Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Jan 12.
Published in final edited form as: Inhal Toxicol. 2010 Jan;22(1):1–16. doi: 10.3109/08958370902838145

Modulation of ozone-sensitive genes in alpha-tocopherol transfer protein null mice

Vihas T Vasu 1, Saji Oommen 1,3, Yunsook Lim 1,4, Giuseppe Valacchi 1,5, Brad Hobson 1, Jason P Eiserich 1,2, Scott W Leonard 6, Maret G Traber 6, Carroll E Cross 1,2, Kishorchandra Gohil 1
PMCID: PMC2805035  NIHMSID: NIHMS151272  PMID: 19555225

Abstract

Alpha-tocopherol transfer protein (ATTP) null mice (ATTP−/−) have a systemic alpha-tocopherol (AT) deficiency, with their lung AT levels being < 10% of those in AT-replete ATTP+/+ mice when fed a standard rodent chow diet. ATTP+/+ and ATTP−/− mice (4 wk old male mice, n = 16 per group) were fed a standard diet (35 IU AT/kg diet) for 8–12 wk, exposed 6 h/day for 3 days to either to O3 (0.5 ppm) or filtered air, then sacrificed. No significant differences in plasma or lung AT concentrations were observed in response to this level of O3 exposure. Lung genomic responses of the lungs to O3 were determined using Affymetrix 430A 2.0 arrays containing over 22,600 probe sets representing 14,000 well-characterized mouse genes. As compared with filtered air exposure, O3 exposure resulted in 99 genes being differentially expressed in ATTP−/− mice, as compared to 52 differentially expressed genes in ATTP+/+ mice. The data revealed an O3-induced upregulation of genes related to cell proliferation/DNA repair and inflammatory-immune responses in both ATTP+/+ and ATTP−/− mice, with the expression of 22 genes being common to both, whereas 30 and 77 genes were unique to ATTP+/+ and ATTP−/− mice, respectively. The expressions of O3 sensitive genes—Timp1, Areg, Birc5 and Tnc—were seen to be further modulated by AT status. The present study reveals AT modulation of adaptive response of lung genome to O3 exposure.

Keywords: Alpha-tocopherol, alpha-tocopherol transfer protein null mice, gene expression profiling, oxidative stress, ozone, vitamin E

Introduction

Ozone (O3), the principal component of photochemical smog and a powerful highly reactive hydrophobic oxidant, forms peroxides, aldehydes, and lipid ozonation products (LOP) as a result of unsaturated fatty acid oxidation in biological systems (Pryor, 1992, 1994; Pryor et al., 1995). Upper respiratory tract lining fluids (RTLF) come into direct contact with inhaled O3, absorbing and detoxifying significant portions of inhaled O3, thereby reducing amounts of the inhaled toxin reaching more vulnerable peripheral gas exchange regions of the lung (Halliwell and Cross, 1994; Langford et al., 1995). Epidemiological studies have provided evidences that O3 exposures are related to adverse health effects, including exacerbations of respiratory-tract diseases (Tager et al., 2005) and increased mortality (Thurston and Ito, 2001). Human supplementation with antioxidants, such as α-tocopherol (AT), has been reported to ameliorate decrements in O3-induced lung injury in some (Samet et al., 2001; Sienra-Monge et al., 2004), but not all (Mudway et al., 2006), studies.

α-Tocopherol (AT), a lipid-soluble dietary antioxidant, is the most abundant and biologically active form of vitamin E (VE) (Schneider, 2005). VE is absorbed into the lymphatics from the intestine and initially transported in chylomicrons to the systemic circulation. Following uptake of the circulating VE-containing chylomicrons and their remnants by the liver, AT is preferentially bound to the hepatic AT transfer protein (ATTP), incorporated into lipoproteins, and secreted into the circulation (Traber and Arai, 1999). ATTP mRNA has been detected in low levels in other tissues, including rat brain, spleen, lung, and kidney (Hosomi et al., 1998). ATTP−/− mice, therefore, have low plasma and extrahepatic tissue AT concentrations (approximately 2–20% of littermate ATTP+/+ mice), while liver concentrations remain approximately 40% of those of their ATTP+/+ littermates (Leonard et al., 2002).

Previously, we reported genome-wide changes in mRNAs from livers and brain cortex of ATTP−/− mice using high-density oligonucleotide arrays. Our findings included enhanced gene expression related to cell proliferation pathways and oxidant stress in liver and repression of specific genes that determine synaptic plasticity and neuronal development in brain cortex (Gohil et al., 2003b). In a later report our results also suggested age-related multi-organ deregulation of gene networks in ATTP−/− as compared with ATTP+/+ mice (Gohil et al., 2004). We have also reported modest increases in lung and liver heme oxygenase 1 (HO-1) and inducible nitric oxide synthase (iNOS) expression in lipopolysaccharide (LPS)-injected (ip) ATTP−/− mice as compared with ATTP+/+ mice (Schock et al., 2004). Recently we reported dysregulated expression of immune- and lipid metabolism-related genes in ATTP−/− heart tissue and dysregulated airway allergic inflammatory responses in ovalbumin-sensitized ATTP−/− mice (Lim et al., 2008; Vasu et al., 2007).

O3 exposure has been used to explore transcriptomic responses of the lungs to oxidative stress. When C57BL6/J mice were exposed to O3 (1 ppm for 3 consecutive nights, 8 h/night) followed by microarray analysis of lung mRNA, we observed induction of the expression of serum amyloid A3 gene and of DNA- and cell cycle-related genes, as well as repression of xenobiotic and cytoskeletal genes, as compared with lungs from air-breathing mice (Gohil et al., 2003a). These findings suggest that various defensive mechanisms are activated to protect lungs from O3 exposure in mice.

AT deficiency to the extent obtained by ATTP−/− mice would be uncommon in humans except for those with severe fat malabsorption or rare families exhibiting ATTP deficiency (Alex et al., 2000; Jeppesen et al., 2000). However, by manipulating systemic AT, a major lipophilic antioxidant, we would predict a robust “antioxidant action,” which would be further augmented by O3 (Traber and Atkinson, 2007). On the other hand, AT may have biological activities beyond its antioxidant action (Azzi, 2007; Brigelius-Flohe and Davies, 2007). ATTP−/− mice represent a unique strain where we can study the effect of AT on biological systems by genetically (via deletion of ATTP gene) manipulating systemic AT levels without any dietary AT regulations. The present study was carried out to analyze the genome-wide effect of O3 in AT-deficient lungs secondary to ATTP deletion in ATTP−/− mice and AT-sufficient mice (ATTP+/+) as compared to their air-breathing ATTP−/− and ATTP+/+ littermate controls. Some of the results in this article have been previously reported in abstract form (Vasu et al., 2006a, 2006b).

Materials and methods

Animals, diet, and experimental design

The protocols for the care and use of animals were approved by the Institutional Care and Use Committee at the University of California, Davis. Male C57BL/6 mice with a deletion of ATTP gene (ATTP−/−) and wild-type mice (ATTP+/+) were used from our colonies. The ATTP−/− mice in C57BL6/J genetic background were obtained by backcrossing the original colony (Terasawa et al., 2000) of mixed (50% C57BL6/J and 50% 129/SvJae) mice heterozygous for the deletion (ATTP+/-) with C57BL6/J (ATTP+/+) mice. The mice were housed in polycarbonate cages in a room maintained at 21–23°C and 60–70% humidity on a 12-h light/dark schedule with ad libitum access to water and food. ATTP−/− mice were bred by mating heterozygous (ATTP+/-) male and female mice, and the offspring were genotyped using specific primers for ATTP and confirmed by Western blot analysis using antibody against ATTP protein in liver (Terasawa et al., 2000). After weaning, the offspring were fed diets containing 35 IU dl-tocopheryl acetate/kg diet (USB Corporation, Cleveland, OH).

O3 Exposure

At 12–14 wk, ATTP+/+ or ATTP−/− mice were exposed either to filtered air or to 0.5 ppm O3 for 6 h/day for 3 consecutive days (n = 8 per group), with body weights being measured before and after exposure. The O3 was produced from O2 by electrical corona arc discharge (sander Ozonizer model IV, Eltze, Germany). The O2–O3 mixture (∼95% O2, 5% O3) was mixed with ambient air and allowed to flow into a Teflon-lined exposure chamber, with the O3 concentration in chamber being adjusted to 0.5 ppm and continuously monitored by an O3 detector (Dasibi model 1003-AH, Glendale, CA) (Valacchi et al., 2004). Exposure to filtered air was done in similar exposure chambers except that filtered airflow was released into the chamber at flow rates similar to the O3 flow. Temperature and humidity were monitored during exposures (25–28°C and 45–55%, respectively).

All the animals were sacrificed immediately after the third 6-h exposure by intraperitoneal injection of beuthanasia (120 mg/kg body weight) and bronchoalveolar lavage (BAL) performed in half of the animals (n = 4 per group). Blood was collected by cardiac puncture and lung (dissected free of trachea, large airways, and blood vessels), and liver tissues were rapidly obtained and stored at −80°C until further processing.

AT analyses

Plasma, liver, and lung AT analyses were determined using high-pressure liquid chromatography (HPLC) with electrochemical detection (Podda et al., 1996).

Nitrate/nitrite measurements

Plasma nitrate/nitrite were measured as an indicator of NO production through reduction with acidified vanadium(III) using the Sievers NO analyzer (Sievers, Boulder, CO) (Van Der Vliet et al., 2000).

Bronchoalveolar lavage

Animals were sacrificed, tracheal cannula inserted, and bronchoalveolar lavage (BAL) performed three times via the trachea using approximately 1.0 ml of ice-cold phosphate-buffered saline (PBS, pH 7.4) and recovered by gentle manual aspiration. The recovered BAL fluid was centrifuged, the cell pellet washed twice, and finally resuspended in 1 ml PBS. The total cell count was performed in a Burker chamber (Novolab, Geraardsbergen, Belgium).

To assess alveolar-capillary membrane protein permeability, total protein from cell-free BAL fluid was measured using a commercially available protein bioassay kit (Bio-Rad Laboratories, Hercules, CA).

RNA extraction and biotin-labeled RNA for gene chip analysis

Total RNA from ∼30 mg unlavaged lung tissue was extracted by RNeasy Minikit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Total RNA purity and quantity were determined spectrophotometrically (A260/A280 ratio being close to 2.0 for pure RNA). Four replicates, each from a mouse lung, from each group (n = 4 per group), were further processed as follows for gene chip analysis.

The methods used to prepare the eukaryotic target preparation were followed according to the manufacturer's protocol (Affymetrix, Inc.) for expression arrays. An aliquot (10 μg) of RNA solution was used for preparation of one-cycle cDNA synthesis (first-strand and second-strand cDNA synthesis) followed by cleanup of double-stranded cDNA and synthesis of biotin-labeled cRNA. The biotin-labeled cRNA (40 μg) was used for fragmenting for target preparation. Fragmented cRNA samples were hybridized to high density oligonucleotide Affymetrix Mouse 430A 2.0 GeneChips (Santa Clara, CA) which contains 22,600 probe sets representing transcripts and variants from over 14,000 well-characterized mouse genes. For hybridization, gene expression was assessed using one chip per mouse lung.

Oligonucleotide microarray analysis and statistics

The scanned images of hybridization signals were analyzed with the Affymetrix GeneChip Operating Software (GCOS) including the GeneChip Scanner 3000 High-Resolution Scanning Patch and DNA-D chip analyzer (dChip), a software package implementing model-based expression analysis of oligonucleotide arrays at http://www.dchip.org (Li and Hung Wong, 2001). The absolute mRNA expression (present or absent) and differential mRNA expression data were obtained from GCOS. When the p value for detection signal was < .049 (range of p value .0002–.049), the expression of the mRNA was classified as present (P). All mRNAs with the p value for detection > .05 were considered absent (A). The signal intensities for transcripts classified as present ranged from 5 to 7000 U.

