Modulation of α₂-Adrenoceptor Functions by Heterotrimeric Gα_i Protein Isoforms

Abstract

Subtype diversity of heterotrimeric G proteins and G protein-coupled receptors enables a wide spectrum of signal transduction. However, the significance of isoforms within receptor or G protein subfamilies has not been fully elucidated. In the present study, we have tested whether α₂-adrenoceptors require specific Gα isoforms for their function in vivo. In particular, we analyzed the role of the highly homologous Gα_i isoforms, Gα_i1, Gα_i2, and Gα_i3, in typical α₂-adrenoceptor-controlled functions. Mice with targeted deletions in the genes encoding Gα_i1, Gα_i2, or Gα_i3 were used to test the effects of α₂-adrenoceptor stimulation by the agonist medetomidine. The α₂-adrenoceptor agonist medetomidine inhibited [³H]norepinephrine release from isolated prefrontal brain cortex or cardiac atria tissue specimens with similar potency and efficacy in tissues from wild-type or Gα_i-deficient mice. In vivo, bradycardia, hypotension, induction of sleep, antinociception, and hypothermia induced by α₂-adrenoceptor activation did not differ between wild-type and Gα_i-knockout mice. However, the effects of the α₂-agonists medetomidine or 5-bromo-6-(2-imidazolin-2-ylamino)quin-oxaline tartrate (UK14,304) on spontaneous locomotor activity or anesthetic sparing were reduced or absent, respectively, in mice lacking Gα_i2. In microdissected locus coeruleus neurons or postganglionic sympathetic neurons from stellate ganglia, all three Gα_i subunits were expressed as determined by quantitative reverse transcription-polymerase chain reaction, with Gα_i1 and Gα_i2 dominating over Gα_i3. Functional redundancy of the highly homologous Gα_i isoforms may predominate over specificity to regulate distinct intracellular pathways downstream of α₂-adrenoceptors in vivo. In contrast, inhibition of locomotor activity and anesthetic sparing may be elicited by a specific coupling of α_2A-adrenoceptors via the Gα_i2 isoform to intracellular pathways.

Heterotrimeric G proteins are composed of α, β, and γ subunits and play diverse roles in many aspects of cell regulation. In general, G proteins are classified according to the intracellular signaling pathway stimulated by their α subunits, although growing evidence is supporting a regulatory role for the tightly associated βγ dimers (Gibson and Gilman, 2006; Smrcka, 2008). Agonist activation of G protein-coupled receptors induces a conformational change within the receptor, which subsequently catalyzes the exchange of GDP for GTP on the Gα subunit leading to the dissociation of the heterotrimer into the GTP-bound Gα subunit and the functional Gβγ dimer (Gilman, 1987). These two mediators relay signals from the receptor to several downstream effectors, including ion channels, small GTPases, adenylyl cyclases, phosphodiesterases, and phospholipases, giving rise to the generation of respective second messenger molecules involved in regulating physiological processes (Offermanns, 2003).

Based on their sequence homology and differential regulation of effectors, G proteins are grouped into four functional classes: Gα_s, increasing the levels of cAMP via adenylyl cyclase; Gα_i, decreasing cAMP levels by inhibition of adenylyl cyclase or modulating potassium channels; Gα_q, activating phospholipase Cβ and eventually leading to a rise in intracellular calcium; and Gα_12/13, interacting with chloride channels and other second messenger systems (Morris and Malbon, 1999) and activating the small GTPase Rho involved in actin cytoskeleton reorganization (Wettschureck and Offermanns, 2005).

Members of the α₂-adrenoceptor family are prototype G_i protein-coupled receptors involved in the regulation of a wide number of physiological functions in vivo, including presynaptic inhibition of norepinephrine secretion from sympathetic nerves (Hein et al., 1999; Gilsbach et al., 2009), bradycardia and hypotension (MacMillan et al., 1996), analgesia and sedation (Lakhlani et al., 1997), body temperature, and intraocular pressure. The G_i subfamily of Gα subunits comprises three highly related members, Gα_i1, Gα_i2, and Gα_i3 (Gerhardt and Neubig, 1991; Nürnberg et al., 1995), which are characterized by their sensitivity to pertussis toxin. The three Gα_i subunits are encoded by distinct genes, termed Gnai1, Gnai2, and Gnai3 (Offermanns, 2003). These Gα_i isoforms share an amino acid sequence identity of higher than 85% and are characterized by partially overlapping expression patterns. In particular, Gα_i1 is primarily found in the nervous system, whereas Gα_i2 is expressed ubiquitously and represents the quantitatively predominant Gα_i isoform. Last, Gα_i3, the closest homolog of Gα_i1, is hardly detectable at the protein level in the neuronal system but is broadly expressed in peripheral tissues (Nürnberg, 2004).

