Determination of Helicobacter pylori virulence by analysis of the cag pathogenicity island isolated from Iranian population

Abstract

Background

The cag pathogenicity island (PAI), which can divide into two parts: cagI and cagII, is the most well-known virulence factor of Helicobacter pylori.

Aims

We investigated the association between genetic variations within the cag PAI (cagA and cagE in the cagI and cagT in the cagII) and clinical outcomes in Iranian population.

Subjects

A total of 231 patients including 182 patients with gastritis, 41 with peptic ulcer and 8 with gastric cancer.

Methods

The presences of the cagA, cagE and cagT genes were measured by polymerase chain reaction and the results were compared with clinical outcomes and gastric histology.

Results

The cagA, cagE and cagT genes were found in 154 (66.7%), 90 (39.0%) and 70 (30.3%) of clinical isolates. At least 144 (62.3%) strains possessed partially deleted cag PAI (e.g., 69 [29.9%] strains were cagA-positive, but cagE and cagT-negative).

Conclusion

The simple gene as well as the combination of the genes in the cag PAI appeared not to be useful markers to predict H. pylori-related diseases in Iranian population. The genomic sequences of the cag PAI in Iranian strains might be considerably different from those in other geographic locations.

Introduction

Helicobacter pylori is an important pathogen for gastroduodenal diseases. In most cases, H. pylori infection causes an asymptomatic chronic gastric inflammation and is also the cause of severe gastroduodenal diseases in some infected persons, including chronic atrophic gastritis, peptic ulcers, and gastric adenocarcinoma (1).

Albeit the pathogenesis of H. pylori infection is not well understood, several virulence factors have been proposed and the best studied is the cag pathogenicity island (PAI) which is approximately 40 kilobase pair region (2). The cag PAI encodes a type IV secretion system, by which CagA is delivered into host cells (3-7). After the delivery into gastric epithelial cells, CagA is mainly tyrosine-phosphorylated at Glu-Pro-Ile-Tyr-Ala (EPIYA) motifs located in the 3′ region of cagA gene (8).

The cag PAI can divide into two parts: the upstream cagII region and the downstream cagI region (2). The cagA gene is located in the most downstream portion of cagI and is known as a marker for the cagI region. The cagA-positive strains are reported to be related to severe clinical outcomes, especially in Western countries (9-12). In contrast, most previous studies reported that there were no relationship between cagA status and clinical outcomes in Iranian population (13-18). The cagE gene is a homolog of the ptlF and virB4 genes of Bordetella pertussis and Agrobacterium tumefaciens, respectively, and is also located in the cagI, and is necessary to induce interleukin (IL)-8 from gastric epithelial cells (2). In previous studies, the cagE gene was reported to be a better marker for the cagI region than the cagA gene, and the cagE gene was more useful gene in discriminating between H. pylori strains causing different rates of disease progression than the cagA gene (19). CagT protein is found in the pilus of the type IV secretion system and the cagT gene has been reported to be a marker of the cagII region (20). The cagT-positive strains are also reported to be related to severe clinical outcomes (20;21).

These results indicate that investigating not only the cagA status, but also the cagE and cagT status should be necessary for understanding the roles of cag PAI in clinical outcomes; however there is currently no report investigating the importance of the cagE and cagT status on clinical outcomes in Iranian population. We therefore aimed to investigate the association between genetic variations within the two parts of the cag PAI (cagA and cagE in the cagI and cagT in the cagII) and clinical outcomes in Iranian population.

Methods

Population Studied

The patient group consisted of individuals coming to the Taleghani and Mehrad Hospitals in Tehran, Iran for investigation of dyspeptic symptom between April 2007 and January 2008. The study was explained to the 311 patients who received endoscopy by members of the local H. pylori research group. All eligible patients meeting inclusion criteria were entered.