The entire data of ATTP+/+, ATTP−/−, air/O3-exposed groups of mice were subjected to analysis. CEL files generated in GCOS were analyzed using dChip (version 1.0) by model-based expression (perfect match/mismatch; PM/MM) analysis to compute expression values. Hybridization data from O3-exposed lungs were treated as “Test” data and those for control, air-exposed lungs as “Baseline” data. The generated gene list was filtered representing the following criteria: (i) data that showed either an “increase” or a “decrease” of ≥ 2-fold expression comparing air-exposed ATTP−/− group of mice versus ATTP+/+ groups; (ii) O3-exposed ATTP+/+/ATTP−/− groups of mice versus air-exposed ATTP+/+/ATTP−/− groups greater than 100 expression (E) value difference in either direction (i.e., Etest − Econtrol > 100 or Econtrol − Etest > 100); (iii) p for testing was set at < .05, where p is based on the t distribution used to assess the relative magnitude of the expression value difference. The D-Chip software program calculates mean and standard error of the mean (SEM) for each mRNA in a baseline (e.g., air) sample and compares the mean and SEM for the same mRNA in test sample (e.g., O3). The program then gives a p value for the difference and magnitude of the difference. The data are then edited to select only the genes that show ≥ 2-fold and p value < .05. Our previous experience (Gohil et al., 2003a, 2003b, 2007; Oommen et al., 2007; Vasu et al., 2007, 2009) has shown that we can confirm “all” the changes that are ≥ 2-fold, by independent quantitative real-time polymerase chain reaction (PCR) assay using a sample size of 4–6 mice per group. However, the entire data from this study will be submitted online at Array Express (http://www.ebi.ac.uk/arrayexpress). Hierarchial clustering or “heat map” of the resulting differentially regulated gene list was analyzed by dChip software.

Validation of GeneChip data by quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from lung as described for GeneChip analysis and cDNA was synthesized from 5 μg total RNA and reverse transcribed to obtain cDNA. Gene-specific primers (Table 1) for selected genes were designed using Primer Express 2.0 software (Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer was used to normalize for gene expression level. qRT-PCR was carried out with SYBR Green I Master Mix (Applied Biosystems) reagent. The PCR results were analyzed using the ABI Prism 7700 sequence detector (PE Applied Biosystems, Foster City, CA). The 2−ΔΔCT method (Livak and Schmittgen, 2001) was used to calculate relative changes in gene expression determined from qRT-PCR experiments (Applied Biosystems User Bulletin No. 2 [P/N4303859]). The threshold cycle, Ct, which correlates inversely with the target mRNA levels, was measured as the cycle number at which the SYBR Green emission increases above a preset threshold level. The specific mRNA transcripts were expressed as fold difference in the expression of the specific mRNAs in RNA samples from the lungs of ATTP+/+/ATTP−/− mice exposed to O3 compared to those in the respective lungs of mice exposed to filtered air.

Table 1.

Primer sequences for real-time PCR (qRT-PCR).

Primer sequence (5′–3′)

Gene Sense Anti-sense
GAPDH TTGTGGAAGGGCTCATGACC TCTTCTGGGTGGCAGTGATG
GCLC GGACGCTGGGAAGACCAAG CAGGCAACTGGCGCAGA
NR1D1 CAGCGAGAAGCTCAACTCCC AATAGGCCCAGCTCCTCCTC
SAA3 AGTCATCAGCGATGCCAGAGA GCTCCATGTCCCGTGAACTT
MARCO CTGGGAACATCTGGCTGGAC AACTGTTCTCTGTGCCCCGA
TIMP1 TATCCGGTACGCCTACACCC TGGGCATATCCACAGAGGCT
CHEK1 TGGATTTGAAACCAAGTTATGGG GGGTATAAAAGCTGGCAAACTCA
CXCL2 AACATTTTTGATGCTGGATTTCAA TGTCCAAGGGTTACTCACAACATT
HSPB1 AAGGAAGGCGTGGTGGAGAT TTCGTCCTGCCTTTCTTCGT
FKBP5 CTGGTCCACAGCTGGGTCTC CGAAAGGACTTGGAAGGCAG
IGFBP3 GCCTGGTAAGAGCATGGAGAA AAGGACCCCAAGATCAACATACA
CCNA2 CCCAGAGGACATGTAGGCCA GGCAGTCCTGGTAGCAAGAATT
MBD1 GTAAGCAACCGCCGCAGA TCCTCCACCAGTGCCTCTTC

Statistical analyses

Statistical evaluation of analytical data was done by Student's t test using the statistical software GraphPad Prism 4.0 (San Diego, CA). In all comparisons p < .05 was considered as significant. Results are expressed as mean ± SEM. Tissue AT concentrations were evaluated by ANOVA after log transformation of data, and Tukey's multiple comparison test was employed for pairwise comparisons.

Results

Plasma, liver or lung AT levels

The plasma, liver, or lung AT levels in ATTP−/− mice were 10-to 20-fold lower than those of ATTP+/+ mice (Figures 1–3). Though O3 exposure (0.5 ppm, 6 h/day for 3 days) caused a significant decrease (p < .01) in liver AT concentrations of ATTP−/− mice as compared to air-exposed ATTP−/− mice, no significant changes were observed in liver AT levels of ATTP+/+ mice (Figure 2). Plasma and lung AT levels were unaffected by O3 exposure in both genotypes (Figures 1 and 3, respectively).

Figure 1.

Figure 1

Plasma AT concentrations in ATTP+/+ and ATTP−/− mice exposed to O3 (0.5 ppm, 6 h/day for 3 days). ATTP deletion results in extremely low plasma AT levels (p < .001). There was no significant change in AT levels in O3-exposed group as compared to their respective air-breathing littermate controls. Data are presented as mean ± SEM, n = 5–6.

Figure 3.

Figure 3

Lung AT concentrations in ATTP+/+ and ATTP−/− mice exposed to O3 (0.5 ppm, 6 h/day for 3 days). ATTP deletion results in extremely low lung AT levels (p < .001). There was no significant change in AT levels in O3-exposed group as compared to their respective air-breathing littermate controls. Data are presented as mean ± SEM, n = 5–6.

Figure 2.

Figure 2

Liver AT concentrations in ATTP+/+ and ATTP−/− mice exposed to O3 (0.5 ppm, 6 h/day for 3 days). ATTP deletion results in ∼35% drop of ATTP+/+ liver AT levels. There was no significant change in AT levels in O3-exposed ATTP+/+ mice as compared to their respective air-breathing littermate controls. But a significant drop (p < .01) in AT levels was seen in O3-exposed ATTP−/− mice as compared to their respective air-breathing littermate controls. Data are presented as mean ± SEM, n = 5–6.

Plasma nitrate/nitrite levels

No significant changes in plasma nitrate/nitrite levels were observed in ATTP+/+/ATTP−/− mice exposed to O3 as compared to their respective air-breathing controls (data not shown).

Total BAL cell count and protein levels

Significantly (p < .001) increased levels of total BAL cell counts and cell-free BAL protein levels were observed in response to O3 exposure in both groups of mice (Figures 4 and 5). Notably, the total BAL cell count doubled in response to O3 exposure in ATTP−/− (p < .001) as compared with ATTP+/+ mice (Figure 4).

Figure 4.

Figure 4

Total BAL cell count in ATTP+/+ and ATTP−/− mice exposed to O3 (0.5 ppm, 6 h/day for 3 days). A slight increase was seen in ATTP−/− mice as compared to its respective air-breathing ATTP+/+ controls but was not statistically significant. ATTP−/−/ATTP+/+ mice exposed to O3 showed significant increase (p < .001) in BAL cell count as compared to their respective air-breathing controls. As compared to O3-exposed ATTP+/+ mice, the increase in BAL cell count was statistically significant in O3-exposed ATTP−/− mice (P < .001) suggesting increased lung injury. Data are presented as mean ± SEM, n = 5–6.

Figure 5.

Figure 5

Total BAL protein levels in ATTP+/+ and ATTP−/− mice exposed to O3 (0.5 ppm, 6 h/day for 3 days). ATTP−/−/ATTP+/+ mice exposed to O3 showed significant increase (p < .001) in BAL protein levels as compared to its respective air-breathing controls. But no significant difference was observed in O3-exposed ATTP−/− mice as compared to O3-exposed ATTP+/+ mice. Data are presented as mean ± SEM, n = 5–6.

Microarray analysis

The global gene expression profile of unlavaged lung tissue of ATTP+/+/ATTP−/− mice exposed to O3 (0.5 ppm, 6 h/day for 3 days) were analyzed and compared to their air-breathing littermate ATTP+/+/ATTP−/− controls. The microarray analysis by mouse 430 A2.0 arrays or gene chips (4 replicates per group) detected ∼15,000 probe sets (∼9000 genes) in both O3-exposed ATTP+/+ and ATTP−/− lung tissues. O3 exposure resulted in the selective modulation of 52 and 99 genes in the lungs of ATTP+/+ and ATTP−/− mice, respectively. The expression of 22 genes was common to both (Table 2), of which the expressions of 4 genes (Timp1, Areg, Birc5, Tnc) were seen to be further modulated by lung AT status. The expression of 30 and 77 genes were unique to ATTP+/+ and ATTP−/− mice, respectively (Figure 6). Figure 7 shows the “heat map” for the entire set of differentially regulated genes. The coefficient of variation for Chip–Chip, i.e., same sample on four different chips, was <2%. As reported earlier by us (Oommen et al., 2007), mouse-to-mouse variation depends on the activity of the gene and can vary from 5 to 41%. Our selection criterion for a significant change was empirically set at ≥ 100%.

Table 2.

Differentially expressed genes in lungs common to both O3-exposed ATTP+/+ and ATTP−/− mice as compared to their respective air-breathing controls.

Description Affymetrix probe set ID Fold change

ATTP+/+ P-value ATTP−/− p Value
Inflammatory-immune response
Tissue inhibitor of metalloproteinase 1, Timp1 1460227_at 4.1 0.003086 13.8 .001442
Mettalothionein 2, Mt2 1428942_at 5.7 0.039341 6.2 .005926
A disintegrin-like and metallopeptidase with thrombospondin type 1 motif 4, Adamts4 1452595_at 5.0 0.010648 4.8 .008109
Tumor necrosis factor receptor superfamily member 12a, Tnfrsf12a 1418571_at 2.8 0.006708 3.2 .007977
Serine (or cysteine) peptidase inhibitor clade E member 1, Serpine1 1419149_at 3.5 0.009815 3.0 .003037
Thrombospondin 1, Thbs1 1460302_at 3.3 0.013611 3.0 .01315
C-type lectin domain family 4 member n, Clec4n 1425951_a_at 5.0 0.003182 4.0 .03387
Prostaglandin-endoperoxide synthase 1, Ptgs1 1436448_at 2.4 0.002984 2.5 .000417
Cell proliferation/DNA repair/DNA synthesis
Amphiregulin, Areg 1421134_at 5.9 0.001613 8.2 .000441
Baculoviral IAP repeat-containing 5, Birc5 1424278_a_at 4.7 0.011477 8.0 .001819
Cell division cycle 2 homolog A (S. cerevisiae), Cdc2a 1448314_at 5.9 0.000422 4.4 .001511
Ribonucleotide reductase M2, Rrm2 1416120_at 4.8 0.010085 5.1 .019074
Ubiquitin-conjugating enzyme E2C, Ube2c 1452954_at 3.5 0.003733 4.8 .025162
Cell division cycle associated 1, Cdca1 1430811 a at 5.1 0.016262 4.0 .000807
Cell division cycle 20 homolog (S. cerevisiae), Cdc20 1416664_at 5.7 0.01147 3.7 .007289
Rac-GTPase activating protein 1, Racgap1 1451358_a_at 3.2 0.010008 3.4 .002712
Checkpoint kinase 1 homolog (S. pombe), Chek1 1449708_s_at 4.3 0.028655 3.3 .003636
Growth arrest and DNA-damage-inducible 45 gamma, Gadd45g 1453851_at 3.0 0.022487 2.7 .010569
Extracellular matrix
Tenascin C, Tnc 1416342_at 4.4 0.005287 8.0 .000555
Signal transduction
Membrane-spanning 4 domains subfamily A member 4C, Ms4a4c 1420671_x_at −3.8 0.007388 −3.5 .034934
Unknown function
Similar to histone 2a, MGC73635 1438009_at 4.9 0.002595 6.1 .02903
DNA segment chr 17 human D6S56E 5, D17H6S56-E5 1417822_at 3.8 0.003788 3.5 .006364

Figure 6.

