Abstract
A study was performed to determine the prevalence and antimicrobial resistance of Shigella species and diarrheagenic Escherichia coli isolates cultured from patients with acute diarrhea in Tehran, Iran. Between May 2003 and May 2005, 1120 diarrheal specimens were collected and assayed for bacterial enteropathogens by conventional and molecular methods. Etiological agents were isolated from 564 (50.3%) specimens, and included 305 (54%) E coli, 157 (27.8%) Shigella species, and 102 (18%) from other genera of bacteria. The predominant E coli was Shiga toxin-producing E coli (105 isolates [34.5%]) and the predominant Shigella serotype was Shigella sonnei (88 isolates [56.1%]). A high rate of antibiotic resistance was observed among E coli, with 40 of 53 (75.5%) Shiga toxin-producing E coli isolates resistant to amoxicillin and tetra-cycline, and eight (5.2%) E coli isolates resistant to more than six antibiotics. Most Shigella isolates were resistant to tetracycline (95%) and trimethoprim-sulfamethoxazole (91.7%), with greatest antibiotic resistance observed among S sonnei (53 of 88 [60.2%] isolates). Antibiotic resistance is widespread in diarrheagenic E coli and Shigella in children with acute diarrhea in Tehran, Iran; hence, updated strategies for appropriate use of antimicrobial agents in Iran are needed.
Keywords: Antibiotic resistance, Diarrheagenic pathogens, E coli, Iran, Shigella
Abstract
On a effectué une étude pour déterminer la prévalence et la résistance antimicrobienne des espèces de Shigella et des isolats d’Escherichia coli diarrhéogènes cultivés à partir de prélèvements de patients atteints de diarrhée aiguë à Téhéran, en Iran. Entre mai 2003 et mai 2005, on a prélevé et titré 1 120 échantillons de diarrhée pour dépister des entéropathogènes bactériens au moyen des méthodes classiques et moléculaires. On a isolé des agents étiologiques auprès de 564 échantillons (50,3 %), ce qui incluait 305 cas d’E coli (54 %), 157 espèces de Shigella (27,8 %) et 102 cas d’autres genres de bactéries (18 %). Le principal E coli était un E coli producteur de toxines Shiga (105 isolats [34,5 %]) et le principal sérotype de Shigella, le Shigella sonnei (88 isolats [56,1 %]). On a observé un fort taux d’antibiorésistance dans les cas d’E coli, 40 des 53 cas d’isolats d’E coli producteurs de toxines Shiga (75,5 %) étant résistants à l’amoxicilline et à la tétracycline et huit isolats d’E coli (5,2 %) étant résistants à plus de six antibiotiques. La plupart des isolats de Shigella étaient résistants à la tétracycline (95 %) et au triméthoprim-sulfaméthoxazole (91,7 %), la plus grande antibiorésistance s’observant dans les cas de S sonnei (53 des 88 isolats [60,2 %]). L’antibiorésistance est généralisée en cas d’E coli diarrhéogène et de Shigella chez les enfants atteints de diarrhée aiguë de Téhéran, en Iran. Il faut donc trouver de nouvelles stratégies afin d’utiliser les antimicrobiens convenablement en Iran.
Diarrheal diseases caused by bacterial pathogens are a major problem worldwide, especially in developing countries (1,2). Five types of diarrheagenic Escherichia coli, including enterotoxigenic E coli (ETEC), enterohemorrhagic E coli, enteropathogenic E coli (EPEC), enteroinvasive E coli and enteroaggregative E coli, as well as Shigella species, are the most common causes of acute diarrhea in Iran (3,4). In Vietnam and Thailand, E coli is among the most common isolates from patients with diarrhea and has a high prevalence of resistance to antibiotics (5,6). Shigella is also a major cause of gastroenteritis, leading to annual deaths of three to five million children younger than five years of age in developing countries (7).
Antibiotic treatment of common bacterial infections plays a crucial role in reducing morbidity and mortality of diseases; however, overuse and misuse of antibiotics in the treatment of diarrhea could lead to increased antibiotic resistance (8). The progressive increase in antibiotic resistance among enteric pathogens in developing countries (9,10) is a research priority of the diarrheal disease control program of the World Health Organization (11). Knowledge of antimicrobial resistance of diarrheagenic pathogens is important in selecting the appropriate therapy, because many patients with gastroenteritis are treated empirically with antibiotics and the antimicrobials may not be effective. This is especially relevant to the developing world, where the rate of diarrheal diseases is highest and the use of antimicrobial agents is often indiscriminate (12). The purpose of the present study was to determine the prevalence and antimicrobial susceptibility of diarrheagenic E coli and Shigella isolates from Iranian children with acute diarrhea in Tehran, from 2003 to 2005.
Methods
Definitions
Diarrhea was defined as at least three loose stools in 24 h, any number of watery stools, or one or two loose stools in 24 h accompanied by at least one of the following symptoms: nausea, vomiting, abdominal cramps or fever of 38°C. Acute diarrhea was defined as diarrhea that lasted 14 days or less at the time of presentation. Isolates from children with persistent diarrhea were not included in this study. Persistent diarrhea was defined as diarrhea which lasted for more than 14 days at presentation. When diarrhea was present intermittently, it was considered persistent when diarrhea occurred during at least six days in a two-week period.
Sample collection
The present study included children who presented with acute diarrhea from May 2003 to May 2005 from four hospitals (two of four were children’s hospitals) in Tehran. The children were categorized into six different groups according to their age – zero to two months, three to five months, six to 11 months, 12 to 23 months, 24 to 35 months and 36 to 60 months. They were part of the routine 25% to 30% surveillance sampling of all diarrhea children seen at the children’s hospitals and clinical centres in Iran. The study was endorsed by the Ethic Committee of Research Center for Gastroenterology and Liver Diseases. Informed consent was obtained from the children’s parents.