Inclusion criteria included patients with H. pylori infection proven by the culture of H. pylori, patients with the absence of non-gastrointestinal chronic medical conditions and the absence of contraindications to upper gastrointestinal endoscopy, patients providing informed consent, and patients with willingness to complete a standardized data-collection form. Exclusions included patients with upper gastrointestinal bleeding, patients who had received non-steroidal anti-inflammatory drugs, steroids or proton pump inhibitors at least three months prior to endoscopy, patients who had received any antibiotics at least one month prior to endoscopy, and patients who had received previous treatment for H. pylori infection. Informed consent was obtained from all patients and the protocol was approved by the hospital ethics committee.

The clinical presentations recognized were H. pylori-related gastritis, gastric ulcers (GU), duodenal ulcers (DU), and non-cardiac gastric adenocarcinoma. Peptic ulcers were identified endoscopically. Gastric cancers were confirmed histologically and all were of the distal type and advanced. Gastritis was defined as histological gastritis without peptic ulcer diseases or gastric malignancy, or erosive esophagitis.

Histology

Three biopsy specimens were taken from the greater curve of the antrum; two were used for histological examination and one for H. pylori culture. Biopsy specimens for histology were fixed overnight in buffered formalin, embedded in paraffin, cut to 3-μm thickness, and stained with hematoxylin-eosin (H&E) for routine histological evaluation. The slides were blindly evaluated by two expert gastrointestinal pathologists. The degree of gastric mucosal inflammation (mononuclear cell infiltration), polymorphonuclear cell infiltration, glandular atrophy, and intestinal metaplasia were classified according to the Updated Sydney System (22).

Preparation of Genomic DNA

Gastric biopsy specimens for culture were kept in transport medium consisting of thyoglycolate with 1.3 g/L agar (Merck Co, Humbuerg, Germany) and 3% yeast extract (Oxoid Ltd., Basingstoke,. UK) and brought to the laboratory on the day of endoscopy. The specimens were cultured on Brain Heart Infusion agar with 10% (v/v) sheep blood and Campylobacter selective supplement (Merck Co, Humbuerg, Germany). The cultured plates were incubated at 37°C for 3 to 5 days under microaerobic conditions (5% O₂, 10% CO₂, 85% N₂) in CO₂ incubator ((Innova-Co 170; New Brunswick Scientific). The organisms were identified as H. pylori by colony morphology, Gram staining and positive reactions to oxidase, catalase, and urease activities. The identified H. pylori was then subcultured to single colonies for DNA extraction. DNA extraction from H. pylori isolates was performed using QIAamp tissue DNA extraction kit (Qiagen, Hilden, Germany).

Polymerase chain reaction amplification analysis

PCR analyses were carried out to determine the presence or absence of cagA, cagE, and cagT genes. The glmM (ureC) gene was used as controls for detecting H. pylori DNA. Primers sequences used in this study were listed in Table 1 (23;24). All PCR mixtures were performed in a total volume of 25 μL containing 10 × PCR buffer, 500 nM of each primer, 2 mM MgCl₂; 200 μM each dNTP, 1.5 U Taq DNA polymerase, and 200 ng DNA sample. The total volume was made up with autoclaved Milli-Q water (Eppendorf AG 22331, Hamburg, Germany). Amplification conditions were optimized in thermocycler as follows: initial denaturation for 5 min at 94°C was followed by 30 cycles of denaturation at 93°C for 1 min, annealing at 58°C, 57°C, and 60°C for cagA and glmM, cagE and cagT respectively for 30 seconds and extension at 72°C for 1 min. After a final extension at 72°C for 10 min, PCR products were visualized by electrophoresis in 1.2% agarose gel, stained with ethidium bromide, and examined under UV illumination. H. pylori 26695 DNA was used as a positive control for cag PAI-positive strain.

Table 1. PCR primers used in this study.