Figure 6

Venn diagram presentation of the differentially expressed genes in ATTP+/+ and ATTP−/− mice exposed to O3 (0.5 ppm, 6 h/day for 3 days). Fifty-two genes were differentially expressed in lungs of ATTP+/+ mice and 99 genes in ATTP−/− mice exposed to O3 as compared to its respective air-breathing controls. Out of these, the expression of 22 genes was common to both O3-exposed ATTP+/+ and ATTP−/− mice (n = 4/group).

Figure 7.

Figure 7

Hierarchial clustering of genes. Each column represents an individual mouse. Each row represents a gene. Deep-red color shows high expression, green color shows low expression, and black color indicates intermediate expression of the gene.

Comparing lung mRNA expression in air-breathing mice, only two genes, Prrx1 and Hspb1, were downregulated, ∼4- and 3-fold, respectively, in ATTP−/− compared with ATTP+/+ mice (Table 3). It must be noted that as compared to our earlier published reports (Oommen et al., 2007; Vasu et al., 2007), in this study we have used more stringent criteria for selection of genes that are sensitive to AT deficiency and/or O3. The primary aim was to obtain the most sensitive genes that have high statistical probability to be “real change” and possibly have biological significance. However, the entire data set from this study will be published online at Array Express (http://www.ebi.ac.uk/arrayexpress).

Table 3.

Differentially expressed genes in lungs of air-exposed ATTP−/− compared with those in ATTP+/+ mice.

Description Affymetrix probe set ID Fold change p Value
Paired related homeobox 1, Prrx1 1432129_a_at −4.2 .030167
Heat-shock protein 1, Hspb1 1425964_x_at −3.2 .04199

Table 4A shows functional groups of selected genes that were upregulated in ATTP+/+ mice in response to O3 exposure. Most of these genes were related to inflammatory-immune responses and cell proliferation or DNA repair. Some of these included FK506 binding protein 5 (Fkbp5), metallothionein 2 (Mt2), chemokine (C-X-C motif) ligand 2 (Cxcl2), prostaglandin-endoperoxide synthase 1 (Ptgs1), cell division cycle 2 homolog A (Cdc2a), and cell division cycle 6 homolog (Cdc6). The expression of transcription factors such as period homolog 1 (Per1), nuclear factor interleukin 3 regulated (Nfil3), and activating transcription factor 3 (Atf3) was also seen to be upregulated. Interestingly, only seven genes were found to be downregulated in ATTP+/+ mice in response to O3 exposure as compared to their air-breathing controls (Table 4B). These included immunoglobulin heavy chain (Igh-VJ558), N-acylsphingosine amidohydrolase 3-like (Asah3l), hepatitis A virus cellular receptor 1 (Havcr1), casein kappa (Csnk), membrane-spanning 4-domains, subfamily A, member 4C (Ms4a4c), WNT1 inducible signaling pathway protein 2 (Wisp2), and protocadherin 18 (Pcdh18), of which Igh-VJ558 showed a 36-fold downregulation. The entire list of differentially expressed genes is shown in Appendix I.

Table 4A.

Selected list of upregulated genes in lungs of O3-exposed ATTP+/+ mice as compared to respective air-breathing controls.

Description Affymetrix Probe set ID Fold change p Value
Inflammatory-immune response-related genes
FK506 binding protein 5, Fkbp5 1448231_at 10.9 .046047
Metallothionein 2, Mt2 1428942_at 5.7 .039341
Chemokine (C-X-C motif) ligand 2, Cxcl2 1449984_at 5.3 .018505
Tumor necrosis factor receptor superfamily, member 12a, Tnfrsf12a 1418571_at 2.8 .006708
Prostaglandin-endoperoxide synthase 1, Ptgs1 1423414_at 2.4 .002984
Cell proliferation/DNA repair/remodeling
Cell division cycle 2 homolog A (S. pombe), Cdc2a 1448314_at 4.4 .001511
Checkpoint kinase 1 homolog (S. pombe), Chek1 1450677_at 4.3 .028655
Cell division cycle 6 homolog (S. cerevisiae), Cdc6 1417019_a_at 3.8 .019495
Transcription factors
Period homolog 1 (Drosophila), Per1 1449851_at 3.2 .002077
Nuclear factor, interleukin 3, regulated, Nfil3 1418932_at 3.2 .002181
Activating transcription factor 3, Atf3 1449363_at 2.9 .009167
Cell-adhesion-related genes
CEA-related cell adhesion molecule 1, Ceacam1 1452532_x_at 4.0 .026812
Other functions
Iduronate 2-sulfatase, Ids 1450166_at 3.4 .008805
Transmembrane protein 37, Tmem37 1417611_at 2.9 .003164
Table 4B. Downregulated genes in lungs of O3-exposed ATTP+/+ mice as compared to respective air-breathing controls.

Description Affymetrix Probe set ID Fold change p Value

Immunoglobulin heavy chain (J558 family), Igh-VJ558 1427839_at -36.2 .030697
N-Acylsphingosine amidohydrolase 3-like, Asah3l 1421496_at -6.2 .001439
Hepatitis A virus cellular receptor 1, Havcr1 1450364_a_at -5.8 .022315
Casein kappa, Csnk 1419735_at -4.7 .015088
Membrane-spanning 4-domains, subfamily A, member 4C, Ms4a4c 1450291_s_at -4.4 .017093
WNT1 inducible signaling pathway protein 2, Wisp2 1419015_at -3.3 .013676
Protocadherin 18, Pcdh18 1422889_at -2.9 .00596

The lung gene expression of ATTP−/− mice when exposed to O3 showed 99 genes differentially expressed as compared to their air-breathing ATTP−/− controls. This was approximately 50% more than that observed in differential comparison of ATTP+/+ lungs exposed to O3 and respective air-breathing controls (Figure 6). The functional classification of these upregulated genes resulted in six groups: cell proliferation- or DNA repair-related genes (40%), inflammatory-immune related genes (27%), transcription-related genes (7%), cytoskeleton-related genes (3%), lipid metabolism-related genes (2%), and ion transport-related genes (1%) (Table 5A). Seven genes were found to be downregulated in lungs of ATTP−/− mice exposed to O3 as compared to their air-breathing controls (Table 5B). These included membrane-spanning 4-domains, subfamily A, member 4c (Ms4a4c) (−3.5-fold), complement receptor 2 (Cr2) (−3.3–fold), interferon-induced transmembrane protein 6 (Ifitm6) (−3.3-fold), CD19 antigen (Cd19) (−3.1-fold), ATPase, Na+/K+-transporting, alpha 3 polypeptide (Atp1a3) (−3.0-fold), nuclear receptor subfamily 1, group D, member 1 (Nr1d1) (−3.0-fold), and insulin-like growth factor binding protein 3 (Igfbp3) (−2.9-fold). The entire list of differentially expressed genes is shown in Appendix II.

Table 5A.

Selected list of upregulated genes in lungs of O3 exposed ATTP−/− mice as compared to respective air-breathing controls.

Description Affymetrix Probe set ID Fold change p Value
Inflammatory-immune response-related genes
Serum amyloid A 3, Saa3 1450826_a_at 18.7 .008959
Metallothionein 2, Mt2 1428942_at 6.2 .005926
Macrophage receptor with collagenous structure, Marco 1449498_at 6.1 .006801
Lipocalin 2, Lcn2 1427747_a_at 5.9 .01288
C-type lectin domain family 4, member n, Clec4n 1425951_a_at 4.0 .03387
Prostaglandin-endoperoxide synthase 2, Ptgs2 1417262_at 3.8 .004319
Suppressor of cytokine signaling 3, Socs3 1455899_x_at 3.8 .030528
Tumor necrosis factor (ligand) superfamily, member 9, Tnfsf9 1422924_at 3.5 .003302
Tumor necrosis factor receptor superfamily, member 12a, Tnfrsf12a 1418571_at 3.2 .007977
Arginase type II, Arg2 1418847_at 3.4 .021006
Serine (or cysteine) peptidase inhibitor, clade A, member 3N, Serpina3n 1419100_at 3.2 .000509
Serine (or cysteine) peptidase inhibitor, clade E, member 1, Serpine1 1419149_at 3.0 .003037
Coagulation factor VII, F7 1419321 at 3.0 .000498
Thrombospondin 1, Thbs1 1460302_at 3.0 .01315
Glutamate-cysteine ligase, catalytic subunit, Gclc 1424296_at 2.9 .001408
Prostaglandin-endoperoxide synthase 1, Ptgs1 1436448_a_at 2.5 .000417
Cell proliferation/DNA repair/remodeling
Cyclin A2, Ccna2 1417910_at 7.2 .000661
Cell division cycle 2 homolog A (S. pombe), Cdc2a 1448314_at 5.9 .000422
Cell division cycle associated 3, Cdca3 1452040_a_at 5.3 .002641
Cyclin B1, Ccnb1 1419943_s_at 5.2 .00567
Ribonucleotide reductase M2, Rrm2 1416120_at 5.1 .019074
Cyclin B2, Ccnb2 1450920_at 4.8 .000411
RAD51 homolog (S. cerevisiae), Rad51 1418281_at 4.6 .000758
Spindle pole body component 25 homolog (S. cerevisiae), Spbc25 1424118_a_at 4.6 .000531
Cyclin B1, related sequence 1, Ccnb1-rs1 1448205_at 3.7 .006735
Rac GTPase-activating protein 1, Racgap1 1451358_a_at 3.4 .002712
Checkpoint kinase 1 homolog (S. pombe), Chek1 1449708_s_at 3.3 .003636
PDZ binding kinase, Pbk 1448627_s_at 3.3 .000095
Alpha-fetoprotein, Afp 1416645_a_at 3.0 .001902
Growth arrest and DNA-damage-inducible 45 gamma, Gadd45g 1453851_a_at 2.7 .010569
MAD2 (mitotic arrest deficient, homolog)-like 1 (yeast), Mad2l1 1422460_at 2.5 .002757
Transcription factors
Topoisomerase (DNA) II alpha, Top2a 1454694_a_at 4.4 .000008
Polymerase (DNA directed), epsilon, Pole 1448650_a_at 3.4 .005435
Methyl-CpG binding domain protein 1, Mbd1 1430838_x_at 3.4 .009822
Cytoskeleton-related genes
Kinesin family member 22, Kif22 1437716_x_at 6.3 .005116
Tubulin, alpha 6, Tuba6 1416128_at 3.6 .006892
Kinesin family member 23, Kif23 1455990_at 3.2 .000845
Lipid metabolism-related genes
Cholesterol 25-hydroxylase, Ch25h 1449227_at 5.7 .034847
Aldo-keto reductase family 1, member B8, Akr1b8 1448894_at 3.3 .000588
Ion transport-related genes
Solute carrier family 26, member 4, Slc26a4 1419725_at 5.5 .005928
Unknown functions
Resistin-like alpha, Retnla 1449015_at 8.4 .000305
Restin-like 2, Rsnl2 1427278_at 3.0 .00517
Table 5B. Downregulated genes in lungs of O3-exposed ATTP−/− mice as compared to respective air-breathing controls.

