confirmed that the sefA primer and probe set detected Salmonella serotype Enteritidis and displayed no cross-reactivity with other, non-serogroup D salmonellae, including Salmonella serotype Typhimurium (Table 2), or to a host of other potential food-borne bacterial pathogens (Table 3).
The primer and probe set specific for orgC (Table 1) was designed to detect DNA from both serogroup D and non-serogroup D salmonellae, including Salmonella serotype Enteritidis and Salmonella serotype Typhimurium, respectively. The orgC gene is located on SPI-1 of the Salmonella chromosome and encodes a regulatory protein that is exported via a type III secretion system (10). Homology searches in the database have failed to uncover sequence similarities to the orgC gene, and it appears to encode a protein product unique to Salmonella species. In order to determine the orgC primer and probe set specificity, we conducted RT-PCR analysis of genomic DNA from several Salmonella serotype Enteritidis phage types, non-serogroup D salmonellae, and other potential food-borne bacterial pathogens. No fluorescent signal above background levels was observed after 45 cycles in any of the nonsalmonellae tested (Table 3), whereas all Salmonella serotypes tested showed fluorescent signals above background levels before the completion of 45 cycles (Table 2). These data indicate that the orgC primer and probe set is specific for salmonellae and does not cross-react with DNA from other potential food-borne bacteria.
Eukaryotic cell culture and RT-PCR identification of Salmonella serotype Enteritidis from artificially contaminated macrophage growth medium.
Salmonella serotype Enteritidis has previously been shown to replicate within cultured macrophage cell lines in tissue culture dishes (7). In order to test the eukaryotic cell culture method, we used RAW 264.7 murine macrophages as the eukaryotic cell host. In two separate experiments performed in duplicate, RAW 264.7 macrophages were infected with Salmonella serotype Enteritidis phage type 13 in quantities ranging from 107 to 100 CFU/ml in macrophage growth medium. Analysis of the DNA from infected RAW 264.7 cell lysates by RT-PCR revealed the detection limit of the assay to be 10 CFU/ml using the orgC- and sefA-specific primer and probe sets (Table 4). Lysates from RAW 264.7 cells exposed to uninoculated macrophage growth medium (negative control) failed to illicit a fluorescent signal before the completion of 45 cycles, indicating that the RT-PCR was specific for phage type 13 DNA and not for any nonspecific DNA sequence from the RAW 264.7 cell genome. Gel electrophoresis of the RT-PCR amplifications revealed DNA fragments with sizes corresponding to the orgC (121 bp) and sefA (98 bp) DNA segments, indicating that the fluorescent signal was derived specifically from phage type 13 DNA (data not shown). These data suggest that Salmonella serotype Enteritidis phage type 13 was internalized into RAW 264.7 cells and can subsequently be detected by RT-PCR from infected macrophage cell lysates.
TABLE 4.
Mean cycle threshold values of Salmonella serotype Enteritidis (SE13) detection in macrophage medium by cell culture and RT-PCR analysis at 5 h postinfection using orgC and sefA primer and probe sets
| Salmonella serotype Enteritidis amt (CFU/ml) | Cycle threshold value for indicated primer/probe seta
|
|
|---|---|---|
| orgC | sefA | |
| 107 | 17.23 ± 0.47 | 19.41 ± 0.33 |
| 106 | 18.73 ± 0.60 | 21.28 ± 0.32 |
| 105 | 19.68 ± 0.80 | 22.59 ± 0.27 |
| 104 | 22.60 ± 0.26 | 25.16 ± 0.34 |
| 103 | 27.41 ± 0.54 | 30.56 ± 0.21 |
| 102 | 31.38 ± 0.31 | 34.78 ± 0.19 |
| 101 | 34.97 ± 0.32 | 38.17 ± 1.01 |
| 0 | ND | ND |
Cycle threshold values are expressed as the means of two replicate experiments performed in duplicate ± standard deviations. ND, not detected.
Eukaryotic cell culture and RT-PCR detection of Salmonella serotype Enteritidis from artificially contaminated raw shell eggs.