Gene	Primer designation	Sequence (5′-3′)	PCR product size (bp)	References
glmM	GlmM1-R	GCTTACTTTCTAACACTAACGCGC	296	(23)
	GlmM2-F	GGATAAGCTTTTAGGGGTGTTAGGGG
cagA	CagA F1	AACAGGACAAGTAGCTAGCC	349	(23)
	CagA R1	TATTAATGCGTGTGTGGCTG
cagE	cagE F	GTTACATCAAAAATAAAAGGAAGCG	733	(24)
	cagE R	CAATAATTTTGAAGAGTTTCAAACG
cagT	cagT F	TCTAAAAAGATTACGCTCATA	489	(24)
	cagT R	CTTTGGCTGCATGTTCAAGTTGCC

Data Analysis

Variables such as gender (male or female), mean age, frequencies of the cagA, cagE and cagT genes (negative or positive) were evaluated. Statistical differences in demographic characteristics among the different disease groups were determined by one-way ANOVA or the chi-square test. The univariate association between genotype status and clinical outcomes was quantified by the chi-square test and student t-test. The effects of the cagA, cagE and cagT status on the risk for developing gastric cancer and peptic ulcer in patients were expressed as odds ratios (ORs) with 95% confidence intervals (CIs) with reference to gastritis alone or mild gastritis alone subjects adjusted by age and sex. Analyses were performed using Sigma Stat for Windows V2.03 (SPSS, Chicago, IL). A p value of <0.05 was accepted as statistically significant.

Results

Patients

H. pylori was isolated from 231 patients including 95 men and 136 women with mean age of 43.9 years old (14 to 71 years old). Clinical presentations included 182 patients with gastritis, 16 with DU, 2 with GU, 23 with both DU and GU, and 8 with gastric cancer. Since the number of patients with both DU and GU were predominant among patients with peptic ulcer and the number of patients with GU was small, we combined patients with peptic ulcer as peptic ulcer (PUD) group in the subsequent analyses. There were no age and gender differences among different clinical outcomes (data not shown).

cagI markers

In 231 H. pylori-positive patients studied, 154 (66.7%) patients were infected with the cagA-positive strains (Table 2). The cagA gene was detected from 127 of 182 (69.7%) strains isolated from patients with gastritis, 22 of 41(53.6%) with peptic ulcer and 5 of 8 (62.5%) with gastric cancer. There was no significant relationship between the presence of the cagA gene and clinical outcomes both by univariate analyses (Table 2) and adjusted by age and sex (Table 3). We also classified the gastritis cases with no acute inflammation (polymorphonuclear cell infiltration), none to mild chronic inflammation (mononuclear cell infiltration) as well as no gastric atrophy/intestinal metaplasia as “mild gastritis”, and analyzed separately; however the prevalence of the cagA gene in strains isolated from patients with mild gastritis (76.5%: 26/34) was even higher than those with total gastritis as well as those with PUD and GC (Table 2), indicating that the cagA gene was not involved in the severity of gastritis. ORs adjusted by age and sex also showed that the presence of the cagA gene was independent of the risk for PUD and GC.

Table 2. Clinical outcomes and the presence of different genes in cagI and cagII.

	Gastritis (n = 182)	Mild gastritis (n = 34)	PUD (n = 41)	GC (n = 8)	Total (n = 231)
cagA+	127 (69.7%)	26 (76.5%)	22 (53.6%)	3 (62.5%)	154 (66.7%)
cagE+	71 (39.0%)	13 (38.2%)	18 (43.9%)	1 (12.5%)	90 (39.0%)
cagT+	53 (29.1%)	12 (35.3%)	15 (36.5%)	2 (25.0%)	70 (30.3%)
cagA+/cagE+/cagT+ (1)	32 (17.5%)	9 (28.1%)	8 (19.5%)	0 (0%)	40 (17.3%)
cagA+/cagE-/cagT+ (2)	12 (6.5%)	2 (5.9%)	2 (4.8%)	1 (12.5%)	15 (6.4%)
cagA-/cagE+/cagT+ (2)	3 (1.6%)	0 (0.0%)	1 (2.4%)	1 (12.5%)	5 (2.1%)
cagA-/cagE-/cagT+ (2)	6 (3.3%)	1 (2.9%)	4 (9.8%)	0 (0.0%)	10 (4.3%)
cagA+/cagE+/cagT- (3)	24 (13.2%)	3 (8.8%)	6 (14.6%)	0 (0.0%)	30 (13.0%)
cagA-/cagE+/cagT- (3)	12 (6.6%)	1 (2.9%)	3 (7.3%)	0 (0.0%)	15 (6.5%)
cagA+/cagE-/cagT- (3)	59 (32.4%)	12 (35.3%)	6 (14.6%)	4 (50%)	69 (29.9%)
cagA-/cagE-/cagT- (4)	34 (18.7%)	6 (17.6%)	11 (26.8%)	2 (25%)	47 (20.3%)