Description Affymetrix Probe set ID Fold change p Value

Membrane-spanning 4-domains, subfamily A, member 4C, Ms4a4c 1420671_x_at −3.5 .034934
Complement receptor 2, Cr2 1425289_a_at −3.4 .003537
Interferon induced transmembrane protein 6, Ifitm6 1440865_at −3.3 .034152
CD19 antigen, Cd19 1450570_a_at −3.1 .000444
ATPase, Na+/K+ transporting, alpha 3 polypeptide, Atp1a3 1427481_a_at −3.0 .005875
Nuclear receptor subfamily 1, group D, member 1, Nr1d1 1426464_at −3.0 .005349
Insulin-like growth factor binding protein 3, Igfbp3 1423062_at −2.9 .001285

Validation of microarray data

We selected 14 genes from the microarray data to confirm independently by qRT-PCR. The selected genes included upregulated (Gclc, Saa3, Marco, Timp1, Areg, Check1, Cxcl2, Fkbp5, Tnc, Ccna2, Mbd1) and downregulated (Nr1d1, Hspb1, Igfbp3) genes. The fold-change data analyzed by qRT-PCR were similar to or lower than the microarray data and was highly correlated (R2 = .8076) (Figure 8). The higher degree of consistency between the qRT-PCR data and oligonucleotide microarray data raised confidence in the gene expression data obtained and the validity of the experiments.

Figure 8.

Figure 8

Confirmation of selected genes by qRT-PCR. The selected genes (n = 14) included upregulated (Gclc, Saa3, Areg, Marco, Timp1, Check1, Cxcl2, Fkbp5, Ccna2, Mbd1, Tnc) and downregulated genes (Nr1d1, Hspb1, Igfbp3). The fold-change data analyzed by qRT-PCR was similar to or lower than the microarray data and was highly correlated (R2 = .8076).

Discussion

ATTP−/− mice represent a unique strain in which one can study the effect of AT on biological systems by genetically (via deletion of ATTP gene) manipulating systemic AT levels. The experimental design utilized ATTP−/− mice in which extremely low levels of lung AT were achieved secondary to ATTP deletion. The present study was carried out to explore the potential of the major nutritional lipophilic antioxidant, AT, on the adaptive response of lung transcriptomes to O3, the most important photochemical oxidant. Genome-wide effect of O3 were analyzed in ATTP−/− mice and AT-sufficient mice (ATTP+/+) as compared to their respective air-exposed ATTP−/− and ATTP+/+ littermate controls.

The AT levels in plasma, liver, and lung tissues of ATTP−/− mice were much lower as compared to their respective levels in ATTP+/+ littermate controls, as reported earlier by us and by other workers (Gohil et al., 2003b, 2004; Leonard et al., 2002; Lim et al., 2008; Schock et al., 2004; Terasawa et al., 2000). We observed an increase in total BAL cell count and protein levels in O3-exposed mice, confirming O3-induced inductions of lung injury (Guth et al., 1986), but we did not find any significant change in plasma or lung AT levels in O3-exposed ATTP+/+ or ATTP−/− mice (0.5 ppm, 6 h/day for 3 days) as compared to their respective air-exposed littermate controls. However, a significant O3-induced drop was observed in liver AT levels in ATTP−/− mice as compared to air-exposed ATTP−/− mice (Figure 2). A possible explanation would be an increase in circulatory lipid hydroperoxides as a result of AT deficiency in O3-exposed ATTP−/− mice as observed by other workers in O3-exposed AT deficient rats (Sato et al., 1980). In a study published in 1980, rats fed vitamin E-deficient diet or vitamin E-supplemented diet were exposed to 0.3 ppm O3 for 3 h daily, 5 days/wk, for 7 mo (Sato et al., 1980). The investigators observed that serum vitamin E concentration decreased following O3 exposure in the E-supplemented group, but remained unaffected in the E-depleted group. Interestingly, they observed that liver tissues showed more damaging affect as compared to lung tissues that were directly exposed to O3, as reflected by biochemical and morphological observations, although no clear explanation could be put forth (Sato et al., 1980). In another study, in a burn and inhalation injury model in sheep, Traber and workers observed nearly 2000 nmol alpha-tocopherol depletion from the liver, as compared to only 1000 nmol alpha-tocopherol loss in lungs, over 48 h after exposure to burn and inhalation injury (Traber et al., 2007). The loss of hepatic alpha-tocopherol was suggested to be caused by lipid hydroperoxides, which are delivered to the liver by lipoproteins (Traber et al., 2007).

We had earlier reported a decrease in plasma and lung AT levels (23 and 20%, respectively) in O3-exposed SKH-1 hairless mice (0.8 ppm, 6 h/day for 6 days) as compared to their air-breathing controls (Valacchi et al., 2004). Elsayed and workers have previously reported an increase in lung AT content after O3 exposure (0.5 ppm, 5 days) in Long-Evans rats fed an AT-supplemented diet, suggesting mobilization of AT to lungs as a response to “oxidative stress” or as a result of O3-induced inflammatory responses with leakage of blood constituents into lung tissues (Elsayed et al., 1990). In another study, no significant changes were found in plasma AT levels in mature female rabbits exposed to 0.1 to 0.6 ppm of O3 for 3 h (Canada et al., 1987). These observations suggest the degree of oxidative stress caused by O3 exposure, potentially dependent upon the duration of exposure, the levels of antioxidant (both enzymatic and nonenzymatic), the magnitude of the inflammatory responses, and/or the species/strain of animals may all be involved in modulating lung AT levels.

Comparing the differential expression of lung genes in air-breathing mice, only two genes, paired related homeobox 1 (Prrx1) and heat-shock protein 1 (Hspb1), were downregulated, by 4.2- and 3.2-fold, in ATTP−/− lungs (Table 3). Prrx1 (also known as Prx1 or Mhox) is a transcription factor associated with differentiation and vascularization of vessel walls (Bergwerff et al., 1998). In lungs, Prrx1 has been localized to the differentiating endothelial cells and Prrx1-/- mice have been reported to show abnormal lung vascularization (Ihida-Stansbury et al., 2004). Hspb1 (also known as Hsp27 or Hsp25) belongs to the family of small heat-shock proteins that are stimulated by heat shock or disturbed cell environment or inflammation. Hspb1 was also suggested to be anti-apoptotic effector acting by sequestering cytochrome c released from mitochondria (Bruey et al., 2000). Sinha et al. reported that AT deficiency leads to reduced Hspb1 expression in lung type II pneumocytes and thus promotes apoptosis (Sinha et al., 2002). Reduced Hspb1 expression was assumed to be dependent upon the protein kinase C (PKC) pathway, as AT is known to modulate PKC activity (Mahoney and Azzi, 1988). In type II pneumocytes its deficiency has been reported to strongly increase PKC activity (Sabat et al., 2001). The present study further supports a role for AT in Hspb1 expression.

Of note, we were surprised to observe that only two genes were differentially expressed in ATTP−/− lungs as compared to lungs of respective littermate ATTP+/+ controls. We were expecting a “significant number” of differentially expressed genes, particularly those related to “oxidant responsive” genes. Interestingly, we previously have not observed any significant increase in isoprostanes in lungs from ATPP−/− mice (unpublished data, from the laboratory of the late Dr. J. Morrow) as compared to ATTP+/+ controls. Similar unexpected observations were recently reported by other workers in brain tissue of ATTP−/− mice (Cuddihy et al., 2008).

O3-sensitive lung genes modulated by AT status

Of the expression of 22 genes in lungs common to both ATTP+/+ and ATTP−/− mice exposed to O3, the expression of 4 genes [tissue inhibitor of metalloproteinase 1 (Timp1), amphiregulin (Areg), baculoviral IAP-repeat containing 5 (Birc5), and Tenascin C (Tnc)] was seen to be further modulated by lung AT status (Table 2). Timp1, Areg, Birc5, and Tnc were induced 4.1-, 5.9-, 4.7-, and 4.4-fold in ATTP+/+ mice, whereas they were induced by 13.8-, 8.2-, 8-, and 8-fold, respectively, in ATTP−/− mice. TIMPs are regulators of matrix metalloproteinase activity and their levels are known to be increased in lung injury (Kim et al., 2005). They have also been touted as a physiological regulator of normal airway repair (Chen et al., 2008). Wang et al. have reported a consistent increase in Timp1 mRNA expression in rat type I-like lung pneumocytes exposed to 100 ppb (0.1 ppm) O3 for 1 h, thus suggesting the importance of this lung cell type in alveolar injury repair (Wang et al., 2006). Similarly, the expression of amphiregulin (Areg) was induced 8.2-fold in O3-exposed ATTP−/− mice, as compared to 5.9-fold in O3-exposed ATTP+/+ mice. Areg, a member of epidermal growth factor, is known to regulate cell proliferation (Schuger et al., 1996). Shao and workers have reported that Areg can be activated by prostaglandin E(2) (PGE2), a major product of cyclooxygenase (cox) via cAMP/protein kinase A pathways in colon cancer cells (Shao et al., 2003).

Of note, in the present study, the mRNA expression of prostaglandin-endoperoxide synthase 1 and 2 (Ptgs1 and 2/Cox-1 and 2) was seen to be induced by 2.5- and 3.8-fold, respectively, in O3-exposed ATTP−/− mice. Interestingly, only Ptgs1 was seen to be induced (2.4-fold) in O3-exposed ATTP+/+ mice. AT supplementation has been reported to reverse age-associated increase in murine macrophage PGE2 production and COX activity, but had no effect on COX 1 and 2 protein expression or COX 2 mRNA expression (Wu et al., 1998). The authors suggested that AT may be exerting its effect posttranslationally by inhibiting COX activity (Wu et al., 1998). Hence our microarray data suggest that O3 exposure to lung tissues with low AT levels (ATTP−/− mice) may increase Ptgs1 and -2 expressions, leading to increased expression of Areg, which in turn may modulate cell proliferation mechanisms. Similarly, the increased expression of tenascin C (Tnc), an extracellular matrix component, in lung tissues of O3-exposed ATTP−/− mice (8-fold) as compared to lung tissues of O3-exposed ATTP+/+ mice (4.4-fold) further consolidates our hypothesis of modulated lung injury pathways in O3-exposed ATTP−/− mice as a result of low AT status. Tnc is associated with cell detachment, migration, proliferation, and tissue remodeling (Chiquet-Ehrismann, 1991). Potter-Perigo and workers have shown an increased expression of Tnc in O3-exposed (0.3 ppm, 3 h) primate nasal epithelial cells (harvested after 24 h postexposure) as a result of epithelial cell detachment and disruption (Potter-Perigo et al., 1998).

The increased expression of Birc5 (also known as survivin), a member of the inhibitor of apoptosis protein family (IAP) (Salvesen and Duckett, 2002), in lungs of O3-exposed ATTP-/- mice (8-fold) represents another marker of inflammation (Altznauer et al., 2004). Overexpression of Birc5 had also been reported in proliferating cells and its expression had been described to be cell-cycle dependent (Altznauer et al., 2004). Thus the present data reveal O3-sensitive genes that may be further modulated by AT levels in lung tissues. It must also be noted that the absence of any dose response or time course of O3 exposure in the present study (one of the limitation of the study) renders it difficult to discern direct O3-specific changes from those of O3 plus the resulting inflammatory-immune system activation-induced changes. Similarly, another limitation of the current study includes the difficulty in ascribing noted changes to changes in a specific lung cell population. However, it should also be recognized that the GeneChip assay used in this study is very sensitive with a large dynamic range for detections (signal intensity of 10–10,000 units) (Oommen et al., 2007). Hence by pairwise comparison of two treatment groups, some of the large changes in even a small population of lung cells should be detected.

Differential expression of genes upregulated in O3-exposed lungs of ATTP+/+ and ATTP-/- mice

Comparative analysis of lung gene expression in ATTP−/− mice exposed to O3 as compared to their respective air-breathing ATTP−/− control mice showed similar trends in upregulation of inflammatory-immune related and cell differentiation/DNA repair/DNA synthesis related genes as observed in lungs of ATTP+/+ mice exposed to O3. The changes in gene expression in lungs of ATTP−/− mice in response to O3 were significantly higher, as seen by the differential expressions of greater than 50%, likely due to AT deficiency as a result of ATTP gene deletion (Figure 6).