The functional significance of G_i proteins and in particular the possible specificity of Gα_i isoforms in α₂-adrenoceptor-dependent signal transduction in vivo have not been fully explored. Here, we used mice with targeted deletions of individual Gα_i isoforms to examine for the first time their role in physiological functions mediated by α₂-adrenoceptor activation, i.e., inhibition of locomotor activity, induction of sleep, sedation/anesthetic-sparing, antinociception, hypothermia, bradycardia, and hypotension.

Materials and Methods

Animals.

All experiments were performed on four groups of mice: wild type (WT) and Gα_i1-, Gα_i2-, and Gα_i3-deficient mice, respectively. Generation and characterization of mouse models with targeted deletion of genes encoding for Gα_i proteins has been described previously (Rudolph et al., 1995; Jiang et al., 2002; Pineda et al., 2004; Gohla et al., 2007). Gα_i-deficient mice were backcrossed onto a C57BL6/J background for >11 generations. Adult mice (3–5 months of age; 20–25 g body weight) were maintained on a 12-h light/dark cycle in specified pathogen-free facilities with unlimited access to food and water. All animal procedures were approved by the animal care committee of the University of Freiburg and were carried out in accordance with the Guide for the Care and Use of Laboratory Animals as adopted and promulgated by the National Institutes of Health (Bethesda, MD).

[³H]Norepinephrine Release.

Pieces of prefrontal cortex were prepared from each animal after cervical dislocation as described previously (Trendelenburg et al., 2001). Tissue specimens from cardiac atria were processed as described previously (Altman et al., 1999; Hein et al., 1999). In brief, tissue segments were preincubated in 1 ml of medium containing 0.1 μM [³H]norepinephrine (GE Healthcare, Freiburg, Germany) for 30 min at 37°C. Segments were then placed in superfusion chambers between platinum electrodes, one segment per chamber, in which they were superfused with [³H]norepinephrine-free medium at a rate of 1.2 ml/min. Successive 2-min samples of the superfusate were collected from t = 50 min onward (t = 0 min being the start of superfusion). Six periods of electrical stimulation with pseudo-one pulse conditions (prefrontal cortex, 4 pulses/100 Hz; atria, 20 pulses/100 Hz; 2-ms pulse width; 80-mA amplitude) were applied at 8-min intervals. Concentration-response curves for the release-inhibiting effect of medetomidine were determined by addition of this α₂-agonist at increasing concentrations. At the end of experiments, tissues were dissolved and tritium was determined in superfusate samples and tissues. The superfusion medium contained 118 mM NaCl, 4.8 mM KCl, 1.3 mM CaCl₂ (cortex), 1.2 mM MgSO₄, 25 mM NaHCO₃, 1.2 mM KH₂PO₄, 11 mM glucose, 0.57 mM ascorbic acid, 0.03 mM disodium EDTA, and 0.001 mM desipramine (Hein et al., 1999).

The outflow of tritium was calculated as fraction of the tritium content of the tissue at the onset of the respective collection period (fractional rate; minutes⁻¹). The overflow elicited by electrical stimulation was calculated as the difference “total tritium outflow during and after stimulation” minus “basal outflow” and was then expressed as a percentage of the tritium content of the tissue at the time of stimulation (Trendelenburg et al., 2001, 2003). The calculation yielded the E_max value and EC₅₀ value of medetomidine (concentration causing half-maximal inhibition), and n is the number of superfusion chambers (containing one piece of tissue).

Spontaneous Locomotor Activity.