Fecal specimens
All specimens were added to Cary-Blair and PBS transport media and transported on ice packs to the laboratory of the Research Department of Foodborne and Diarrheal Diseases of Shaheed Beheshti University of Medical Sciences, M.C. in Tehran. Stool samples were collected on the day of presentation at the outpatient department, immediately transported to the laboratory, stored at 4°C and processed within 24 h.
Bacterial isolation
Samples (swabs from Cary-Blair transport media) were cultured for E coli, Shigella and Salmonella species by streaking directly onto xylose-lysine deoxycholate agar, MacConkey agar and Salmonella-Shigella agar (Merck, Germany), and incubating for 24 h at 37°C, and by enriching in Selenite F broth at 37°C overnight. Enrichment cultures were subcultured on each of the media described above by incubating at 37°C overnight. Swabs from Cary-Blair transport media of samples were also cultured for Campylobacter species, on enrichment media including Preston enrichment broth base (HIMEDIA, Mumbai, India, M899) supplemented with Campylobacter selective supplement IV (HIMEDIA, Mumbai, India, FD158) with an antibiotic (Campylobacter Supplement 2, Blaser Wang, HIMEDIA, Mumbai, India, FD 006) and 5% defibrinated sheep blood and incubated for 48 h at 42°C under microaerophilic conditions. One presumptive Campylobacter colony from each selective agar plate was subcultured and tested for Gram stain, production of catalase and oxidase and hippurate hydrolysis. For Yersinia species, swabs from PBS transport media were cultured on selective agar, CIN agar, (Merck K GaA Darmstadt, Germany) and incubated at 22°C for 24 h to 72 h.
Molecular diagnosis of diarrheagenic E coli and Shigella species
E coli-like and other Gram-negative colonies growing on the primary culture medium were tested by polymerase chain reaction (PCR) assay for virulence genes. For DNA extraction, a loopful of bacterial growth obtained from the culture plate was suspended in 0.75 mL of sterile distilled water and boiled for 20 min.
Extracts of genomic DNA from mixed cultures were assayed by PCR using seven different sets of primers targeting stx1, stx2, eae, pCVD432 plasmid, lt, st and ipaH (13–16). A 2 μL portion of this suspension was added to 22 μL of PCR mixture (50 mM potassium chloride, 10 mM Tris-hydrochloride [pH 8.3], 1.5 mM magnesium chloride, 0.2 mM each deoxynucleotide triphosphate and 0.6 U of Taq polymerase) and 1 μL of primer mix 1 or 2 containing 10 ng primer/μL. All samples were amplified in a programmable thermocycler (Eppendorf AG 2233, Germany) by cycling at 95°C for 2 min to denature DNA, then 30 cycles for 30 s at 94°C, 30 s at 60°C to anneal the primers (stx1, stx2 and eae [58°C], lt, st and pCVD423 [57°C] and ipaH [52°C]), 20 s at 72°C, and a final prolonged extension at 72°C for 10 min.
The PCR product bands were separated by electrophoresis through 1.3% agarose gel in 1× TBE buffer. DNA fragments were visualized by ethidium bromide staining and photographed under ultraviolet light illumination.
Up to 15 to 30 suspected colonies for diarrheagenic E coli-positive cases were tested for the virulence genes. E coli isolates that were eae-positive and stx-negative were identified as EPEC. Isolates positive for pCVD432 were identified as EAEC and those stx1- or stx2-positive, or both, were Shiga toxin-producing E coli (STEC). Those E coli isolates that were lt- or st-positive, or both, were ETEC. Positive controls with genomic DNA from E coli ATCC 35401 (lt-positive, st-positive), E coli ATCC 43894 (stx1-positive, stx2-positive, eae-positive), E coli RH 4620 (Pcvd432-positive) and Shigella ATCC 9290 (ipaH-positive) were included in each PCR run along with a nontemplate-containing reaction to detect false-positive results. For isolation the Shigella strains, PCR was done for ial gene by the ial lower GGAGGCCAACAATTATTTCC and ial upper CTGGATGGTATGGTGAGG primers (320 base pairs). Which sample was positive for both ial and ipaH genes presented as Shigella strains (17).
Biochemical identification and serological assay
Colonies morphologically resembling Shigella species were further identified by biochemical reactions according to standard methods (8 and confirmed by slide agglutination test using commercially available antisera from Mast Group Ltd (18). E coli isolates that were positive for both stx1 and stx2 genes were tested by O157 and H7 antiseras (MAST House, Merseyside, United Kingdom).
Antibiotic susceptibility testing
E coli isolates were tested for susceptibility to tetracycline (30 μg), ampicillin (10 μg), ceftazidime (30 μg), nalidixic acid (30 μg), gentamicin (10 μg), amoxicillin-clavulanic acid (30 μg), sulfamethoxazole (30 μg), ceftriaxon (30 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg) and streptomycin (10 μg) by the Kirby-Bauer disk diffusion method (MAST House, Merseyside, United Kingdom) (19).
Shigella isolates were also assayed for the same 11 antibiotics in addition to erythromycin (10 μg), cefixime (5 μg) and ampicillin-sulbactam (20 μg). The resistance break points were those recommended by Clinical and Laboratory Standards Institute, (20) and was reported as sensitive or resistant based on break points. Bacteria used for controls included Staphylococcus aureus ATCC 25923 and E coli ATCC 25922.
Statistical analysis
All data were entered into SPSS/PC 11.0 software (SPSS Inc, USA) and comparative statistics were calculated using the two-tailed χ2 test and Fisher’s exact test. P≤0.05 was considered to be significant.