To evaluate the effectiveness of Salmonella serotype Enteritidis detection in raw shell eggs by using the eukaryotic cell culture technique and RT-PCR, RAW 264.7 macrophages were infected separately with Salmonella serotype Enteritidis phage types 4, 8, and 13 in quantities ranging from 107 to 101 CFU/ml in raw shell eggs (see Materials and Methods). Analysis of RAW 264.7 cell lysates from 5 h postinfection by RT-PCR revealed a detection limit of 10 CFU/ml for all three phage types when the orgC- and sefA-specific primer and probe sets were used (Table 5), which was identical to results obtained using the traditional culture method of the International Organization for Standardization (2). Lysates from RAW 264.7 cells exposed to uninoculated raw shell eggs (negative controls) failed to illicit a fluorescent signal before the completion of 45 cycles, indicating that the RT-PCR analyses were specific for Salmonella serotype Enteritidis DNA and not for nonspecific reactions with RAW 264.7 cell DNA or residual shell egg particles in the PCR mixture. These data demonstrate that the eukaryotic cell culture method and RT-PCR combination can correctly identify Salmonella serotype Enteritidis in raw shell eggs without a loss of specificity or sensitivity.
TABLE 5.
Mean cycle threshold values of Salmonella serotype Enteritidis (phage types 4, 8, and 13) and Salmonella serotype Typhimurium (phage type DT104) detection from artificially contaminated shell eggs by cell culture and RT-PCR at 5 h postinfection by using orgC and sefA primer and probe sets
| Salmonella serotype amt (CFU/ml) | Cycle threshold value for indicated primer/probe seta
|
|||||||
|---|---|---|---|---|---|---|---|---|
|
orgC
|
sefA
|
|||||||
| SE4 | SE8 | SE13 | DT104 | SE4 | SE8 | SE13 | DT104 | |
| 107 | 18.68 ± 0.17 | 18.13 ± 0.19 | 17.15 ± 0.58 | 16.41 ± 0.28 | 18.61 ± 0.57 | 18.14 ± 0.26 | 18.74 ± 0.75 | ND |
| 106 | 19.55 ± 0.73 | 19.56 ± 0.75 | 18.16 ± 0.78 | 17.36 ± 0.38 | 20.75 ± 0.96 | 20.83 ± 0.44 | 20.20 ± 0.35 | ND |
| 105 | 22.52 ± 0.41 | 22.14 ± 0.81 | 22.88 ± 1.39 | 20.70 ± 0.17 | 24.10 ± 0.46 | 23.51 ± 0.53 | 24.78 ± 0.51 | ND |
| 104 | 23.19 ± 0.16 | 26.69 ± 0.85 | 26.38 ± 0.51 | 24.40 ± 0.10 | 24.75 ± 0.19 | 28.07 ± 0.37 | 27.92 ± 1.17 | ND |
| 103 | 26.74 ± 1.11 | 29.18 ± 0.41 | 29.65 ± 0.72 | 27.72 ± 0.07 | 28.33 ± 1.44 | 30.49 ± 0.16 | 30.72 ± 1.44 | ND |
| 102 | 31.15 ± 1.01 | 30.93 ± 1.15 | 32.86 ± 2.05 | 31.80 ± 0.33 | 32.31 ± 0.97 | 32.79 ± 0.78 | 34.48 ± 4.01 | ND |
| 101 | 32.50 ± 2.06 | 34.91 ± 1.77 | 36.26 ± 2.55 | 40.46 ± 0.94 | 34.06 ± 0.86 | 34.68 ± 0.72 | 36.26 ± 3.52 | ND |
| 0 | ND | ND | ND | ND | ND | ND | ND | ND |
Cycle threshold values are expressed as the means of two replicate experiments performed in duplicate ± standard deviations. ND, not detected.
Differentiation between serogroup D and non-serogroup D salmonellae in artificially inoculated macrophage growth medium and raw shell eggs by eukaryotic cell culture and RT-PCR.