We have earlier reported an induction of lung mRNA expression of serum amyloid A3 (Saa3), a main acute-phase protein in mice exposed to 1 ppm O3 for 3 consecutive nights (8 h/night) (Gohil et al., 2003a). In the current study we did not see any change in Saa3 expression in ATTP+/+ mice exposed to O3. However, there was an 18.7-fold increase in Saa3 expression in ATTP−/− mice exposed to O3 (Table 5A). Saa3 has been shown to induce extracellular matrix-degrading enzymes such as collagenase and matrix metalloproteinases (Mitchell et al., 1991; Vallon et al., 2001). The expression of macrophage receptor with collagenous structure (Marco), class A scavenger receptor, was upregulated by 6.1-fold in lungs of O3-exposed ATTP−/− mice. Its expression was reported to be restricted to subsets of macrophages active in scavenging pathogenic microorganisms (Kraal et al., 2000). Dahl and workers recently reported increased mRNA expression of Marco in lungs in response to O3 exposure in wild-type mice and at the same time reported increased lung inflammation and injury in MARCO−/− mice instilled (intratracheally) by pro-inflammatory O3-generated lipids: 5β,6β-epoxycholesterol (β-epoxide) and 1-palmitoyl-2-(9′-oxo-nonanoyl)-glycerophosphocholine (PON-GPC) (Dahl et al., 2007). The unavailability of time-course observation in the present study makes it difficult to explain the modest increase (6.1-fold in lungs of O3-exposed ATTP−/− mice) in MARCO mRNA expression as compared to reports by Dahl and workers (Dahl et al., 2007) in a different cohort of mice.

Several genes related to cell proliferation markers and regulators, such as cyclin A2 (Ccna2), cyclin B1 (Ccnb1), Cyclin B2 (Ccnb2), Chek1, Tnfrsf12a, Gadd45g, and Top2a, were also upregulated in O3-exposed ATTP−/− mice. Alpha-fetoprotein (Afp), reported to promote cell proliferation of NIH 3T3 cells by induction of the PKA-cAMP pathway (Li et al., 2002), was also upregulated.

As compared to respective air-breathing controls, in lungs of ATTP+/+ mice exposed to O3, chemokine (C-X-C motif) ligand 2 (Cxcl2), also known as macrophage inflammatory protein 2 (Mip-2), was induced by 5-fold. Cxcl2 has been reported to be secreted from alveolar macrophages, neutrophils, type II epithelial cells, and lung fibroblasts (Driscoll et al., 1993a) and is believed to play an important role in O3-induced inflammatory responses (Driscoll et al., 1993b). Tumor necrosis factor receptor superfamily, member 12a (Tnfrsf12a) (also known as TWEAK-R or Fn14), predominantly found in macrophages and a well-known modulator of cell proliferation, differentiation, and apoptosis (Girgenrath et al., 2006), was induced by 2.8-fold. Similarly, cell cycle-related genes such as cell division cycle 2 homolog (Cdc2), cyclin A2 (Ccna2), survivin (baculoviral IAP repeat-containing 5, Birc5), mitotic arrest deficient, homolog (MAD2), cell cycle division 20 homolog (Cdc20), cell division cycle 6 homolog (Cdc6), topoisomerase DNA II alpha (Top2A), and other related genes were also induced.

Dysregulated expression of “clock genes” in O3-exposed lungs of ATTP+/+ and ATTP-/- mice

Transcription factors such as period homolog 1 (Per1), nuclear factor, interleukin 3 regulated (Nfil3), and activating transcription factor 3 (Atf3) were upregulated by 3.2-, 3.2-, and 2.9-fold, respectively, in lungs of O3-exposed ATTP+/+ mice (Table 4A). Per1, implicated in regulating circadian rhythm, has been reported to be elevated in the paraventricular nucleus of mice as a result of stress-induced disturbance of circadian corticosterone secretion (Takahashi et al., 2001). The expression of the “clock genes” including Per1 has been reported to be present in larynx, trachea, bronchus, and lung of mice (Bando et al., 2007) and has also been reported to regulate cell cycle by interacting with components of the cell cycle checkpoint system activating checkpoint kinase 1 and 2 (Chek1 & 2) in response to DNA damage (Gery et al., 2006). Interestingly, Chek1 and another key regulator of cell cycle progression, growth arrest and DNA-damage-inducible 45 gamma (Gadd45g), were seen to be induced by 4.3- and 3.0-fold in lungs of O3-exposed ATTP+/+ mice. Kondratov and Antoch have reported that Gadd45g showed circadian patterns of recognition at mRNA or protein levels (Kondratov and Antoch, 2007). Nfil3 (also known as E4BP4), a mammalian basic leucine zipper (bZIP) transcription factor found primarily in T cells (Cowell, 2002) and induced by interleukin (IL)-3 (Ikushima et al., 1997), has been reported to regulate inflammatory processes and apoptosis and also involves circadian clock mechanisms (Cowell, 2002). Atf3, a member of the ATF/CREB family of transcription factors, is a stress-inducible gene induced by a variety of stress signals and also induced by ischemia and hypoxia (Ameri et al., 2007; Chen et al., 1996; Hai et al., 1999). It is also reported to affect cell cycle progression and apoptosis (Lu et al., 2006).

Nr1d1 (Nuclear receptor subfamily 1, group D member 1), also known as Rev-erb alpha, is seen to be downregulated (3-fold) in lungs of O3-exposed ATTP−/− mice (Table 5B). It is a member of the “orphan” nuclear receptor family (Chawla and Lazar, 1993). Nr1d1 has also been reported to display circadian rhythmic expression by regulating or being regulated by other “clock genes” of circadian circuitry. It is also known to regulate various metabolic pathways (Duez and Staels, 2008; Torra et al., 2000). Though it is not very clear how O3 may directly/indirectly influence the expression of genes involved in circadian pathways, studies indicate that oxidative stress might play an important role in their transcriptional regulation (Igarashi et al., 2007).

Summary of limitations and conclusion

One of the limitations of the study was nonavailability of data for O3-modulated lung gene expression profiles and/or lung injury at different time intervals (van Bree et al., 2001). It must be noted that our transcriptomic data were in lungs exposed to O3 for 3 days, a period in which the lung epithelial cell proliferation and alveolar wound repair mechanisms and inflammatory responses are simultaneously occurring (Dormans et al., 1999; Savov et al., 2004). The present study did not characterize lipid ozonation products that may have directly or indirectly modulated gene expression as a result of increased lipid peroxidation due to AT deficiency (Kafoury et al., 2007). Other workers have provided evidence that O3-induced inflammatory responses may be maximally present on the third day of acute O3 exposure (Dormans et al., 1999; Savov et al., 2004). Bioinformatic analyses of several genes modulated in the present study reveals involvement of nuclear factor (NF)-κB and related pathways (Bing et al., 2000; Cavin et al., 2004; Girgenrath et al., 2006; Gohil et al., 2003a; Huffman et al., 2002; Morante et al., 2005). The induction of the catalytic subunit of glutamate-cysteine ligase, Gclc, a rate-limiting enzyme in de novo reduced glutathione (GSH) synthesis, by 2.9-fold in O3-exposed ATTP−/− mice (Table 5A) also suggests the involvement of a transcription factor of the cap'n'collar-basic leucine zipper proteins (CNC-bZIP), Nrf2 (Wild et al., 1999). Thus, the present data also suggest possible highly complex cross-talk mechanisms involved between the “stress-responsive” transcription factors such as Nrf2, NF-κB, and Atf3. The present study also identifies four O3-sensitive lung genes (Timp1, Areg, Birc5, and Tnc) that appear to be further modulated by AT status. However, it must also be noted that in the present study we exposed the mice to O3 (0.5 ppm) 6 h/day for 3 days and thus the gene expression pattern observed represents changes due to O3, O3-induced injury-inflammation-repair processes, and/or adaptive responses to O3 exposure, thus significantly limiting mechanistic interpretations regarding respiratory tissue overall pathobiological responses. However, it can be reasonably concluded that lung genomic responses to O3 are modulated in ATTP-/- mice compared to their littermate ATTP+/+ mice.

Acknowledgments

This research was partly funded by grants from National Institute of Health Sciences (ES011895) and United States Department of Agriculture (35200-13456).

Appendix I

Differentially expressed genes in lungs of ATTP+/+ mice exposed to O3 as compared to their respective air-exposed controls.

Description Affymetrix probe set ID Fold change p Value
FK506 binding protein 5, Fkbp5 1448231_at 10.9 .046047
Amphiregulin, Areg 1421134_at 5.9 .001613
Metallothionein 2, Mt2 1428942_at 5.7 .039341
Cell division cycle 20 homolog (S. cerevisiae), Cdc20 1439394_x_at 5.7 .01147
Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme, Gcnt2 1451733_at 5.4 .006715
Chemokine (C-X-C motif) ligand 2, Cxcl2 1449984_at 5.3 .018505
Cell division cycle associated 1, Cdca1 1430811_a_at 5.1 .016262
C-type lectin domain family 4, member n, Clec4n 1425951_a_at 5.0 .003182
Similar to histone 2a, MGC73635 1438009_at 4.9 .002595
Mitogen-activated protein kinase kinase kinase 6, Map3k6 1449901_a_at 4.8 .004217
Ribonucleotide reductase M2, Rrm2 1416120_at 4.8 .010085
Baculoviral IAP repeat-containing 5, Birc5 1424278_a_at 4.7 .011477
A disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4, Adamts4 1452595_at 4.5 .010648
Tenascin C, Tnc 1416342_at 4.4 .005287
Cell division cycle 2 homolog A (S. pombe), Cdc2a 1448314_at 4.4 .001511
Checkpoint kinase 1 homolog (S. pombe), Chek1 1450677_at 4.3 .028655
Tissue inhibitor of metalloproteinase 1, Timp1 1460227_at 4.1 .003086
Similar to thrombospondin 1, LOC640441 1450377_at 4.0 .003209
Lipin 2, Lpin2 1460290_at 4.0 .010188
CEA-related cell adhesion molecule 1, Ceacam1 1452532_x_at 4.0 .026812
Cell division cycle 6 homolog (S. cerevisiae), Cdc6 1417019_a_at 3.8 .019495
Serine (or cysteine) peptidase inhibitor, clade E, member 1, Serpine1 1419149_at 3.5 .009815
Ubiquitin-conjugating enzyme E2C, Ube2c 1452954_at 3.5 .003733
Natriuretic peptide receptor 3, Npr3 1448024_at 3.4 .006901
Iduronate 2-sulfatase, Ids 1450166_at 3.4 .008805
Thrombospondin 1, Thbs1 1460302_at 3.3 .013611
Polo-like kinase 4 (Drosophila), Plk4 1426580_at 3.3 .00878
Rac GTPase-activating protein 1, Racgap1 1451358_a_at 3.2 .010008
Period homolog 1 (Drosophila), Per1 1449851_at 3.2 .002077
Nuclear factor, interleukin 3, regulated, Nfil3 1418932_at 3.2 .002181
Coagulation factor III, F3 1417408_at 3.0 .006349
Growth arrest and DNA-damage-inducible 45 gamma, Gadd45g 1453851_a_at 3.0 .022487
Activating transcription factor 3, Atf3 1449363_at 2.9 .009167
Transmembrane protein 37, Tmem37 1417611_at 2.9 .003164
Tumor necrosis factor receptor superfamily, member 12a, Tnfrsf12a 1418571_at 2.8 .006708
Ribonucleotide reductase M1, Rrm1 1448127_at 2.7 .004612
Basic leucine zipper and W2 domains 1, Bzw1 1450846_at 2.7 .011171
Prostaglandin-endoperoxide synthase 1, Ptgs1 1423414_at 2.4 .002984
Immunoglobulin heavy chain (J558 family), Igh-VJ558 1427839_at −36.2 .030697
N-Acylsphingosine amidohydrolase 3-like, Asah3l 1421496_at −6.2 .001439
Hepatitis A virus cellular receptor 1, Havcr1 1450364_a_at −5.8 .022315
Casein kappa, Csnk 1419735_at −4.7 .015088
Membrane-spanning 4-domains, subfamily A, member 4C, Ms4a4c 1450291_s_at −4.4 .017093
WNT1 inducible signaling pathway protein 2, Wisp2 1419015_at −3.3 .013676
Protocadherin 18, Pcdh18 1422889_at −2.9 .00596

Appendix II

Differentially expressed genes in lungs of ATTP−/− mice exposed to O3 as compared to their respective air-exposed group.