RESULTS
The etiological agents were isolated from 564 of 1120 stool specimens (50.3%) from children with acute diarrhea. The enteropathogens isolated included 305 (54%) E coli and 157 (27.8%) Shigella species, and 102 (18%) belonged to other genera of bacteria (60 [10.6%] Campylobacter species and 42 [7.5%] Salmonella species) (Table 1). The most frequently isolated E coli was STEC (34.5%), whereas the predominant serotype of Shigella species was Shigella sonnei (56.1%) (Table 1).
TABLE 1.
Prevalence of enteropathogenic bacteria isolated from children with acute diarrhea (n=564) in Tehran, Iran, from May 2003 to May 2005
| Enteropathogens | Number of isolates |
|---|---|
| Shigella species | 157 |
| Shigella sonnei | 88 |
| Shigella flexneri | 48 |
| Shigella dysenteriae | 13 |
| Shigella boydii | 8 |
| STEC | 105 |
| stx1 | 30 |
| stx2 | 65 |
| stx1/stx2 | 10 |
| EAEC | 92 |
| EPEC | 70 |
| ETEC | 38 |
| LT-producing | 13 |
| ST-producing | 17 |
| LT/ST-producing | 8 |
| Campylobacter species | 60 |
| Salmonella species | 42 |
| Yersinia species | 0 |
| Total | 564 |
EAEC Enteroaggregative Escherichia coli; EPEC Enteropathogenic E coli; ETEC Enterotoxigenic E coli; STEC Shiga toxin-producing E coli
The highest acute diarrhea rate was from children 12 to 24 months of age (n=266) during the dry seasons (from June 20 to September 20) (68.6%) (Table 2). The 153 pure diarrheagenic E coli strains were isolated and selected for antibiotic sensivity testing. The number of isolates compared by PCR-positive samples show that the molecular technique is more sensitive than conventional tests.
TABLE 2.
Basic information and clinical symptoms of the 1120 children with acute diarrhea analyzed
| Characteristic | |
|---|---|
| Seasons, n (%) | |
| Spring | 215 (19.2) |
| Summer | 537 (48.0) |
| Fall | 227 (20.2) |
| Winter | 141 (12.6) |
| Age (months), n (%) | |
| 0–2 | 89 (7.9) |
| 3–5 | 171 (15.3) |
| 6–11 | 219 (19.5) |
| 12–23 | 266 (23.7) |
| 24–35 | 121 (10.8) |
| 36–60 | 254 (22.7) |
| Sex ratio (male:female) | 1.21:1 |
| Age, months (mean ± SD) (male) | 33.07±6.89 |
| Age, months (mean ± SD) (female) | 32.93±7.27 |
| Diarrhea, n (%) | |
| Frequency (mean ± SD)* | 7.1±2.4 |
| Watery | 469 (41.8) |
| Mucus | 429 (38.3) |
| Bloody | 112 (10) |
| Unknown | 110 (9.8) |
| Vomiting, n (%) | 631 (56.3) |
| Anorexia, n (%) | 314 (28) |
| Fever, n (%) | 322 (28.7) |
| Abdominal pain, n (%) | 245 (21.9) |
| Antibiotic consumption, n (%) | 84 (7.5) |
Number of depositions per day
The E coli and Shigella species isolates had a high prevalence of resistance to commonly used antibiotics such as tetracycline, ampicillin and trimethoprim-sulfamethoxazole. Results of antibiotic susceptibility testing of STEC revealed that 40 of 53 isolates (75.5%) were resistant to amoxicillin-clavulanic and tetracycline and 36 (67.9%) were resistant to trimethoprim-sulfamethoxazole, whereas none was resistant to ciprofloxacin, gentamicin, ceftazidime and ceftriaxone (Table 3). Although antimicrobial resistances are reported for the STEC isolates, antibiotics are not used for treatment of STEC infections; rather, these results are reported for epidemiological tracking purposes only. Of the EPEC isolates, 19 (54.3%) were resistant to trimethoprim-sulfamethoxazole; however, all were susceptible to nalidixic acid, ciprofloxacin, gentamicin, ceftazidime and ceftriaxone. Of 45 EAEC isolates, 32 (71.1%) and 27 (60%) were resistant to trimethoprim-sulfamethoxazole and ampicillin, respectively. The percentages of ETEC isolates resistant to ampicillin, amoxicillin-clavulanic acid, streptomycin and trimethoprim-sulfamethoxazole were 60% (n=12), 60% (n=12), 50% (n=10) and 60% (n=12), respectively, and 20% were resistant to nalidixic acid and ciprofloxacin (Table 3). Shigella species isolates had the highest rates of resistance to tetracycline (95%) and trimethoprim-sulfamethoxazole (91.7%), and more than 90% of Shigella species isolates were susceptible to cefixime, ceftriaxone, ceftazidime, nalidixic acid, gentamicin, ciprofloxacin and ampicillin-sulbactam (P<0.05) (Table 3). Eighty-five of 88 S sonnei isolates (96.5%) were resistant to tetracycline and trimethoprim-sulfamethoxazole, and 66 (75%) to erythromycin (75.1%). All the S sonnei and Shigella flexneri isolates were susceptible to chloramphenicol, ceftazidime and gentamicin, and 94.7% and 98.8% of the isolates were susceptible to nalidixic acid and ampicillin-sulbactam, respectively (Table 4).
TABLE 3.