Locomotor activity was measured by placing individual animals into a transparent polypropylene animal cage (25 × 19 × 13 cm) with a 1-cm-thick layer of granulated bedding on the floor. The cages were surrounded by a custom-made infrared photobeam frame designed to measure activity. The baseline locomotor activity was measured over 10-min intervals for 30 min before and after administration of 0.9% saline or medetomidine (50 μg/kg i.p.) (n = 6–8 male mice/genotype group; age 12–16 weeks). Medetomidine (4-[1-(2,3-dimethylphenyl)ethyl]-1H-imidazole hydrochloride) was a gift from Orion Pharma (Espoo, Finland). UK14,304 was obtained from Tocris Bioscience (Bristol, UK).

Loss of Righting Reflex and Anesthetic-Sparing Effect.

Loss of the righting reflex was used as a measure of sedation. For this test, mice received intraperitoneal injections of medetomidine (50, 100, 200, 500, 750, or 1000 μg/kg i.p.). In a separate series of experiments, the sedative response to pentobarbital (50 mg/kg i.p.) was assessed. To assess the anesthetic sparing effect of α₂-adrenoceptor stimulation, mice received saline or medetomidine (50 or 100 μg/kg i.p.). Thirty minutes later, mice were placed in an airtight Plexiglas chamber, and isoflurane was administered at stepwise increasing concentrations for 5 min per concentration (0–1.2 vol% in O₂). Loss of the righting reflex was assessed at the end of each 5-min period. Mice were laid on their back and allowed to right themselves within 30 s (Gilsbach et al., 2009).

Antinociception.

The pain threshold was measured in WT, Gα_i1-, Gα_i2-, or Gα_i3-deficient mice, respectively, by the tail-flick method (Harvard Apparatus, Les Ulis, France). A high-intensity light was focused on the distal two thirds of mouse tail, and the time to flick their tail was automatically recorded and determined as the tail-flick latency (in seconds). A cut-off of 15 s and exposing a different part of the tail to the beam on each trial were applied to prevent the risk of tissue damage. The tail-flick latencies were determined 30 min after administration of saline or medetomidine (100 or 200 μg/kg i.p.).

Body Temperature.

Core body temperature of the mice was monitored at the end of the anesthetic sparing experiments and was thus recorded 60 min after administration of drug or vehicle using a rectal thermometer probe (TKM-0902; FMI, Seeheim-Ober Beerbach, Germany). Experiments were carried out at an ambient temperature of 23 ± 2°C.

Hemodynamic Measurements.

For aortic catheterization with a 1.4-French pressure-volume catheter (Millar Instruments Inc., Houston, TX), mice were anesthetized with isoflurane (2 vol% in O₂) and placed on a 37°C plate (Brede et al., 2002). The microtip catheter was inserted via the right carotid artery and advanced into the ascending aorta for pressure measurements. Medetomidine (6.5–330 μg/kg body weight in six doses) was applied via the left jugular vein. Each dose was infused over 1 min.

Locus Coeruleus Microdissection.

For microscopical microdissection of locus coeruleus specimens, tissues were frozen in liquid nitrogen. Then, 15-μm cryostat sections were mounted on glass slides and dehydrated in ethanol and xylene, followed by microdissection using an AM6000 inverted microscope (Leica, Wetzlar, Germany). The area of the locus coeruleus (Paxinos and Franklin, 2001) was microdissected using MicroChisels (Eppendorf, Hamburg, Germany) and aspirated via a micropipette. Xylene was evaporated and RNA was isolated using the RNeasy Micro kit (QIAGEN, Hilden, Germany). The identity of the locus coeruleus was verified by quantitative real-time PCR-based analysis of tyrosine hydroxylase and dopamine β-hydroxylase expression.

Immunohistochemistry.

For immunodetection of adrenergic neurons in the locus coeruleus or sympathetic ganglia, cryostat sections from perfusion-fixed mice [4% paraformaldehyde and 0.1% glutaraldehyde in phosphate-buffered saline (PBS)] were used. Sections were blocked in 1% bovine serum albumin, 0.04% Triton X-100 in PBS, and incubated overnight with an anti-tyrosine hydroxylase antiserum, followed by Alexa488-coupled secondary antibodies.