The orgC-specific primer and probe set was designed to identify all Salmonella serotypes, including the two most common Salmonella serotypes implicated in human gastroenteritis, Salmonella serotype Enteritidis and Salmonella serotype Typhimurium. Conversely, the sefA primer and probe set detected a narrow range of Salmonella serotypes belonging to serogroup D, including Salmonella serotype Enteritidis. To determine whether the cell culture and RT-PCR method could be used to discriminate between serogroup D and non-serogroup D salmonellae, raw shell eggs were artificially inoculated with Salmonella serotype Typhimurium, a non-group D serotype, in quantities ranging from 107 to 101 CFU/ml, and macrophages were infected in two separate experiments performed in duplicate. Analysis of macrophage cell lysates from 5 h postinfection by RT-PCR analysis using the orgC-specific primer and probe set revealed a detection limit of 10 CFU/ml (Table 5). In contrast, no fluorescent signal was detected from macrophage cell lysates when the sefA-specific primer and probe set was used (Table 5). These data indicate that the cell culture and RT-PCR technique using the orgC and sefA primer and probe sets is a practical tool for the detection and differentiation of serogroup D (orgC+ and sefA+) and non-serogroup D (orgC+ and sefA null) salmonellae.
Confirmatory identification of Salmonella serotype Enteritidis in raw shell eggs by the eukaryotic cell culture technique.
A presumptive positive result by the eukaryotic cell culture and RT-PCR method must be followed up by confirming the identity of Salmonella in pure culture. To evaluate the eukaryotic cell culture method for confirmatory identification, RAW 264.7 macrophages were infected with Salmonella serotype Enteritidis phage types 4, 8, and 13 in quantities ranging from 107 to 100 CFU/ml in raw shell eggs. At 5 h postinfection, macrophages were lysed with 0.1% sodium deoxycholate in PBS, and the released salmonellae were plated on XLD agar and incubated for at least 24 h at 37°C. Suspected colonies were streaked for isolation on XLD agar and incubated for at least 24 h. Colonies were chosen and boiled as described in Materials and Methods, and the released DNA was analyzed by RT-PCR using the sefA- and orgC-specific primer and probe sets. Confirmatory identification revealed a detection limit of 10 CFU/ml (data not shown). Lysates from RAW 264.7 cells exposed to uninoculated raw shell eggs (negative control) failed to produce Salmonella serotype Enteritidis colonies on XLD agar plates.
DISCUSSION
Methods used previously to detect Salmonella from food specimens include classic microbiologically based (cultivation, biochemical profiling) and immunologically based (enzyme-linked immunosorbent assay, direct fluorescence antibody) methods (25, 28, 29, 30, 39). These methods are frequently being replaced with more-rapid and -sensitive molecular biology-based techniques. RT-PCR is a recent advance in molecular detection that has been used successfully for the rapid identification of a wide array of bacterial pathogens in specific food matrices (12, 15, 22, 34, 36, 40). However, various food products have been shown to interfere with PCR assays, resulting in potentially false-negative results (1, 22, 31, 32, 33, 35). Indeed, detection of Salmonella in raw shell eggs by RT-PCR has been challenging due to the PCR-inhibitory nature of eggs (41). Therefore, a sample processing step is often required to isolate the target organism from potential PCR-inhibitory food particles prior to initiating the RT-PCR assay. Preenrichment strategies using selective broth have been employed prior to the application of RT-PCR for detection of Salmonella in eggs in order to dilute the food matrix and increase the bacterial load to detectable levels (26, 37). However, the total time for detection of Salmonella species using these preenrichment steps has exceeded 24 h in each case.