Description Affymetrix Probe set ID Fold change p Value
Serum amyloid A 3, Saa3 1450826_a_at 18.7 .008959
Tissue inhibitor of metalloproteinase 1, Timp1 1460227_at 13.8 .001442
Bromodomain and WD repeat domain containing 3, Brwd3 1441182_at 10.1 .004669
Resistin like alpha, Retnla 1449015_at 8.4 .000305
Tenascin C, Tnc 1416342_at 8.0 .000555
Baculoviral IAP repeat-containing 5, Birc5 1424278_a_at 8.0 .001819
Amphiregulin, Areg 1421134_at 8.2 .000441
Cyclin A2, Ccna2 1417910_at 7.2 .000661
Kinesin family member 22, Kif22 1437716_x_at 6.3 .005116
Metallothionein 2, Mt2 1428942_at 6.2 .005926
Macrophage receptor with collagenous structure, Marco 1449498_at 6.1 .006801
Similar to histone 2a, MGC73635 1438009_at 6.1 .02903
Sperm associated antigen 5, Spag5 1433893_s_at 6.0 .016256
Lipocalin 2, Lcn2 1427747_a_at 5.9 .01288
Cell division cycle 2 homolog A (S. pombe), Cdc2a 1448314_at 5.9 .000422
Cholesterol 25-hydroxylase, Ch25h 1449227_at 5.7 .034847
Leucine-rich alpha-2-glycoprotein 1, Lrg1 1417290_at 5.6 .016171
Solute carrier family 26, member 4, Slc26a4 1419725_at 5.5 .005928
Shc SH2-domain binding protein 1, Shcbp1 1416299_at 5.3 .014011
Cell division cycle associated 3, Cdca3 1452040_a_at 5.3 .002641
Cyclin B1, Ccnb1 1419943_s_at 5.2 .00567
Ribonucleotide reductase M2, Rrm2 1416120_at 5.1 .019074
Antigen identified by monoclonal antibody Ki 67, Mki67 1426817_at 5.1 .000155
Centrosomal protein 55, Cep55 1452242_at 5.0 .000317
Cyclin B2, Ccnb2 1450920_at 4.8 .000411
Ubiquitin-conjugating enzyme E2C, Ube2c 1452954_at 4.8 .025162
A disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4, Adamts4 1452595_at 4.8 .008109
Thymidine kinase 1, Tk1 1416258_at 4.6 .00906
RAD51 homolog (S. cerevisiae), Rad51 1418281_at 4.6 .000758
Spindle pole body component 25 homolog (S. cerevisiae), Spbc25 1424118_a_at 4.6 .000531
Helicase, lymphoid specific, Hells 1417541_at 4.5 .010822
Topoisomerase (DNA) II alpha, Top2a 1454694_a_at 4.4 .000008
C-type lectin domain family 4, member n, Clec4n 1425951_a_at 4.0 .03387
Cell division cycle associated 1, Cdca1 1430811_a_at 4.0 .000807
Inter alpha-trypsin inhibitor, heavy chain 4, Itih4 1431808_a_at 3.9 .018824
Prostaglandin-endoperoxide synthase 2, Ptgs2 1417262_at 3.8 .004319
Suppressor of cytokine signaling 3, Socs3 1455899_x_at 3.8 .030528
Cyclin B1, related sequence 1, Ccnb1-rs1 1448205_at 3.7 .006735
Cell division cycle 20 homolog (S. cerevisiae), Cdc20 1416664_at 3.7 .007289
Ect2 oncogene, Ect2 1419513_a_at 3.7 .001832
Membrane targeting (tandem) C2 domain containing 1, Mtac2d1 1439045_x_at 3.7 .001114
Leucine zipper protein 5, Luzp5 1417926_at 3.6 .000143
Transforming, acidic coiled-coil containing protein 3, Tacc3 1455834_x_at 3.6 .00117
ASF1 anti-silencing function 1 homolog B (S. cerevisiae), Asf1b 1423714_at 3.6 .003282
CDC28 protein kinase 1b, Cks1b 1416698_a_at 3.6 .00004
Tubulin, alpha 6, Tuba6 1416128_at 3.6 .006892
Tumor necrosis factor (ligand) superfamily, member 9, Tnfsf9 1422924_at 3.5 .003302
Fidgetin-like 1, Fignl1 1422430_at 3.4 .000638
Polymerase (DNA directed), epsilon, Pole 1448650_a_at 3.4 .005435
Methyl-CpG binding domain protein 1, Mbd1 1430838_x_at 3.4 .009822
Rac GTPase-activating protein 1, Racgap1 1451358_a_at 3.4 .002712
Ubiquitin-like, containing PHD and RING finger domains, 1, Uhrf1 1415810_at 3.4 .006189
Tumor necrosis factor receptor superfamily, member 12a, Tnfrsf12a 1418571_at 3.2 .007977
Arginase type II, Arg2 1418847_at 3.4 .021006
Secreted phosphoprotein 1, Spp1 1449254_at 3.3 .002481
Checkpoint kinase 1 homolog (S. pombe), Chek1 1449708_s_at 3.3 .003636
PDZ binding kinase, Pbk 1448627_s_at 3.3 .000095
Calcitonin/calcitonin-related polypeptide, alpha, Calca 1452004_at 3.3 .009521
Aldo-keto reductase family 1, member B8, Akr1b8 1448894_at 3.3 .000588
Serine (or cysteine) peptidase inhibitor, clade A, member 3N, Serpina3n 1419100_at 3.2 .000509
Kinesin family member 23, Kif23 1455990_at 3.2 .000845
Protein regulator of cytokinesis 1, Prc1 1423775_s_at 3.1 .001146
Anillin, actin binding protein (scraps homolog, Drosophila), Anln 1433543_at 3.1 .000536
Serine (or cysteine) peptidase inhibitor, clade E, member 1, Serpine1 1419149_at 3.0 .003037
Coagulation factor VII, F7 1419321 at 3.0 .000498
Myelin and lymphocyte protein, T-cell differentiation protein, Mal 1417275_at 3.0 .000093
Thrombospondin 1, Thbs1 1460302_at 3.0 .01315
Alpha-fetoprotein, Afp 1416645_a_at 3.0 .001902
Cytidine 5′-triphosphate synthase, Ctps 1416563_at 3.0 .006285
Restin-like 2, Rsnl2 1427278_at 3.0 .00517
ERBB receptor feedback inhibitor 1, Errfi1 1416129_at 3.0 .01848
Glutamate-cysteine ligase, catalytic subunit, Gclc 1424296_at 2.9 .001408
Budding uninhibited by benzimidazoles 1 homolog (S. cerevisiae), Bub1 1424046_at 2.9 .00066
GINS complex subunit 4 (Sld5 homolog), Gins4 1452598_at 2.9 .001311
Cathepsin K, Ctsk 1450652_at 2.8 .002077
Nucleolar and spindle associated protein 1, Nusap1 1416309_at 2.8 .00123
Early growth response 2, Egr2 1427683_at 2.8 .000942
Transcription factor 19, Tcf19 1423809_at 2.6 .001691
Growth arrest and DNA-damage-inducible 45 gamma, Gadd45g 1453851_a_at 2.7 .010569
Prostaglandin-endoperoxide synthase 1, Ptgs1 1436448_a_at 2.5 .000417
MAD2 (mitotic arrest deficient, homolog)-like 1 (yeast), Mad2l1 1422460_at 2.5 .002757
Karyopherin (importin) alpha 2, Kpna2 1415860_at 2.4 .000024
Membrane-spanning 4-domains, subfamily A, member 4C, Ms4a4c 1420671_x_at −3.5 .034934
Complement receptor 2, Cr2 1425289_a_at −3.4 .003537
Interferon induced transmembrane protein 6, Ifitm6 1440865_at −3.3 .034152
CD19 antigen, Cd19 1450570_a_at −3.1 .000444
ATPase, Na+/K+ transporting, alpha 3 polypeptide, Atp1a3 1427481_a_at −3.0 .005875
Nuclear receptor subfamily 1, group D, member 1, Nr1d1 1426464_at −3.0 .005349
Insulin-like growth factor binding protein 3, Igfbp3 1423062_at −2.9 .001285

Footnotes

Declaration of interest: The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.