Quantitative Real-Time PCR.

mRNA quantification by real-time PCR from murine tissues was performed as described previously (Gilsbach et al., 2007). For quantitative real-time PCR, 30 μl of the amplification mixture (Quantitect SYBR Green kit; QIAGEN) was used containing 20 ng of reverse-transcribed RNA and 300 nM primers (MWG, Ebersberg, Germany) specific for Gα_i subunits or the ribosomal protein S29 (Table 1). Reactions were run in triplicate on an MX3000P detector (Stratagene, Amsterdam, The Netherlands). The cycling conditions were as follows: 15-s polymerase activation at 95°C and 40 cycles at 95°C for 15 s, at 58°C for 30 s, and at 72°C for 30 s. Absolute copy numbers were determined using standard curves of corresponding linear DNA fragments (Gilsbach et al., 2007).

TABLE 1.

Primers used to determine Gα_i isoform expression by quantitative reverse transcription-PCR

Gene	Primer Sequence [5′ → 3′]		GenBank Accession No.	Product Size
				bp
Gαi1	ACGATTCGGCAGCGTACT	s	NM_010305	72
	TCCTGCTGAGTTGGGATGTA	as
Gαi2	GAGGTGAAGTTGCTTCTGTTAGG	s	NM_008138	77
	TTCATGGATGATCTTCATCTGC	as
Gαi3	GATTGATTTTGGGGAATCTGC	s	NM_010306	85
	AATCACGCCTGCTAGTTCTGA	as
Rps29	ATGGGTCACCAGCAGCTCTA	s	NM_009093	154
	AGCCTATGTCCTTCGCGTACT	as

bp, base pair; Rps29, ribosomal protein S29; s, sense; as, antisense.

Statistical Analysis.

Data are presented as means ± S.E.M. of individual data points. Data were analyzed using one or two-way analysis of variance or Kruskal-Wallis test (ratios) followed by appropriate post hoc tests. A p value of less than 0.05 was considered as statistically significant.

Results

Feedback Control of Norepinephrine Release from Sympathetic Nerves.

To evaluate whether a distinct Gα_i isoform mediates the feedback inhibition of norepinephrine release from sympathetic nerves after α₂-adrenergic activation, the inhibition of electrically evoked release of [³H]norepinephrine by the α₂-adrenoceptor agonist medetomidine was tested in prefrontal brain cortex slices (Fig. 1; Table 2) and cardiac atria (Table 2) isolated from wild-type or Gα_i-deficient mice. Neurotransmitter release was elicited by short pulse trains of electrical field stimulation (Fig. 1a). In brain cortex, electrically evoked maximal release of [³H]norepinephrine did not differ between tissue specimens from wild-type or Gα_i-deficient mice (data not shown). In the presence of increasing concentrations of medetomidine, [³H]norepinephrine release was inhibited to a similar degree in tissue slices from all genotypes analyzed (Fig. 1, b–d; Table 1). The EC₅₀ values for the inhibitory effect of medetomidine did not differ significantly between genotype groups (Fig. 1, b–d; Table 2). Similar results were obtained for inhibition of [³H]norepinephrine release from isolated cardiac atria. Concentrations of medetomidine to inhibit transmitter release from isolated atria by 50% did not differ significantly between tissues obtained from Gα_i-deficient or wild-type animals (Table 2). These results indicate that a single Gα_i isoform is not required in an essential/nonredundant manner to inhibit electrically evoked release of norepinephrine from adrenergic nerve terminals in the brain cortex or in cardiac atria.

Fig. 1.

Effect of the α₂-adrenoceptor agonist medetomidine on [³H]norepinephrine release from brain cortex slices. a, tritium efflux- versus time-curves from brain cortex slices of Gα_i1-KO mice. Cortex slices were stimulated with four rectangular electrical pulses at 100 Hz (2-ms pulse width; 80 mA) applied at 8-min intervals. [³H]Norepinephrine release was inhibited by addition of medetomidine. b to d, concentration-response curves for the inhibition of [³H]norepinephrine release by medetomidine. For ease of comparison, results from wild-type specimens (open squares) were reproduced in b to d. Data are means ± S.E.M. from n = 8 to 12 mice.

TABLE 2.