We sought to develop a system for the specific identification of serogroup D salmonellae, which include Salmonella serotype Enteritidis, in raw shell eggs that can (i) isolate or separate Salmonella serotype Enteritidis from PCR-inhibitory food particles, (ii) enrich small amounts of Salmonella serotype Enteritidis to detectable levels for PCR, (iii) detect only viable cells, and (iv) isolate Salmonella serotype Enteritidis colonies for subsequent confirmatory identification and that is rapid, sensitive, and specific. The technique presented here uses a macrophage cell monolayer that acts as host for the physical separation of Salmonella from egg particles. Once Salmonella cells are separated from inhibitory egg components and concentrated via intracellular multiplication to detectable levels, the bacterium can be identified via RT-PCR. We show that this system is capable of identifying as little as 10 CFU/ml of Salmonella serotype Enteritidis and Salmonella serotype Typhimurium in raw eggs and that it displays a broad range of detection, from 107 CFU/ml to 101 CFU/ml. The overall analysis time for presumptive detection of Salmonella in raw eggs was 10 h, with no false positives recorded. Another advantage of this eukaryotic cell culture technique is that only living Salmonella cells are able to reside and multiply within macrophages, thus restricting detection to viable bacteria. Furthermore, a modification of the procedure allows confirmatory detection of Salmonella serotype Enteritidis in eggs in less than 48 h, compared to the more than 5 days required for the standard method of the International Organization for Standardization (2).
Primer and probe sets that recognize DNA sequences unique to and present in all Salmonella serotype Enteritidis strains have yet to be developed. The Salmonella sefA and Prot6e genes have been used previously as targets for the RT-PCR identification of Salmonella serotype Enteritidis strains in raw eggs and have come the closest to satisfying inclusivity and exclusivity criteria (26, 37). The sefA DNA sequence appears to be present in all known Salmonella serotype Enteritidis phage types tested so far but is not unique to Salmonella serotype Enteritidis and is present in seven other Salmonella serotypes, all of which are members of serogroup D (37). In contrast, Prot6e is found exclusively in Salmonella serotype Enteritidis strains and is absent from all other known Salmonella serotypes, including other members of serogroup D (26). However, Prot6e is carried on a plasmid, which is prone to loss or modification (26). Therefore, Salmonella serotype Enteritidis strains lacking a virulence plasmid would not be detected using Prot6e primers and probes, leading to false-negative RT-PCR assays. In order to avoid potentially false-negative results, we chose sefA as the RT-PCR target gene. We also utilized a primer and probe set specific for the Salmonella gene orgC in order to add a degree of specificity and to distinguish between serogroup D and non-serogroup D salmonellae when used in combination with the sefA primer and probe set. We showed that the orgC-specific primer and probe set recognizes DNA from 55 Salmonella strains representing 33 serotypes, including 16 strains of Salmonella serotype Enteritidis and 8 strains of Salmonella serotype Typhimurium (Table 2). Moreover, the orgC primer and probe set exhibited no cross-reactivity to DNA from 46 strains representing 14 potential bacterial food-borne pathogens (Table 3). Using the combination of these two primer/probe sets allows us to determine the presence of serogroup D members, including Salmonella serotype Enteritidis (orgC+ and sefA+), non-serogroup D Salmonella serotypes (orgC+ and sefA null), or no Salmonella contamination (orgC null and sefA null). Although Salmonella serotype Enteritidis is the predominant cause of food poisoning among members of serogroup D, the current primers and probes available do not allow us to definitively verify the presence of Salmonella serotype Enteritidis in a particular food outbreak. The discovery of a unique chromosomal DNA sequence present in all Salmonella serotype Enteritidis serotypes would allow us to combine the RT-PCR procedure with the eukaryotic cell culture isolation technique to rapidly substantiate the presence of Salmonella serotype Enteritidis in raw eggs. However, this unique sequence is unlikely to be found on the invasion-associated pathogenicity island SPI-1, which is a region of the Salmonella chromosome that is commonly used for identification by PCR, in light of the recent discovery of human clinical isolates of Salmonella serotype Senftenberg that do not possess SPI-1 (21).
In theory, the eukaryotic cell culture and RT-PCR technique, or variations of this technique, could be used to detect other food-borne pathogens that exhibit intracellular life cycles, such as Listeria monocytogenes, Shigella spp., and Yersinia spp. In fact, previous experiments have demonstrated that a modified version of the eukaryotic cell culture and RT-PCR method can identify as few as 10 CFU/ml of Francisella tularensis in both solid and liquid food matrices (J. B. Day, unpublished data). The method may also conceivably be employed for the detection of salmonellae in water as well as in environmental and clinical samples. Although the method presented here was designed for the rapid analysis of small egg samples that are suspected of harboring Salmonella serotype Enteritidis or other Salmonella serotypes, the technique can conceivably be adapted for high-throughput identification of Salmonella spp. in larger samples by using automated microtiter plate assay formats with subsequent detection by RT-PCR. However, the requirement for macrophage cell lines to perform the detection method may restrict the application of this technique to laboratories that have access to tissue culture facilities and personnel skilled in cell culture techniques.