Antimicrobial resistance of Escherichia coli isolates from children with acute diarrhea in Tehran, Iran
| E coli |
Resistance, n (%) |
|||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AMP | AMC | CHL | CRO | CAZ | GEN | CIP | TET | NAL | STR | SXT | CHL | CIP | SAM | |
| EPEC | 16 (45.7) | 13 (37.1) | 7 (20) | 0 | 0 | 0 | 0 | 13 (37.1) | 0 | 8 (22.8) | 19 (54.3) | 8 (9) | 0 | 1 (1.2) |
| STEC | 35 (66) | 40 (75.5) | 32 (60.4) | 0 | 0 | 0 | 0 | 40 (75.5) | 1 (1.9) | 33 (62.3) | 36 (67.9) | 23 (47.9) | 0 | 0 |
| EAEC | 27 (60) | 23 (51.1) | 16 (35.5) | 0 | 1 (2.2) | 2 (4.5) | 1 (2.2) | 26 (57.8) | 3 (6.7) | 23 (51.1) | 32 (71.1) | 1 (7.6) | 0 | 0 |
| ETEC | 12 (60) | 12 (60) | 1 (5) | 0 | 4 (20) | 6 (30) | 4 (20) | 9 (45) | 4 (20) | 10 (50) | 12 (60) | 0 | 0 | 0 |
AMC Amoxicillin-clavulanic acid; AMP Ampicillin; CAZ Ceftazidime; CHL Chloramphenicol; CIP Ciprofloxacin; CRO Ceftriaxone; EAEC Enteroaggregative Escherichia coli; EPEC Enteropathogenic E coli; ETEC Enterotoxigenic E coli; GEN Gentamicin; NAL Naldixic acid; SAM Ampicillin-sulbactam; STEC Shiga toxin-producing E coli; STR Streptomycin; SXT Trimethoprim-sulfamethoxazole; TET Tetracycline
TABLE 4.
Antimicrobial resistance of Shigella species isolates from children with acute diarrhea in Tehran, Iran
| Shigella serotype |
Resistance, n (%) |
|||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ERY | CEF | CFM | CRO | TET | AMP | CAZ | SXT | NAL | AMC | GEN | CHL | CIP | SAM | |
| S sonnei | 66 (75) | 26 (29.5) | 1 (1.1) | 0 | 85 (96.5) | 50 (56.8) | 0 | 85 (96.5) | 2 (2.3) | 27 (30.6) | 0 | 8 (9) | 0 | 1 (1.2) |
| S flexneri | 29 (60) | 4 (8.3) | 0 | 0 | 46 (95.8) | 23 (47.9) | 0 | 42 (87.5) | 0 | 26 (54.1) | 2 (4.0) | 23 (47.9) | 0 | 0 |
| S boydii | 11 (84) | 6 (38.4) | 0 | 0 | 11 (84.6) | 5 (38.4) | 0 | 10 (76.9) | 2 (15.4) | 8 (61.5) | 0 | 1 (7.6) | 0 | 0 |
| S dysenteriae | 6 (75) | 1 (12.5) | 0 | 0 | 8 (100) | 3 (37.5) | 0 | 7 (87.5) | 0 | 1 (12.5) | 0 | 0 | 0 | 0 |
AMC Amoxicillin-clavulanic acid; AMP Ampicillin; CAZ Ceftazidime; CEF Cephalothin; CFM Cefixime; CHL Chloramphenicol; CIP Ciprofloxacin; CRO Ceftriaxone; ERY Erythromycin; GEN Gentamicin; NAL Nalidixic acid; SAM Ampicillin-sulbactam; SXT Trimethoprim-sulfamethoxazole; TET Tetracycline
Resistance to more than four antibiotics was observed in 40.6% (n=62) of strains of the diarrheagenic E coli isolates, and eight (5.2%) were resistant to more than six antibiotics (Table 5). The predominant multidrug resistance pattern in these isolates (13.7%) was ampicillin, amoxicillin-clavulanic, chloramphenicol, tetracycline, trimethoprim-sulfamethoxazole and streptomycin (P<0.05). Four E coli isolates were resistant to nine antibiotics (Table 5). According to the definition of multidrug resistance by Lockhart et al (21), five E coli isolates were multi-drug resistant. These isolates were resistant to at least eight antimicrobials from three classes. Of these isolated, four were ETEC and only one of them was among EAEC isolates (Table 6).
TABLE 5.
Distribution of resistance patterns among Escherichia coli strains isolated from children with acute diarrhea in Tehran, Iran, from May 2003 to May 2005
| Antibiotics | STEC | EPEC | EAEC | ETEC | Total | Percentage ofE coliisolates |
|---|---|---|---|---|---|---|
| AMP, TET, SXT, STR | 0 | 1 | 1 | 0 | 2 | 1.3 |
| AMP, AMC, SXT, STR | 3 | 0 | 1 | 1 | 5 | 3.3 |
| AMP, AMC, CHL, SXT | 1 | 0 | 0 | 0 | 1 | 0.7 |
| AMP, AMC, TET, SXT | 1 | 0 | 1 | 0 | 2 | 1.3 |
| AMP, AMC, TET, STR | 0 | 0 | 0 | 1 | 1 | 0.7 |
| AMP, AMC, CHL, TET | 5 | 0 | 1 | 0 | 6 | 3.9 |
| CHL, TET, SXT, STR | 1 | 0 | 0 | 0 | 1 | 0.7 |
| AMP, CHL, TET, STR | 1 | 0 | 0 | 0 | 1 | 0.7 |
| AMP, AMC, CHL, TET, STR | 2 | 0 | 0 | 0 | 2 | 1.3 |
| AMP, CHL, TET, SXT, STR | 0 | 0 | 2 | 0 | 2 | 1.3 |
| AMP, AMC, CHL, SXT, STR | 0 | 0 | 3 | 0 | 3 | 2.0 |
| AMP, AMC, TET, SXT, STR | 1 | 0 | 2 | 1 | 4 | 2.6 |
| CHL, TET, SXT, AMC, STR | 1 | 0 | 0 | 0 | 1 | 0.7 |
| AMP, AMC, CHL, NAL, TET, SXT | 1 | 0 | 0 | 0 | 1 | 0.7 |
| AMP, CHL, NAL, TET, SXT, STR | 0 | 0 | 1 | 0 | 1 | 0.7 |
| AMP, AMC, CHL, TET, SXT, STR | 15 | 1 | 5 | 0 | 21 | 13.7 |
| AMP, AMC, CHL, GEN, TET, SXT, STR | 0 | 0 | 0 | 1 | 1 | 0.7 |
| AMP, AMC, GEN, NAL, TET, SXT, STR | 0 | 0 | 1 | 1 | 2 | 1.3 |
| AMP, AMC, CAZ, GEN, CIP, TET, SXT, STR | 0 | 0 | 0 | 1 | 1 | 0.7 |
| AMP, AMC, CAZ, GEN, NAL, CIP, TET, SXT, STR | 0 | 0 | 1 | 3 | 4 | 2.6 |
| Total | 32 | 2 | 19 | 9 | 62 | 40.4 |
AMC Amoxicillin-clavulanic acid; AMP Ampicillin; CAZ Ceftazidime; CHL Chloramphenicol; CIP Ciprofloxacin; CRO Ceftriaxone; EAEC Enteroaggregative Escherichia coli; EPEC Enteropathogenic E coli; ETEC Enterotoxigenic E coli; GEN Gentamicin; NAL Naldixic acid; SAM Ampicillin-sulbactam; STEC Shiga toxin-producing E coli; STR Streptomycin; SXT Trimethoprim-sulfamethoxazole; TET Tetracycline
TABLE 6.