Inhibition of [³H]norepinephrine release from isolated mouse cardiac atria or prefrontal brain cortex slices by the α₂-adrenoceptor agonist medetomidine

pEC₅₀ values were determined from medetomidine concentration-response curves obtained from experiments using mouse cardiac atrial tissue or cortical brain slices. pEC₅₀ values did not differ significantly between wild type and the indicated Gα_igenotypes (p > 0.05)

	Atria (pEC50 ± S.E.M.)		Cortex (pEC50 ± S.E.M.)
Wild type	9.29 ± 0.18	(n = 5)	9.16 ± 0.11	(n = 12)
Gαi1 KO	8.85 ± 0.36	(n = 5)	8.81 ± 0.18	(n = 8)
Gαi2 KO	9.79 ± 0.28	(n = 5)	9.21 ± 0.12	(n = 12)
Gαi3 KO	8.84 ± 0.26	(n = 5)	9.03 ± 0.14	(n = 12)

Inhibition of Locomotor Activity.

α₂-Adrenoceptor agonists (e.g., clonidine and medetomidine) have been shown to elicit strong sedative and hypnotic effects via activation of α_2A-adrenoceptors (Lakhlani et al., 1997). Thus, we tested which Gα_i isoform may be specifically required to inhibit spontaneous locomotor activity in a photobeam cage system (Fig. 2, a and b). Basal locomotor activity did not differ between genotypes (Fig. 2a). After intraperitoneal application of medetomidine (50 μg/kg), locomotor activity was reduced to 9.2 ± 3.8% in wild-type mice, 7.9 ± 3.7% in Gα_i1-KO mice, and 4.3 ± 3.3% in Gα_i3-KO mice (Fig. 2b). However, the sedative effect of medetomidine was significantly attenuated in Gα_i2-KO mice. Medetomidine reduced locomotor behavior to 37.2 ± 8.1% in Gα_i2-KO mice (Fig. 2b).

Fig. 2.

Inhibition of locomotor activity and loss of righting reflex by medetomidine (a–c) or pentobarbital (d) in mice lacking Gα_i isoforms. a, spontaneous locomotor activity as determined in an infrared photobeam cage system did not differ between genotype groups. b, medetomidine (50 μg/kg) reduced activity by >90% in WT, Gα_i1-KO, or Gα_i3-KO mice but to 37.2 ± 8.1% in Gα_i2-KO mice (n = 6–8/genotype; ∗, p < 0.01 versus WT). c, higher doses of medetomidine induced a strong sedative effect, i.e., loss of the righting reflex, in all genotype groups (percentage of mice that lost the righting reflex; p > 0.05 versus WT). d, pentobarbital-induced loss of righting reflex. Time to present loss of righting after administration of 50 mg/kg i.p. pentobarbital (mean ± S.E.M. represented by left margin of the horizontal bars) or time to recovery from loss of righting (mean ± S.E.M. represented by right margin of horizontal bars) did not significantly differ between genotypes. Data are means ± S.E.M. from n = 6 mice/group (p > 0.05 versus WT).

Loss of Righting Reflex and Anesthetic Sparing Induced by Medetomidine.

Next, the effect of the α₂-agonist medetomidine on the righting reflex and anesthetic sparing was assessed (Figs. 2 and 3). At first, loss of the righting reflex in response to intraperitoneal injection of medetomidine was assessed (Fig. 2c). At doses of 750 or 1000 μg/kg medetomidine, a strong sedative effect was induced in all genotype groups (Fig. 2c). At 750 μg/kg medetomidine, 7 of 14 WT mice (50%), 12 of 16 Gα_i1-KO mice (75%), 8 of 13 Gα_i2-KO mice (61.5%), and 7 of 12 Gα_i3-KO mice (58.3%) lost their righting reflex. Statistical evaluation did not reveal significant differences in the sedative response between wild-type animals and mice deficient in Gα_i isoforms (n = 12–16 mice/genotype group; p > 0.05).

Fig. 3.

Anesthetic sparing effect of α₂-adrenoceptor activation in mice deficient in individual Gα_i protein subunits. a to d, medetomidine was administered at doses that did not cause loss of the righting reflex (50 or 100 μg/kg i.p.) 30 min before exposure to increasing concentrations of isoflurane (0–1.2 vol% in O₂). Medetomidine caused a leftward shift of the isoflurane-mediated loss of righting reflex curves in WT (50 or 100 μg/kg) mice and in animals lacking Gα_i1 (100 μg/kg) and Gα_i3 (100 μg/kg) but not in Gα_i2-deficient mice (n = 12 mice/genotype). e, concentration of isoflurane required to induce loss of righting reflex in 50% of wild-type or Gα_i-deficient mice in the absence (0, control) or presence of medetomidine (50 and 100 μg/kg i.p.; ∗, p < 0.05 versus control).