The pandemic nature of Salmonella species throughout the world and the potential severity of infection from ingestion have raised awareness of the importance of developing rapid and sensitive techniques to detect Salmonella in food matrices, particularly egg products. The method described here would allow the identification of Salmonella species within 10 h so that further exposure to the public could be prevented and the timely administration of appropriate antibiotics could be initiated in the event of an outbreak. In addition, confirmation could be achieved within 48 h without the need for prolonged incubation in selective enrichment media.
Footnotes
Published ahead of print on 26 June 2009.
REFERENCES
- 1.Abolmaaty, A., W. Gu, R. Witkowsky, and R. E. Levin. 2007. The use of activated charcoal for the removal of PCR inhibitors from oyster samples. J. Microbiol. Methods 68:349-352. [DOI] [PubMed] [Google Scholar]
- 2.Anonymous. 2002. Microbiology of food and animal feeding stuffs—horizontal method for the detection of Salmonella. ISO 6579:2002. International Organization for Standardization, Geneva, Switzerland.
- 3.Blais, B. W., and A. Martinez-Perez. 2008. Detection of group D salmonellae including Salmonella Enteritidis in eggs by polymyxin-based enzyme-linked immunoabsorbent assay. J. Food Prot. 71:392-396. [DOI] [PubMed] [Google Scholar]
- 4.Braden, C. R., P. Fields, N. H. Bean, and R. V. Tauxe. 2002. Salmonella surveillance: annual summary, 2001. U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, Atlanta, GA.
- 5.Burr, R., P. Effler, R. Kanenaka, M. Nakata, B. Holland, and F. J. Angulo. 2005. Emergence of Salmonella serotype Enteritidis phage type 4 in Hawaii traced to locally produced eggs. Int. J. Infect. Dis. 9:340-346. [DOI] [PubMed] [Google Scholar]
- 6.Centers for Disease Control and Prevention. 2003. Outbreaks of Salmonella serotype Enteritidis infection associated with eating shell eggs—United States, 1999-2001. MMWR Morb. Mortal. Wkly. Rep. 51:1149-1152. [PubMed] [Google Scholar]
- 7.Chan, K., C. C. Kim, and S. Falkow. 2005. Microarray-based detection of Salmonella enterica serovar Typhimurium transposon mutants that cannot survive in macrophages and mice. Infect. Immun. 73:5438-5449. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Clavijo, R. I., C. Loui, G. L. Anderson, L. W. Riley, and S. Lu. 2006. Identification of genes associated with survival of Salmonella enterica serovar Enteritidis in chicken egg albumen. Appl. Environ. Microbiol. 72:1055-1064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Coyle, E. F., S. R. Palmer, C. D. Ribeiro, H. I. Jones, A. J. Howard, L. Ward, and B. Rowe. 1988. Salmonella enteritidis phage type 4 infection: association with hen's eggs. Lancet ii:1295-1297. [DOI] [PubMed] [Google Scholar]
- 10.Day, J. B., and C. A. Lee. 2003. Secretion of the orgC gene product by Salmonella enterica serovar Typhimurium. Infect. Immun. 71:6680- 6685. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Edwards, R. A., D. M. Schifferli, and S. R. Maloy. 2000. A role for Salmonella fimbriae in interperitoneal infections. Proc. Natl. Acad. Sci. USA 97:1258-1262. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ellingson, J. L., J. L. Anderson, S. A. Carlson, and V. K. Sharma. 2004. Twelve hour real-time PCR technique for the sensitive and specific detection of Salmonella in raw and ready-to-eat meat products. Mol. Cell. Probes 18:51-57. [DOI] [PubMed] [Google Scholar]