References

  1. Alex G, Oliver MR, Collins KJ. Ataxia with isolated vitamin E deficiency: A clinical, biochemical and genetic diagnosis. J Paediatr Child Health. 2000;36:515–516. doi: 10.1046/j.1440-1754.2000.00534.x. [DOI] [PubMed] [Google Scholar]
  2. Altznauer F, Martinelli S, Yousefi S, Thurig C, Schmid I, Conway EM, et al. Inflammation-associated cell cycle-independent block of apoptosis by survivin in terminally differentiated neutrophils. J Exp Med. 2004;199:1343–1354. doi: 10.1084/jem.20032033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ameri K, Hammond EM, Culmsee C, Raida M, Katschinski DM, Wenger RH, et al. Induction of activating transcription factor 3 by anoxia is independent of p53 and the hypoxic HIF signalling pathway. Oncogene. 2007;26:284–289. doi: 10.1038/sj.onc.1209781. [DOI] [PubMed] [Google Scholar]
  4. Azzi A. Molecular mechanism of alpha-tocopherol action. Free Radical Biol Med. 2007;43:16–21. doi: 10.1016/j.freeradbiomed.2007.03.013. [DOI] [PubMed] [Google Scholar]
  5. Bando H, Nishio T, van der Horst GT, Masubuchi S, Hisa Y, Okamura H. Vagal regulation of respiratory clocks in mice. J Neurosci. 2007;27:4359–4365. doi: 10.1523/JNEUROSCI.4131-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bergwerff M, Gittenberger-de Groot AC, DeRuiter MC, van Iperen L, Meijlink F, Poelmann RE. Patterns of paired-related homeobox genes PRX1 and PRX2 suggest involvement in matrix modulation in the developing chick vascular system. Dev Dyn. 1998;213:59–70. doi: 10.1002/(SICI)1097-0177(199809)213:1<59::AID-AJA6>3.0.CO;2-X. [DOI] [PubMed] [Google Scholar]
  7. Bing Z, Huang JH, Liao WS. NFkappa B interacts with serum amyloid A3 enhancer factor to synergistically activate mouse serum amyloid A3 gene transcription. J Biol Chem. 2000;275:31616–31623. doi: 10.1074/jbc.M005378200. [DOI] [PubMed] [Google Scholar]
  8. Brigelius-Flohe R, Davies KJ. Is vitamin E an antioxidant, a regulator of signal transduction and gene expression, or a ‘junk’ food? Comments on the two accompanying papers: “Molecular mechanism of alpha-tocopherol action” by A. Azzi and “Vitamin E, antioxidant and nothing more” by M. Traber and J. Atkinson. Free Radical Biol Med. 2007;43:2–3. doi: 10.1016/j.freeradbiomed.2007.05.016. [DOI] [PubMed] [Google Scholar]
  9. Bruey JM, Ducasse C, Bonniaud P, Ravagnan L, Susin SA, Diaz-Latoud C, et al. Hsp27 negatively regulates cell death by interacting with cytochrome c. Nat Cell Biol. 2000;2:645–652. doi: 10.1038/35023595. [DOI] [PubMed] [Google Scholar]
  10. Canada AT, Chow CK, Airriess GR, Calabrese EJ. Lack of ozone effect on plasma concentrations of retinol, ascorbic acid and tocopherol. Nutr Res. 1987;7:79–800. [Google Scholar]
  11. Cavin LG, Venkatraman M, Factor VM, Kaur S, Schroeder I, Mercurio F, et al. Regulation of alpha-fetoprotein by nuclear factor-kappaB protects hepatocytes from tumor necrosis factor-alpha cytotoxicity during fetal liver development and hepatic oncogenesis. Cancer Res. 2004;64:7030–7038. doi: 10.1158/0008-5472.CAN-04-1647. [DOI] [PubMed] [Google Scholar]
  12. Chawla A, Lazar MA. Induction of Rev-ErbA alpha, an orphan receptor encoded on the opposite strand of the alpha-thyroid hormone receptor gene, during adipocyte differentiation. J Biol Chem. 1993;268:16265–16269. [PubMed] [Google Scholar]
  13. Chen BP, Wolfgang CD, Hai T. Analysis of ATF3, a transcription factor induced by physiological stresses and modulated by gadd153/Chop10. Mol Cell Biol. 1996;16:1157–1168. doi: 10.1128/mcb.16.3.1157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chen P, McGuire JK, Hackman RC, Kim KH, Black RA, Poindexter K, et al. Tissue inhibitor of metalloproteinase-1 moderates airway re-epithelialization by regulating matrilysin activity. Am J Pathol. 2008;172:1256–1270. doi: 10.2353/ajpath.2008.070891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Chiquet-Ehrismann R. Anti-adhesive molecules of the extracellular matrix. Curr Opin Cell Biol. 1991;3:800–804. doi: 10.1016/0955-0674(91)90053-2. [DOI] [PubMed] [Google Scholar]
  16. Cowell IG. E4BP4/NFIL3, a PAR-related bZIP factor with many roles. Bioessays. 2002;24:1023–1029. doi: 10.1002/bies.10176. [DOI] [PubMed] [Google Scholar]
  17. Cuddihy SL, Ali SS, Musiek ES, Lucero J, Kopp SJ, Morrow JD, et al. Prolonged alpha-tocopherol deficiency decreases oxidative stress and unmasks alpha-tocopherol-dependent regulation of mitochondrial function in the brain. J Biol Chem. 2008;283:6915–6924. doi: 10.1074/jbc.M702572200. [DOI] [PubMed] [Google Scholar]
  18. Dahl M, Bauer AK, Arredouani M, Soininen R, Tryggvason K, Kleeberger SR, et al. Protection against inhaled oxidants through scavenging of oxidized lipids by macrophage receptors MARCO and SR-AI/II. J Clin Invest. 2007;117:757–764. doi: 10.1172/JCI29968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dormans JA, van Bree L, Boere AJ, Marra M, Rombout PJ. Interspecies differences in time course of pulmonary toxicity following repeated exposure to ozone. Inhal Toxicol. 1999;11:309–329. doi: 10.1080/089583799197113. [DOI] [PubMed] [Google Scholar]
  20. Driscoll KE, Hassenbein DG, Carter J, Poynter J, Asquith TN, Grant RA, et al. Macrophage inflammatory proteins 1 and 2: expression by rat alveolar macrophages, fibroblasts, and epithelial cells and in rat lung after mineral dust exposure. Am J Respir Cell Mol Biol. 1993a;8:311–318. doi: 10.1165/ajrcmb/8.3.311. [DOI] [PubMed] [Google Scholar]
  21. Driscoll KE, Simpson L, Carter J, Hassenbein D, Leikauf GD. Ozone inhalation stimulates expression of a neutrophil chemotactic protein, macrophage inflammatory protein 2. Toxicol Appl Pharmacol. 1993b;119:306–309. doi: 10.1006/taap.1993.1074. [DOI] [PubMed] [Google Scholar]
  22. Duez H, Staels B. Rev-erb alpha gives a time cue to metabolism. FEBS Lett. 2008;582:19–25. doi: 10.1016/j.febslet.2007.08.032. [DOI] [PubMed] [Google Scholar]
  23. Elsayed NM, Mustafa MG, Mead JF. Increased vitamin E content in the lung after ozone exposure: A possible mobilization in response to oxidative stress. Arch Biochem Biophys. 1990;282:263–269. doi: 10.1016/0003-9861(90)90115-f. [DOI] [PubMed] [Google Scholar]
  24. Gery S, Komatsu N, Baldjyan L, Yu A, Koo D, Koeffler HP. The circadian gene per1 plays an important role in cell growth and DNA damage control in human cancer cells. Mol Cell. 2006;22:375–382. doi: 10.1016/j.molcel.2006.03.038. [DOI] [PubMed] [Google Scholar]
  25. Girgenrath M, Weng S, Kostek CA, Browning B, Wang M, Brown SA, et al. TWEAK, via its receptor Fn14, is a novel regulator of mesenchymal progenitor cells and skeletal muscle regeneration. EMBO J. 2006;25:5826–39. doi: 10.1038/sj.emboj.7601441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Gohil K, Cross CE, Last JA. Ozone-induced disruptions of lung transcriptomes. Biochem Biophys Res Commun. 2003a;305:719–728. doi: 10.1016/s0006-291x(03)00815-5. [DOI] [PubMed] [Google Scholar]
  27. Gohil K, Godzdanker R, O'Roark E, Schock BC, Kaini RR, Packer L, et al. Alpha-tocopherol transfer protein deficiency in mice causes multi-organ deregulation of gene networks and behavioral deficits with age. Ann N Y Acad Sci. 2004;1031:109–126. doi: 10.1196/annals.1331.012. [DOI] [PubMed] [Google Scholar]
  28. Gohil K, Oommen S, Vasu VT, Aung HH, Cross CE. Tocopherol transfer protein deficiency modifies nuclear receptor transcriptional networks in lungs: modulation by cigarette smoke in vivo. Mol Aspects Med. 2007;28:453–480. doi: 10.1016/j.mam.2007.02.004. [DOI] [PubMed] [Google Scholar]
  29. Gohil K, Schock BC, Chakraborty AA, Terasawa Y, Raber J, Farese RV, Jr, et al. Gene expression profile of oxidant stress and neurodegeneration in transgenic mice deficient in alpha-tocopherol transfer protein. Free Radical Biol Med. 2003b;35:1343–1354. doi: 10.1016/s0891-5849(03)00509-4. [DOI] [PubMed] [Google Scholar]
  30. Guth DJ, Warren DL, Last JA. Comparative sensitivity of measurements of lung damage made by bronchoalveolar lavage after short-term exposure of rats to ozone. Toxicology. 1986;40:131–143. doi: 10.1016/0300-483x(86)90074-0. [DOI] [PubMed] [Google Scholar]
  31. Hai T, Wolfgang CD, Marsee DK, Allen AE, Sivaprasad U. ATF3 and stress responses. Gene Expr. 1999;7:321–335. [PMC free article] [PubMed] [Google Scholar]
  32. Halliwell B, Cross CE. Oxygen-derived species: Their relation to human disease and environmental stress. Environ Health Perspect. 1994;102 10:5–12. doi: 10.1289/ehp.94102s105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Hosomi A, Goto K, Kondo H, Iwatsubo T, Yokota T, Ogawa M, et al. Localization of alpha-tocopherol transfer protein in rat brain. Neurosci Lett. 1998;256:159–162. doi: 10.1016/s0304-3940(98)00785-x. [DOI] [PubMed] [Google Scholar]
  34. Huffman LJ, Prugh DJ, Brumbaugh K, Ding M. Influence of hyperthyroidism on rat lung cytokine production and nuclear factor-kappaB activation following ozone exposure. Inhal Toxicol. 2002;14:1161–1174. doi: 10.1080/08958370290084845. [DOI] [PubMed] [Google Scholar]
  35. Igarashi T, Izumi H, Uchiumi T, Nishio K, Arao T, Tanabe M, et al. Clock and ATF4 transcription system regulates drug resistance in human cancer cell lines. Oncogene. 2007;26:4749–4760. doi: 10.1038/sj.onc.1210289. [DOI] [PubMed] [Google Scholar]
  36. Ihida-Stansbury K, McKean DM, Gebb SA, Martin JF, Stevens T, Nemenoff R, et al. Paired-related homeobox gene Prx1 is required for pulmonary vascular development. Circ Res. 2004;94:1507–1514. doi: 10.1161/01.RES.0000130656.72424.20. [DOI] [PubMed] [Google Scholar]
  37. Ikushima S, Inukai T, Inaba T, Nimer SD, Cleveland JL, Look AT. Pivotal role for the NFIL3/E4BP4 transcription factor in interleukin 3-mediated survival of pro-B lymphocytes. Proc Natl Acad Sci USA. 1997;94:2609–2614. doi: 10.1073/pnas.94.6.2609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Jeppesen PB, Hoy CE, Mortensen PB. Deficiencies of essential fatty acids, vitamin A and E and changes in plasma lipoproteins in patients with reduced fat absorption or intestinal failure. Eur J Clin Nutr. 2000;54:632–642. doi: 10.1038/sj.ejcn.1601067. [DOI] [PubMed] [Google Scholar]
  39. Kafoury RM, Hernandez JM, Lasky JA, Toscano WA, Jr, Friedman M. Activation of transcription factor IL-6 (NF-IL-6) and nuclear factor-kappaB (NF-kappaB) by lipid ozonation products is crucial to interleukin-8 gene expression in human airway epithelial cells. Environ Toxicol. 2007;22:159–168. doi: 10.1002/tox.20246. [DOI] [PubMed] [Google Scholar]
  40. Kim KH, Burkhart K, Chen P, Frevert CW, Randolph-Habecker J, Hackman RC, et al. Tissue inhibitor of metalloproteinase-1 deficiency amplifies acute lung injury in bleomycin-exposed mice. Am J Respir Cell Mol Biol. 2005;33:271–279. doi: 10.1165/rcmb.2005-0111OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Kondratov RV, Antoch MP. Circadian proteins in the regulation of cell cycle and genotoxic stress responses. Trends Cell Biol. 2007;17:311–317. doi: 10.1016/j.tcb.2007.07.001. [DOI] [PubMed] [Google Scholar]
  42. Kraal G, van der Laan LJ, Elomaa O, Tryggvason K. The macrophage receptor MARCO. Microbes Infect. 2000;2:313–316. doi: 10.1016/s1286-4579(00)00296-3. [DOI] [PubMed] [Google Scholar]
  43. Langford SD, Bidani A, Postlethwait EM. Ozone-reactive absorption by pulmonary epithelial lining fluid constituents. Toxicol Appl Pharmacol. 1995;132:122–130. doi: 10.1006/taap.1995.1093. [DOI] [PubMed] [Google Scholar]