Mild gastritis was defined as gastritis with no acute inflammation, none to mild chronic inflammation as well as no gastric atrophy/intestinal metaplasia.

cagA+: cagA-positive, cagA-: cagA-negative, cagE+: cagE-positive, cagE-: cagE-negative, cagT+: cagT-positive, cagT-: cagT-negative

(1) cagA+/cagE+/cagT+ = triple-positive

(2) cagI+/cagII+, but one of cagI gene was negative

(3) cagI+/cagII-

(4) all negative (cagI-/cagII-) = triple-negative

Table 3. Age and sex-adjusted risks for PUD and GC in relation to cagI and cagII.

	PUD (n = 41)			GC (n = 8)
	OR	95% CI	p value	OR	95% CI	p value
vs. Gastritis patients (n = 182)
cagA+ vs. cagA-	0.55	0.27-1.10	0.092	0.73	0.17-3.16	0.669
cagE+ vs. cagE-	1.27	0.64-2.55	0.465	0.22	0.03-1.82	0.159
cagT+ vs. cagT-	1.42	0.69-2.91	0.344	0.81	0.17-4.13	0.791
vs. mild gastritis patients (n = 34)
cagA+ vs. cagA-	0.36	0.13-1.13	0.066	0.39	0.06-2.36	0.303
cagE+ vs. cagE-	1.31	0.49-3.47	0.588	0.13	0.01-1.47	0.100
cagT+ vs. cagT-	0.92	0.34-2.49	0.869	0.522	0.08-3.40	0.497

Mild gastritis was defined as gastritis with no acute inflammation, none to mild chronic inflammation as well as no gastric atrophy/intestinal metaplasia.

cagA+: cagA-positive, cagA-: cagA-negative, cagE+: cagE-positive, cagE-: cagE-negative, cagT+: cagT-positive, cagT-: cagT-negative

OR: odds ratio adjusted by age and sex, CI, confidence interval

The cagE gene was found in 39.0% (90/231) of clinical isolates. The prevalence of the cagE gene was 39.0% (71/182) in strains from patients with gastritis and 43.9% (18/41) with peptic ulcers. Only one out of the 8 patients with gastric cancer (12.5%) was found to be cagE-positive. As similar to the cagA gene, there was no relationship between the presence of the cagE gene and clinical outcomes or the severity of gastritis both by univariate analyses (Table 2) and adjusted by age and sex (Table 3).

cagII marker

The cagT gene as a cagII marker was present in 30.3% (70/231) of clinical isolates. The cagT gene was detected in 29.1% (53/182) of strains from patients with gastritis and in 36.6% (15/41) with peptic ulcer. The cagT gene was detected in 25% (2/8) of strains from gastric cancer patients. As similar to two cagI genes described above, there was no relationship between the presence of the cagT gene and clinical outcomes or the severity of gastritis both by univariate analyses (Table 2) and adjusted by age and sex (Table 3).