Multidrug-resistant Escherichia coli strains isolated from children with acute diarrhea
| Antibiotics | STEC | EPEC | EAEC | ETEC | Total |
|---|---|---|---|---|---|
| AMP, AMC, CAZ, GEN, CIP, TET, SXT, STR | 0 | 0 | 0 | 1 | 1 |
| AMP, AMC, CAZ, GEN, NAL, CIP, TET, SXT, STR | 0 | 0 | 1 | 3 | 4 |
| Total | 0 | 0 | 1 | 4 | 5 |
AMP Ampicillin; AMC Amoxicillin-clavulanic acid; CAZ Ceftazidime; CIP Ciprofloxacin; EAEC Enteroaggregative Escherichia coli; EPEC Enteropathogenic E coli; ETEC Enterotoxigenic E coli; GEN Gentamicin; NAL Naldixic acid; STEC Shiga toxin-producing E coli; STR Streptomycin; SXT Trimethoprim-sulfamethoxazole TET Tetracycline
Ninety-one (57.9%) Shigella species isolates were resistant to more than four antibiotics, with 16 resistant to six antibiotics (Table 7). S sonnei had the greatest percentage of multidrug-resistant isolates, with 53 (58%) resistant to more than four antibiotics. Eight (16.6 %) S flexneri isolates were resistant to six antibiotics, and one was resistant to seven (Table 7). All the Shigella boydii isolates were susceptible to ceftazidime, gentamicin, ceftriaxone, ciprofloxacin and ampicillin-sulbactam; however, two isolates were resistant to six antibiotics. Eleven (84.6%) S boydii and all eight Shigella dysenteriae isolates were resistant to tetracycline (Table 4). In addition, more than 90% of Shigella isolates were susceptible to cefixime, ceftriaxone, ceftazidime, nalidixic acid, gentamicin, ciprofloxacin and ampicillin-sulbactam, and all Shigella species isolates were susceptible to ciprofloxacin. Among the diarrheagenic isolates, 58% of Shigella species and 40% of E coli were resistant to more than four antibiotics. No Shigella species isolated categorized as multidrug-resistance by this definition.
TABLE 7.
Distribution of resistance patterns among Shigella species isolated from children with acute diarrhea in Tehran, Iran, from May 2003 to May 2005
| Antibiotic | S flexneri | S sonnei | S dysenteriae | S boydii | Total | Percentage ofShigellaisolates |
|---|---|---|---|---|---|---|
| ERY, TET, AM, SXT | 2 | 16 | 1 | 0 | 19 | 12 |
| ERY, TET, AM, AMC | 1 | 0 | 1 | 1 | 3 | 1.9 |
| CEF, TET, AMP, SXT | 1 | 1 | 1 | 0 | 3 | 1.9 |
| ERY, TET, AMC, CHL | 1 | 0 | 0 | 0 | 1 | 0.6 |
| ERY, TET, SXT, AMC | 2 | 2 | 0 | 0 | 4 | 2.5 |
| ERY, TET, SXT, CHL | 3 | 0 | 0 | 0 | 3 | 1.9 |
| TET, SXT, AMC, CHL | 2 | 1 | 0 | 0 | 3 | 1.9 |
| TET, AMP, SXT, AMC | 1 | 2 | 0 | 0 | 3 | 1.9 |
| ERY, CEF, TET, SXT | 0 | 4 | 0 | 0 | 4 | 2.5 |
| ERY, CEF, TET, AMP, AMC | 0 | 1 | 0 | 1 | 2 | 1.3 |
| ERY, CEF, TET, SXT, AMC | 0 | 3 | 0 | 1 | 4 | 2.5 |
| ERY, TET, AMP, SXT, AMC | 0 | 6 | 0 | 1 | 7 | 4.5 |
| TET, AMP, SXT, AMC, CHL | 6 | 0 | 0 | 0 | 6 | 3.8 |
| ERY, TET, AMP, SXT, CHL | 1 | 3 | 0 | 0 | 4 | 2.5 |
| CEF, TET, AMP, SXT, AMC | 0 | 4 | 0 | 0 | 4 | 2.5 |
| ERY, CEF, CFM, TET, SXT | 0 | 1 | 0 | 0 | 1 | 0.6 |
| ERY, CEF, TET, AMP, SXT | 0 | 3 | 0 | 0 | 3 | 1.9 |
| ERY, CEF, TET, AMP, SXT, AMC | 1 | 3 | 0 | 1 | 5 | 3.1 |
| ERY, TET, AMP, SXT, NAL, CHL | 0 | 0 | 0 | 1 | 1 | 0.6 |
| ERY, TET, AMP, SXT, AMC, CHL | 7 | 1 | 0 | 0 | 8 | 5.1 |
| ERY, CEF, TET, AMP, AMC, CHL | 0 | 1 | 0 | 0 | 1 | 0.6 |
| ERY, CEF, TET, AMP, SXT, CHL | 0 | 1 | 0 | 0 | 1 | 0.6 |
| ERY, CEF, TET, AMP, SXT, AMC, CHL | 1 | 0 | 0 | 0 | 1 | 0.6 |
| Total | 29 | 53 | 3 | 6 | 91 | 57.5 |
AMC Amoxicillin-clavulanic acid; AMP Ampicillin; CAZ Ceftazidime; CEF Cephalothin; CFM Cefixime; CHL Chloramphenicol; CIP Ciprofloxacin; CRO Ceftriaxone; ERY Erythromycin; GEN Gentamicin; NAL Nalidixic acid; SAM Ampicillin-sulbactam; SXT Trimethoprim-sulfamethoxazole; TET Tetracycline
DISCUSSION
The present study provides results of prevalence and antibiotic resistance patterns of diarrheagenic E coli and Shigella species isolates from children younger than five years of age with acute diarrhea in Iran. E coli (305 isolates [54%]) and Shigella species (157 isolates [27.8%]) were the most prevalent bacterial enteric pathogens isolated. These results are in the agreement with previous studies in which diarrheagenic E coli and Shigella species were identified as the most common bacterial enteric pathogens in Iran (18,22). Other isolated bacteria (Campylobacter [10.6%] and Salmonella [7.45%]) were less commonly associated with acute diarrheal illness in Iran than the diarrheagenic E coli and Shigella species (18,23,24) (P<0.05).