  44. Leonard SW, Terasawa Y, Farese RV, Jr, Traber MG. Incorporation of deuterated RRR- or all-rac-alpha-tocopherol in plasma and tissues of alpha-tocopherol transfer protein–null mice. Am J Clin Nutr. 2002;75:555–560. doi: 10.1093/ajcn/75.3.555. [DOI] [PubMed] [Google Scholar]
  45. Li C, Hung Wong W. Model-based analysis of oligonucleotide arrays: Model validation, design issues and standard error application. Genome Biol 2. 2001 doi: 10.1186/gb-2001-2-8-research0032. RESEARCH0032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Li MS, Li PF, Yang FY, He SP, Du GG, Li G. The intracellular mechanism of alpha-fetoprotein promoting the proliferation of NIH 3T3 cells. Cell Res. 2002;12:151–156. doi: 10.1038/sj.cr.7290121. [DOI] [PubMed] [Google Scholar]
  47. Lim Y, Vasu VT, Valacchi G, Leonard S, Aung HH, Schock BC, et al. Severe Vitamin E deficiency modulates airway allergic inflammatory responses in the murine asthma model. Free Radic Res. 2008;42:387–396. doi: 10.1080/10715760801976600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  49. Lu D, Wolfgang CD, Hai T. Activating transcription factor 3, a stress-inducible gene, suppresses Ras-stimulated tumorigenesis. J Biol Chem. 2006;281:10473–10481. doi: 10.1074/jbc.M509278200. [DOI] [PubMed] [Google Scholar]
  50. Mahoney CW, Azzi A. Vitamin E inhibits protein kinase C activity. Biochem Biophys Res Commun. 1988;154:694–697. doi: 10.1016/0006-291x(88)90195-7. [DOI] [PubMed] [Google Scholar]
  51. Mitchell TI, Coon CI, Brinckerhoff CE. Serum amyloid A (SAA3) produced by rabbit synovial fibroblasts treated with phorbol esters or interleukin 1 induces synthesis of collagenase and is neutralized with specific antiserum. J Clin Invest. 1991;87:1177–1185. doi: 10.1172/JCI115116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Morante M, Sandoval J, Gomez-Cabrera MC, Rodriguez JL, Pallardo FV, Vina JR, et al. Vitamin E deficiency induces liver nuclear factor-kappaB DNA-binding activity and changes in related genes. Free Radic Res. 2005;39:1127–1138. doi: 10.1080/10715760500193820. [DOI] [PubMed] [Google Scholar]
  53. Mudway IS, Behndig AF, Helleday R, Pourazar J, Frew AJ, Kelly FJ, et al. Vitamin supplementation does not protect against symptoms in ozone-responsive subjects. Free Radic Biol Med. 2006;40:1702–1712. doi: 10.1016/j.freeradbiomed.2005.10.050. [DOI] [PubMed] [Google Scholar]
  54. Oommen S, Vasu VT, Leonard SW, Traber MG, Cross CE, Gohil K. Genome wide responses of murine lungs to dietary alpha-tocopherol. Free Radical Res. 2007;41:98–109. doi: 10.1080/10715760600935567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Podda M, Weber C, Traber MG, Packer L. Simultaneous determination of tissue tocopherols, tocotrienols, ubiquinols, and ubiquinones. J Lipid Res. 1996;37:893–901. [PubMed] [Google Scholar]
  56. Potter-Perigo S, Kaplan ED, Luchtel DL, Baker C, Altman LC, Wight TN. Ozone alters the expression of tenascin-C in cultured primate nasal epithelial cells. Am J Respir Cell Mol Biol. 1998;18:471–478. doi: 10.1165/ajrcmb.18.4.2966. [DOI] [PubMed] [Google Scholar]
  57. Pryor WA. How far does ozone penetrate into the pulmonary air/tissue boundary before it reacts? Free Radical Biol Med. 1992;12:83–88. doi: 10.1016/0891-5849(92)90060-t. [DOI] [PubMed] [Google Scholar]
  58. Pryor WA. Mechanisms of radical formation from reactions of ozone with target molecules in the lung. Free Radic Biol Med. 1994;17:451–465. doi: 10.1016/0891-5849(94)90172-4. [DOI] [PubMed] [Google Scholar]
  59. Pryor WA, Squadrito GL, Friedman M. A new mechanism for the toxicity of ozone. Toxicol Lett. 1995;82-83:287–293. doi: 10.1016/0378-4274(95)03563-x. [DOI] [PubMed] [Google Scholar]
  60. Sabat R, Kolleck I, Witt W, Volk H, Sinha P, Rustow B. Immunological dysregulation of lung cells in response to vitamin E deficiency. Free Radical Biol Med. 2001;30:1145–1153. doi: 10.1016/s0891-5849(01)00523-8. [DOI] [PubMed] [Google Scholar]
  61. Salvesen GS, Duckett CS. IAP proteins: blocking the road to death's door. Nat Rev Mol Cell Biol. 2002;3:401–410. doi: 10.1038/nrm830. [DOI] [PubMed] [Google Scholar]
  62. Samet JM, Hatch GE, Horstman D, Steck-Scott S, Arab L, Bromberg PA, et al. Effect of antioxidant supplementation on ozone-induced lung injury in human subjects. Am J Respir Crit Care Med. 2001;164:819–825. doi: 10.1164/ajrccm.164.5.2008003. [DOI] [PubMed] [Google Scholar]
  63. Sato S, Shimura S, Hirose T, Maeda S, Kawakami M, Takishima T, et al. Effects of long-term ozone exposure and dietary vitamin E in rats. Tohoku J Exp Med. 1980;130:117–128. doi: 10.1620/tjem.130.117. [DOI] [PubMed] [Google Scholar]
  64. Savov JD, Whitehead GS, Wang J, Liao G, Usuka J, Peltz G, et al. Ozone-induced acute pulmonary injury in inbred mouse strains. Am J Respir Cell Mol Biol. 2004;31:69–77. doi: 10.1165/rcmb.2003-0001OC. [DOI] [PubMed] [Google Scholar]
  65. Schneider C. Chemistry and biology of vitamin E. Mol Nutr Food Res. 2005;49:7–30. doi: 10.1002/mnfr.200400049. [DOI] [PubMed] [Google Scholar]
  66. Schock BC, Van der Vliet A, Corbacho AM, Leonard SW, Finkelstein E, Valacchi G, et al. Enhanced inflammatory responses in alpha-tocopherol transfer protein null mice. Arch Biochem Biophys. 2004;423:162–169. doi: 10.1016/j.abb.2003.12.009. [DOI] [PubMed] [Google Scholar]
  67. Schuger L, Johnson GR, Gilbride K, Plowman GD, Mandel R. Amphiregulin in lung branching morphogenesis: interaction with heparan sulfate proteoglycan modulates cell proliferation. Development. 1996;122:1759–1767. doi: 10.1242/dev.122.6.1759. [DOI] [PubMed] [Google Scholar]
  68. Shao J, Lee SB, Guo H, Evers BM, Sheng H. Prostaglandin E2 stimulates the growth of colon cancer cells via induction of amphiregulin. Cancer Res. 2003;63:5218–5223. [PubMed] [Google Scholar]
  69. Sienra-Monge JJ, Ramirez-Aguilar M, Moreno-Macias H, Reyes-Ruiz NI, Del Rio-Navarro BE, Ruiz-Navarro MX, et al. Antioxidant supplementation and nasal inflammatory responses among young asthmatics exposed to high levels of ozone. Clin Exp Immunol. 2004;138:317–322. doi: 10.1111/j.1365-2249.2004.02606.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Sinha P, Kolleck I, Volk HD, Schlame M, Rustow B. Vitamin E deficiency sensitizes alveolar type II cells for apoptosis. Biochim Biophys Acta. 2002;1583:91–98. doi: 10.1016/s1388-1981(02)00189-0. [DOI] [PubMed] [Google Scholar]
  71. Tager IB, Balmes J, Lurmann F, Ngo L, Alcorn S, Kunzli N. Chronic exposure to ambient ozone and lung function in young adults. Epidemiology. 2005;16:751–759. doi: 10.1097/01.ede.0000183166.68809.b0. [DOI] [PubMed] [Google Scholar]
  72. Takahashi S, Yokota S, Hara R, Kobayashi T, Akiyama M, Moriya T, et al. Physical and inflammatory stressors elevate circadian clock gene mPer1 mRNA levels in the paraventricular nucleus of the mouse. Endocrinology. 2001;142:4910–4917. doi: 10.1210/endo.142.11.8487. [DOI] [PubMed] [Google Scholar]
  73. Terasawa Y, Ladha Z, Leonard SW, Morrow JD, Newland D, Sanan D, et al. Increased atherosclerosis in hyperlipidemic mice deficient in alpha-tocopherol transfer protein and vitamin E. Proc Natl Acad Sci USA. 2000;97:13830–13834. doi: 10.1073/pnas.240462697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Thurston GD, Ito K. Epidemiological studies of acute ozone exposures and mortality. J Expos Anal Environ Epidemiol. 2001;11:286–294. doi: 10.1038/sj.jea.7500169. [DOI] [PubMed] [Google Scholar]
  75. Torra IP, Tsibulsky V, Delaunay F, Saladin R, Laudet V, Fruchart JC, et al. Circadian and glucocorticoid regulation of Rev-erbalpha expression in liver. Endocrinology. 2000;141:3799–3806. doi: 10.1210/endo.141.10.7708. [DOI] [PubMed] [Google Scholar]
  76. Traber MG, Arai H. Molecular mechanisms of vitamin E transport. Annu Rev Nutr. 1999;19:343–355. doi: 10.1146/annurev.nutr.19.1.343. [DOI] [PubMed] [Google Scholar]
  77. Traber MG, Atkinson J. Vitamin E, antioxidant and nothing more. Free Radical Biol Med. 2007;43:4–15. doi: 10.1016/j.freeradbiomed.2007.03.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Traber MG, Shimoda K, Murakami K, Leonard SW, Enkhbaatar P, Traber LD, et al. Burn and smoke inhalation injury in sheep depletes vitamin E: Kinetic studies using deuterated tocopherols. Free Radic Biol Med. 2007;42:1421–1429. doi: 10.1016/j.freeradbiomed.2007.01.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Valacchi G, Pagnin E, Corbacho AM, Olano E, Davis PA, Packer L, et al. In vivo ozone exposure induces antioxidant/stress-related responses in murine lung and skin. Free Radical Biol Med. 2004;36:673–681. doi: 10.1016/j.freeradbiomed.2003.12.005. [DOI] [PubMed] [Google Scholar]
  80. Vallon R, Freuler F, Desta-Tsedu N, Robeva A, Dawson J, Wenner P, et al. Serum amyloid A (apoSAA) expression is up-regulated in rheumatoid arthritis and induces transcription of matrix metalloproteinases. J Immunol. 2001;166:2801–2807. doi: 10.4049/jimmunol.166.4.2801. [DOI] [PubMed] [Google Scholar]
  81. van Bree L, Dormans JA, Boere AJ, Rombout PJ. Time study on development and repair of lung injury following ozone exposure in rats. Inhal Toxicol. 2001;13:703–718. doi: 10.1080/08958370126868. [DOI] [PubMed] [Google Scholar]
  82. Van Der Vliet A, Nguyen MN, Shigenaga MK, Eiserich JP, Marelich GP, Cross CE. Myeloperoxidase and protein oxidation in cystic fibrosis. Am J Physiol Lung Cell Mol Physiol. 2000;279:L537–546. doi: 10.1152/ajplung.2000.279.3.L537. [DOI] [PubMed] [Google Scholar]
  83. Vasu VT, Hobson B, Gohil K, Cross CE. Genome-wide screening of alpha-tocopherol sensitive genes in heart tissue from alpha-tocopherol transfer protein null mice (ATTP(-/-)) FEBS Lett. 2007;581:1572–1578. doi: 10.1016/j.febslet.2007.03.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Vasu VT, Oommen S, Lim Y, Aung HH, Valacchi G, Hobson B, et al. Increased susceptibility of alpha-tocopherol transfer protein (ATTP-/-) deficient mice to ozone (O3) Free Radical Biol Med. 2006a;41:S30. [Google Scholar]
  85. Vasu VT, Oommen S, Lim Y, Aung HH, Valacchi G, Hobson B, et al. Lung-genome responses to ozone (O3) in alpha-tocopherol transfer protein (TTP-/-) deficient mice. Physiologist. 2006b;49:C2–14. [Google Scholar]
  86. Vasu VT, Ott S, Hobson B, Rashidi V, Oommen S, Cross CE, et al. Sarcolipin and ubiquitin carboxy-terminal hydrolase 1 mRNAs are over-expressed in skeletal muscles of a-tocopherol deficient mice. Free Radical Res. 2009;43:106–116. doi: 10.1080/10715760802616676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Wang J, Wang S, Manzer R, McConville G, Mason RJ. Ozone induces oxidative stress in rat alveolar type II and type I-like cells. Free Radical Biol Med. 2006;40:1914–1928. doi: 10.1016/j.freeradbiomed.2006.01.017. [DOI] [PubMed] [Google Scholar]
  88. Wild AC, Moinova HR, Mulcahy RT. Regulation of gamma-glutamylcysteine synthetase subunit gene expression by the transcription factor Nrf2. J Biol Chem. 1999;274:33627–33636. doi: 10.1074/jbc.274.47.33627. [DOI] [PubMed] [Google Scholar]
  89. Wu D, Mura C, Beharka AA, Han SN, Paulson KE, Hwang D, et al. Age-associated increase in PGE2 synthesis and COX activity in murine macrophages is reversed by vitamin E. Am J Physiol. 1998;275:C661–668. doi: 10.1152/ajpcell.1998.275.3.C661. [DOI] [PubMed] [Google Scholar]

RESOURCES