- 13.Fierer, J., and D. G. Guiney. 2001. Diverse virulence traits underlying different clinical outcomes of Salmonella infection. J. Clin. Investig. 107:775-780. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Fink, S. L., and B. T. Cookson. 2007. Pyroptosis and host cell death responses during Salmonella infection. Cell. Microbiol. 9:2562-2570. [DOI] [PubMed] [Google Scholar]
- 15.Fricker, M., U. Messelhausser, U. Busch, S. Scherer, and M. Ehling-Schulz. 2007. Diagnostic real-time PCR assay for the detection of emetic Bacillus cereus strains in foods and recent food-borne outbreaks. Appl. Environ. Microbiol. 73:1892-1898. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Galán, J. E., and R. Curtiss III. 1989. Cloning and molecular characterization of genes whose products allow Salmonella typhimurium to penetrate tissue culture cells. Proc. Natl. Acad. Sci. USA 86:6383-6387. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gast, R. K., and P. S. Holt. 2001. Multiplication in egg yolk and survival in egg albumen of Salmonella enterica serotype enteritidis strains of phage types 4, 8, 13a, and 14b. J. Food Prot. 64:865-867. [DOI] [PubMed] [Google Scholar]
- 18.Geddes, K., F. Cruz III, and F. Heffron. 2007. Analysis of cells targeted by Salmonella type III secretion in vivo. PLoS Pathog. 3:2017-2028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Guo, A., M. A. Lasaro, J. C. Sirard, J. P. Kraehenbuhl, and D. M. Schifferli. 2007. Adhesion-dependent binding and uptake of Salmonella enterica serovar Typhimurium by dendritic cells. Microbiology 153:1059-1069. [DOI] [PubMed] [Google Scholar]
- 20.Haraga, A., M. B. Ohlson, and S. I. Miller. 2008. Salmonellae interplay with host cells. Nat. Rev. Microbiol. 6:53-66. [DOI] [PubMed] [Google Scholar]
- 21.Hu, Q., B. Coburn, W. Deng, Y. Li, X. Shi, Q. Lan, B. Wang, B. K. Coombes, and B. B. Finlay. 2008. Salmonella enterica serovar Senftenberg human clinical isolates lacking SPI-1. J. Clin. Microbiol. 46:1330-1336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kaufman, G. E., G. M. Blackstone, M. C. Vickery, A. K. Bej, J. Bowers, M. D. Bowen, R. F. Meyer, and A. DePaola. 2004. Real-time PCR quantification of Vibrio parahaemolyticus in oysters using an alternative matrix. J. Food Prot. 67:2424-2429. [DOI] [PubMed] [Google Scholar]
- 23.Keller, L. H., C. E. Benson, K. Krotec, and R. J. Eckroade. 1995. Salmonella enteritidis colonization of the reproductive tract and forming and freshly laid eggs of chickens. Infect. Immun. 63:2443-2449. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Knodler, L. A., and O. Steele-Mortimer. 2003. Taking possession: biogenesis of the Salmonella containing vacuole. Traffic 4:587-599. [DOI] [PubMed] [Google Scholar]
- 25.Kumar, R., P. K. Surendran, and N. Thampuran. 2008. Evaluation of culture, ELISA and PCR assays for the detection of Salmonella in seafood. Lett. Appl. Microbiol. 46:221-226. [DOI] [PubMed] [Google Scholar]
- 26.Malorny, B., C. Bunge, and R. Helmuth. 2007. A real-time PCR for the detection of Salmonella Enteritidis in poultry meat and consumption eggs. J. Microbiol. Methods 70:245-251. [DOI] [PubMed] [Google Scholar]
- 27.Mozola, M. A., X. Peng, and M. Wendorf. 2007. Evaluation of the GeneQuence DNA hybridization method in conjunction with 24-hour enrichment protocols for detection of Salmonella spp. in select foods: collaborative study. J. AOAC Int. 90:738-755. [PubMed] [Google Scholar]