Determining the prevalence of diarrheal pathogens should save the way for better control of the disease in the country. Continued vigilance of the safety of food, health education of food handlers, and close attention to hygiene and sanitary conditions can provide an effective barrier against the spread of shigellosis (25). The antimicrobial resistance may be as a result of inappropriate and wide use of different antibiotics to treat infection.
Resistance to currently used antimicrobial agents among enteric pathogens has increased dramatically worldwide during the past decade (24,26,27). In developing countries, trimethoprim-sulfamethoxazole, ampicillin and tetracycline are widely used to treat diarrhea because of their low cost and availability (8). The widespread use of these antibiotics has resulted in an increased prevalence of resistance to these antibiotics by diarrheagenic bacteria, thereby raising concern among general practitioners and pediatricians, especially in developing countries (28).
Studies in Vietnam revealed 86.4%, 77.2% and 19.1% of E coli isolates were resistant to ampicillin, chloramphenicol and trimethoprim-sulfamethoxazole, respectively (8), whereas in Egypt the occurrence of antibiotic resistance among E coli isolates from patients with acute diarrhea was 68.2%, 57.2% and 24.2% for ampicillin, trimethoprim-sulfamethoxazole and ampicillin-sulbactam, respectively (29).
According to the United States Centers for Disease Control and Prevention National Antimicrobial Resistance Monitoring System for Enteric Bacteria in 2004 (www.cdc.gov/narms), the percentage of S sonnei isolates resistant to trimethoprimsulfa-methoxazole and tetracycline increased from 38.5% and 22.1%, respectively, in 2003 to 53.1% and 36.1%, respectively, in 2004. Resistance of S flexneri isolates to trimethoprimsulfa-methoxazole also increased from 28.8% in 2002 to 45.9% in 2004. Overall, in all years from 1999 to 2004, more than 90% of Shigella isolates tested was resistant to at least one Clinical and Laboratory Standards Institute subclass.
In addition, a report from Iran cited by the World Health Organization indicates that sulfamethoxazole-trimethoprim, tetracycline and chloramphenicol were the least effective antibiotics since 112 (80.0%), 90 (64.3%) and 78 (55.7%) of the diarrheagenic E coli isolates were resistant to these antibiotics, respectively (30). Approximately 95% of Shigella species isolates in our study was resistant to tetracycline and 91.7% to trimethoprim-sulfamethoxazole. Comparing our data with previous reports from Iran reveals the same resistance pattern to commonly used antimicrobials such as tetracycline, sulfamethoxazole-trimethoprim and ampicillin, except resistance to chloramphenicol. Results from our study indicate the sensitivity of the most recent isolates to chloramphenicol has increased as all diarrheagenic E coli, S dysenteriae and S boydii isolates were sensitive to chloramphenicol previously.
Our findings are in agreement with reports of others in Iran indicating diarrheagenic E coli and Shigella isolates are resistant to trimethoprim-sulfamethoxazole, tetracycline and erythromycin (9,18). However, our results indicate higher rates of resistance to commonly used antibiotics and the emergency of isolates resistant to more than six antibiotics compared with reports from Iran and other countries. These findings illustrate the need for an ongoing monitoring system for antimicrobial resistance in Iran. Many studies have determined that multi-drug resistance is common among Shigella and E coli isolates, especially to ampicillin and trimethoprim-sulfamethoxazole which are frequently used to treat shigellosis (31–33). In these cases, ampicillin, trimethoprim-sulfamethoxazole and tetracycline should be excluded for the treatment of diarrhea and quinolones, to which these isolates E coli and Shigella species were susceptible, can be used as an alternative treatment.