Combination of cagI and II with clinical outcome

Coexistence of cagI and II (i.e., positive for cagA, cagE and cagT: triple-positive) were found in 17.3% (40 of 231) of the isolates (Table 2). These triple-positive strains were detected in 19.5% (8 of 41) of isolates from patients with peptic ulcer and 17.5% (32 of 182) from patients with gastritis. There were no patients with gastric cancer who were infected with triple-positive strains. Strains lacking both cagI and cagII (i.e., cagA-/cagE-/cagT-: triple-negative) were deleted in 20.3% (47 of 231) of isolates from patients including 18.7% (34 of 182) with gastritis, 26.8% (11 of 41) with peptic ulcer and 25% (2 of 8) with gastritis cancer (Table 2). At least 62.3% (144/231) of strains possessed the partially deleted cag PAI. However, there was no relationship between the combination of cagI and cagII and clinical outcomes or the severity of gastritis (P < 0.05).

Discussion

The profile of H. pylori cag PAI genes shows great variability worldwide. It has been reported that selective pressure induced by the host immune defenses in long-term infection with H. pylori besides different geographic factors leads to high genetic diversity in H. pylori strains that can be affected on phenotypic characters linked to the gastroduodenal diseases (25). Studies especially from European countries showed that the presence of the cagA gene is associated with severe clinical outcomes and patients infected with the cagA-positive strains are associated with denser colonization of H. pylori and a more marked gastric inflammatory response than those with the cagA-negative strains (26;27); however these observation was not confirmed in East Asian countries where most strains possess the cagA gene (28;29). We could not find the relationship between the cagA status and clinical outcomes in Iranian population, which was in agreement with previous studies in Iran (14;17;18). The cagA gene is reported to be sub-typed based on the number of sequences of the repeat region in the 3′ region of the cagA gene (30-32), and the cagA gene with multiple repeats and/or East Asian type repeats are reported to be more virulent than that with fewer repeats and/or Western type repeats (30;31;33). Further studies will be necessary whether the cagA sub-typing is involved in the development of clinical outcomes in Iranian population.

In previous studies, the cagE gene was reported to be a better marker for the cagI region than the cagA gene, and the cagE gene was more useful gene in discriminating between H. pylori strains causing different rates of disease progression than the cagA gene in Japanese (19). However, our data showed that the presence of the cagA gene could be used as a better marker for cagI region than that of the cagE gene, and we could not find the relationship between the cagE status and clinical outcomes in Iranian population. We also examined the cagT gene as a marker of the cagII region; however we could not find the relationship between the cagT status and clinical outcomes as similar to the cagA and the cagE genes. Overall, although the genes in cagI and cagII have been reported to be highly associated with the gastroduodenal diseases in some countries, the clinical outcomes of H. pylori infection is not reliably predicted by the three genes in cag PAI in Iranian population from Tehran Province. There are many factors such as host genetic factors, environmental factors, socio-economic status; irregular dietary habits besides H. pylori with cag PAI should contribute to the clinical outcomes of H. pylori infection.

Interestingly, at least 62.3% (144/231) of strains possessed partially deleted cag PAI. According to a previous study, the cag PAI genes were highly conserved in Japanese isolates, less conserved in European and African isolates, and very poorly conserved in Peruvian isolates and isolates from India (34). There is currently no information about the structures of the cag PAI in Iranian isolates. However, there was one report from Turkey (35) as a neighbor country of Iran that the structures of the cag PAI were poorly conserved. We therefore hypothesize that the structures of the cag PAI in Iranian strains might be similar to those of Turkish strains. The Iranian ancestral strains that including of intact cag PAI might undergo special condition in their gastric environments, and genetic rearrangements or DNA exchange might be occurred in the ancestral strains, which have evolved into genetically different subtypes. It is suggested that similar condition of life and diet in Iran and Turkey might affect on the selection of H. pylori with partial deleted cag PAI. Since we only used one set of PCR primers in each gene, there might yield false-negative results although the genes were present. However, we used well-known PCR primers used in other studies; therefore if this is the case, we might conclude that the genomic sequences of the cag PAI, especially the cagE and cagT genes in Iranian strains should be considerably different from those in other geographic locations. Further studies using several sets of PCR primers, Southern blot hybridization and/or sequence analyses should be necessary to further investigating the roles of the cag PAI in Iranian strains.