- 28.Munson, T. E., J. P. Schrade, N. B. Bisciello, Jr., L. D. Fantasia, W. H. Hartung, and J. J. O'Conner. 1976. Evaluation of an automated fluorescent antibody procedure for detection of Salmonella in foods and feeds. Appl. Environ. Microbiol. 31:514-521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ng, S. P., C. O. Tsui, D. Roberts, P. Y. Chau, and M. H. Ng. 1996. Detection and serogroup differentiation of Salmonella spp. in food within 30 hours by enrichment-immunoassay with a T6 antibody capture enzyme-linked immunoabsorbent assay. Appl. Environ. Microbiol. 62:2294-2302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Olsen, J. E., S. Aabo, W. Hill, S. Notemans, K. Wernars, P. E. Granum, T. Popovic, H. N. Rasmussen, and O. Olsvik. 1995. Probes and polymerase chain reaction for detection of food-borne bacterial pathogens. Int. J. Food Microbiol. 28:1-78. [DOI] [PubMed] [Google Scholar]
- 31.Perelle, S., F. Dilasser, B. Malorny, J. Grout, J. Hoorfar, and P. Fach. 2004. Comparison of PCR-ELISA and LightCycler real-time PCR assays for detection of Salmonella spp. in milk and meat samples. Mol. Cell. Probes 18:409-420. [DOI] [PubMed] [Google Scholar]
- 32.Powell, H. A., C. M. Gooding, S. D. Garrett, B. M. Lund, and R. A. McKee. 1994. Proteinase inhibition of the detection of Listeria monocytogenes in milk using the polymerase chain reaction. Lett. Appl. Microbiol. 18:59-61. [Google Scholar]
- 33.Rijpens, N. P., G. Jannes, M. Van Asbroeck, R. Rossau, and L. M. Herman. 1996. Direct detection of Brucella spp. in raw milk by PCR and reverse hybridization with 16S-23S rRNA spacer probes. Appl. Environ. Microbiol. 62:1683-1688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Rönner, A. C., and H. Lindmark. 2007. Quantitative detection of Campylobacter jejuni on fresh chicken carcasses by real-time PCR. J. Food Prot. 70:1373-1378. [DOI] [PubMed] [Google Scholar]
- 35.Rossen, L., P. Norskov, K. Holmstrom, and O. F. Rasmussen. 1992. Inhibition of PCR by components of food samples, microbial diagnostic assays and DNA-extraction solutions. Int. J. Food Microbiol. 17:37-45. [DOI] [PubMed] [Google Scholar]
- 36.Seo, K. H., and R. E. Brackett. 2005. Rapid, specific detection of Enterobacter sakazakii in infant formula using a real-time PCR assay. J. Food Prot. 68:59-63. [DOI] [PubMed] [Google Scholar]
- 37.Seo, K. H., I. E. Valentin-Bon, R. E. Bracket, and P. S. Holt. 2004. Rapid, specific detection of Salmonella enteritidis in pooled eggs by real-time PCR. J. Food Prot. 67:864-869. [DOI] [PubMed] [Google Scholar]
- 38.Stephens, N., C. Sault, S. M. Firestone, D. Lightfoot, and C. Bell. 2007. Large outbreaks of Salmonella Typhimurium phage type 135 infections associated with the consumption of products containing raw egg in Tasmania. Commun. Dis. Intell. 31:118-124. [PubMed] [Google Scholar]
- 39.U.S. Food and Drug Administration. 2001. Bacteriological analytical manual. http://www.cfsan.fda.gov/∼ebam/bam-toc.html.
- 40.Wang, L., Y. Li, and A. Mustaphai. 2007. Rapid and simultaneous quantification of Escherichia coli 0157:H7, Salmonella and Shigella in ground beef samples by multiplex real-time PCR and immunomagnetic separation. J. Food Prot. 70:1366-1372. [DOI] [PubMed] [Google Scholar]
- 41.Woodward, M. J., and S. E. Kirwan. 1996. Detection of Salmonella enteritidis in eggs by polymerase chain reaction. Vet. Rec. 138:411-413. [DOI] [PubMed] [Google Scholar]