Our study revealed a high prevalence of multidrug antibiotic resistance among Shigella and E coli isolates to the antibiotics most frequently used to treat diarrheal illnesses in Iran (P<0.05). The emergence of multidrug resistance requires continuous monitoring of the resistance patterns and the development and implementation of best practices strategies for antibiotic usage to extend the efficacy of the few effective antibiotics that remain.
The pattern of antibiotic resistance was monitored for Shigella and diarrheagenic E coli isolates. According to the definition of multidrug resistance by Lockhart et al (21), five E coli isolates were multidrug resistant. These isolates were resistant to at least eight antibiotics from three classes (one extended-spectrum cephalosporin, one aminoglycoside and ciprofloxacin) (21). It is quite unique finding in that similar trend in antimicrobial resistance of diarrheagenic pathogens, and has not been observed in Iran. This may be due to inappropriate use of antimicrobials especially in blind cases. The changing patterns of resistance to common antimicrobial agents in Iran indicates that designing a surveillance system for antimicrobial resistance and the introduction of integrated guidelines for the appropriate use of antibiotics are urgently needed. The result of this study suggests antimicrobial resistance is widespread among diarrheagenic E coli strains.
Acknowledgments
This project was supported by Research Center for Gastroenterology and Liver Diseases in Shaheed Beheshti University, M.C., Tehran, Iran. The authors thank Ms N Hosseinkhan, Dr P Kharaziha, Mr M Yaghobi and Mr MA Pourhoseingholi for technical help, and Dr MM Aslani and Dr H Dabiri for critical discussion.
REFERENCES
- 1.Wilson G, Easow JM, Chiranjoy M, Shivananda PG. Isolation and antimicrobial susceptibility of Shigella from patients with acute gastroenteritis in western Nepal. Indian J Med Res. 2006;123:146–50. [PubMed] [Google Scholar]
- 2.Jousilahti P, Madkour S M, Lambrechts T, Sherwin E. Diarrhoeal disease morbidity and home treatment practices in Egypt. Public Health. 1997;111:5–10. doi: 10.1038/sj.ph.1900318. [DOI] [PubMed] [Google Scholar]
- 3.Salmanzadeh-Ahrabi S, Habibi E, Jafari F, Zali MR. Molecular epidemiology of Escherichia coli diarrhoea in children in Tehran. Ann Trop Paediatr. 2005;25:35–9. doi: 10.1179/146532805X23335. [DOI] [PubMed] [Google Scholar]
- 4.Soltan Dallal MM, Moezardalan K. Aeromonas spp associated with children’s diarrhoea in Tehran: A case-control study. Ann Trop Paediatr. 2004;24:45–51. doi: 10.1179/027249304225013231. [DOI] [PubMed] [Google Scholar]
- 5.Cao V, Lambert T, Nhu DQ, Loan HK, Hoang NK, Arlet G, Courvalin P. Distribution of extended-spectrum beta-lactamases in clinical isolates of Enterobacteriaceae in Vietnam. Antimicrob Agents Chemother. 2002;46:3739–43. doi: 10.1128/AAC.46.12.3739-3743.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Isenbarger DW, Hoge CW, Srijan A, Pitarangsi C, Vithayasai N, Bodhidatta L, Hickey KW, Cam PD. Comparative antibiotic resistance of diarrheal pathogens from Vietnam and Thailand, 1996–1999. Emerg Infect Dis. 2002;8:175–80. doi: 10.3201/eid0802.010145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Lee WS. Gastrointestinal infections in children in the Southeast Asia Region: Emerging issues. Review J Ped Gastroenterol Nutr. 2000;30:241–5. doi: 10.1097/00005176-200003000-00006. [DOI] [PubMed] [Google Scholar]
- 8.Nguyen TV, Le PV, Le Ch H, Weintraub A. Antibiotic resistance in diarrheagenic Escherchia coli and Shigella strains isolated from children in Hanoi, Vietnam. Antimicrob Agents Chemother. 2005;49:816–9. doi: 10.1128/AAC.49.2.816-819.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Rahbar M, Deldari M, Hajia M.Changing prevalence and antibiotic susceptibility patterns of different Shigella species in Tehran, Iran Int J Microbiol 2007. <http://www.ispub.com/ostia/index.php?xmlFilePath=journals/ijmb/vol3n2/shigella.xml> (Version current at March 25, 2009).
- 10.Mansouri S, Shareifi S. Antimicrobial resistance pattern of Escherichia coli causing urinary tract infections, and that of human fecal flora, in the Southeast of Iran. Microbial Drug Resistance. 2002;8:123–8. doi: 10.1089/107662902760190662. [DOI] [PubMed] [Google Scholar]
- 11.World Health Organization Shigella<www.who.int/vaccineresearch/disease/-shigella/en> (Version current at March 25, 2009).
- 12.Navia MM, Capitano L, Ruiz J, et al. Typing and characterization of mechanisms of resistance of Shigella species. isolated from feces of children under 5 years of age from Ifakara, Tanzania. J Clin Microbiol. 1999;37:3113–7. doi: 10.1128/jcm.37.10.3113-3117.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Jamal WY, Rotimi VO, Chugh TD, Pal T. Prevalence and susceptibility of Shigella species to 11 antibiotics in a Kuwait teaching hospital. J Chemother. 1998;10:285–90. doi: 10.1179/joc.1998.10.4.285. [DOI] [PubMed] [Google Scholar]
- 14.Sonawala M, Saraswathi K, Deodhar LP. Serogroup prevalence of shigellae in Bombay. J Postgrad Med. 1995;41:104–6. [PubMed] [Google Scholar]
- 15.Kell YM T, Brenner DJ, Farmer JJ., III . Enterobacteriaceae. In: Clennette EH, Ballows A, Tausler WJ Jr, Shadomy HJ, editors. Manual of clinical microbiology. 4th edn. Washington: ASM Press; 1985. pp. 263–77. [Google Scholar]
- 16.Olsvik O, Strockbine NA. PCR detection of heat-stable, heat-labile and shiga-like toxin genes in Escherichia coli. In: Persing DH, Smith TH, Tenover F, White TJ, editors. Diagnostic molecular microbiology-Principles and applications. Washington: ASM Press; 1993. pp. 271–76. [Google Scholar]
- 17.Frankel G, Giron JA, Valmassoi J, Schoolnik GK. Multi-gene amplification: Simultaneous detection of three virulence genes in diarrhoeal stool. Mol Microbiol. 1989;3:1729–34. doi: 10.1111/j.1365-2958.1989.tb00158.x. [DOI] [PubMed] [Google Scholar]
- 18.Moezardalan K, Zali MR, Soltan Dallal MM, Salmanzade-Ahrabi S. Prevalence and pattern of antimicrobial resistance of Shigella species among patients with acute diarrhea in Karaj, Tehran, Iran. J Health Popul Nutr. 2003;21:96–102. [PubMed] [Google Scholar]
- 19.Bopp CA, Brenner FW, Wells JG, Strockbine NA. Escherichia, Shigella, and Salmonella. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, editors. Manual of Clinical Microbiology. 7th edn. American Society for Microbiology; Washington: 1999. pp. 459–74. [Google Scholar]
- 20.Clinical and Laboratory Standards Institute . Performance standards for antimicrobial susceptibility testing. Sixteenth Informational Supplement CLSI Document M100-S16. Wayne: Clinical and Laboratory Standards Institute; 2006. [Google Scholar]
- 21.Lockhart SR, Abramson MA, Beekmann SE, et al. Antimicrobial resistance among Gram-negative bacilli causing infections in intensive care unit patients in the United States between 1993 and 2004. J Clin Microbial. 2007;45:3352–9. doi: 10.1128/JCM.01284-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Alizadeh AH, Behrouz N, Salmanzadeh S, et al. Escherichia coli, Shigella and Salmonella species in acute diarrhoea in Hamedan, Islamic Republic of Iran. East Mediterr Health J. 2007;13:243–9. [PubMed] [Google Scholar]
- 23.Keskima M, Mattila L, Peltola IH, Sittonen A. Prevalence of diarrheagenic Escherichia coli in Finns with or without diarrhea during a round-the-world trip. J Clin Microbiol. 2000;38:4425–9. doi: 10.1128/jcm.38.12.4425-4429.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Salmanzdeh-Ahrabi S, Jafari F, Habibi E, et al. Serotype distribution and antimicrobial resistance rates of Shigella spp. isolates in Tehran, Iran. Mikrobiyol Bul. 2007;41:453–7. [PubMed] [Google Scholar]
- 25.Jafari F, Shokrzadeh L, Hamidian M, Salmanzadeh-Ahrabi S, Zali MR. Acute diarrhea due to enteropathogenic bacteria in patients at hospitals in Tehran. Jpn J Infect Dis. 2008;61:269–73. [PubMed] [Google Scholar]
- 26.Temu MM, Kaatano GM, Miyaye ND, et al. Antimicrobial susceptibility of S. flexneri and S. dysenteriae isolated from stool specimens of patients with bloody diarrhoea in Mwanza, Tanzania. Tanzan. Health Res Bull. 2007;9:186–9. [PubMed] [Google Scholar]
- 27.Woodward DL, Rodgers FG. Surveillance of antimicrobial resistance in Salmonella, Shigella and Vibrio cholerae in Latin America and the Caribbean: A collaborative project. Can J Infect Dis. 2000;11:181–6. doi: 10.1155/2000/743969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Vila J, Vargas M, Casals C, et al. Antimicrobial resistance of diarrheagenic Escherichia coli isolated from children under the age of 5 years from Ifakara, Tanzania. Antimicrob Agents Chemother. 1999;31:3022–4. doi: 10.1128/aac.43.12.3022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Putnam SD, Riddle MS, Wierzba TF, Pittner BT, Elyazeed RA. Antimicrobial susceptibility trends among Escherichia coli and Shigella spp. isolated from rural Egyptian paediatric populations with diarrhoea between 1995 and 2000. Clin Microbiol Infect. 2004;10:804–10. doi: 10.1111/j.1469-0691.2004.00927.x. [DOI] [PubMed] [Google Scholar]
- 30.Bouzari S, Jafari A, Zarepoor M. Distribution of genes encoding toxins and antibiotic resistance patterns in diarrheagenic Escherichia coli isolates in Tehran. East Med Heath J. 2007;13:287–293. [PubMed] [Google Scholar]
- 31.Lolekha S, Vibulbandhitkit S, Poonyarit P. Response to antimicrobial therapy for shigellosis in Thailand. Rev Infect Dis. 1991;13(Suppl 4):S342–6. doi: 10.1093/clinids/13.supplement_4.s342. [DOI] [PubMed] [Google Scholar]
- 32.Hoge CW, Gambel JM, Srijan A, Pitarangsi C, Echeverria P. Trends in antibiotic resistance among diarrheal pathogens isolated in Thailand over 15 years. Clin Infect Dis. 1998;26:341–5. doi: 10.1086/516303. [DOI] [PubMed] [Google Scholar]
- 33.Aslani MM, Salmanzadeh-Ahrabi S, Alikhani MY, Jafari F, Zali MR. Molecular detection and antimicrobial resistance of diarrheagenic Escherichia coli strains from diarrheal cases. Sauci J Biol Sci. 2008;20:388–92. [PubMed] [Google Scholar]