To assess the sensitivity of Gα_i1-, Gα_i2-, and Gα_i3-deficient mice to sedation through non–α₂-adrenoceptor stimuli, animals received 50 mg/kg of the GABA_A receptor agonist pentobarbital, and the time until loss or recovery (Fig. 2d) of the righting reflex was recorded. Similar to medetomidine treatment, the induction or recovery time of the hypnotic effect of pentobarbital did not differ significantly between the four genotype groups analyzed (Fig. 2d).

When given at smaller doses, α₂-agonists have been shown to reduce dosing of inhalative anesthetics to induce sedation (Lakhlani et al., 1997). This “anesthetic sparing” effect may also be used therapeutically for patients to reduce the doses of general anesthetics (Maze et al., 2001). In wild-type mice, 50 or 100 μg/kg medetomidine caused a significant leftward shift of the concentration-response curve for isoflurane to induce loss of righting (Fig. 3, a and e). A similar shift to lower isoflurane concentrations was observed in mice deficient in Gα_i1 or Gα_i3 at 100 μg/kg but not at 50 μg/kg medetomidine (Fig. 3, b, d, and e). However, this effect was completely absent in Gα_i2-deficient mice (Fig. 3, c and e), indicating that Gα_i2 subunits are essential to mediate the anesthetic sparing effect of α₂-agonists in a nonredundant manner.

Similar results were obtained for UK14,304, an α₂-adrenceptor agonist that differs in its chemical structure from medetomidine (Fig. 4, a and b). The reduction in locomotor activity by the α₂-agonist UK14,304 was significantly blunted in Gα_i2-KO mice (Fig. 4b; ∗∗p < 0.01 versus WT). Furthermore, UK14,304 caused a leftward shift of the isoflurane-mediated loss of righting reflex curves in WT mice and in animals lacking Gα_i1 or Gα_i3 but not in Gα_i2-deficient mice (Fig. 4, c–f).

Fig. 4.

Inhibition of locomotor activity and anesthetic sparing effect of the α₂-adrenoceptor agonist UK14,304. a, spontaneous locomotor activity as determined in an infrared photobeam cage system did not differ between genotype groups. b, UK14,304 (100 μg/kg)-mediated reduction in activity was significantly blunted in Gα_i2-KO mice (n = 8–12/measurements per genotype; ∗∗, p < 0.01 versus WT). c to f, UK14,304 was administered at 300 μg/kg i.p. 30 min before exposure to increasing concentrations of isoflurane (0–1.2 vol% in O₂). UK14,304 caused a leftward shift of the isoflurane-mediated loss of righting reflex curves in WT mice and in animals lacking Gα_i1 or Gα_i3 but not in Gα_i2-deficient mice (n = 6 mice/genotype, log rank test).

Role of Gα_i1, Gα_i2, and Gα_i3 Isoforms in the Antinociceptive Effect Mediated by α₂-Adrenoceptor Activation.

We determined whether Gα_i1, Gα_i2, or Gα_i3 proteins are required for the antinociceptive effect of medetomidine in the tail-flick assay (Lakhlani et al., 1997; Stone et al., 1997). In the absence of medetomidine, tail-flick latency times did not differ between Gα_i-deficient mouse strains compared with wild-type mice (Fig. 5a). After application of medetomidine (100 or 200 μg/kg i.p.), all genotype groups showed a significant and comparable antinociceptive effect as evidenced by a dose-dependent increase of the time until tail withdrawal (Fig. 5a).

Fig. 5.

Antinociceptive and hypothermic effects of α₂-adrenoceptor stimulation in mice lacking Gα_i protein isoforms. a, pain threshold was assessed by determining the tail-flick latency. Administration of medetomidine (100 or 200 μg/kg i.p.) prolonged the tail-flick latency in all groups, although this effect did not differ significantly between genotypes (∗, p < 0.001 versus respective saline group; n = 8/genotype). b, body core temperature was determined during isoflurane anesthesia by a rectal probe. Administration of medetomidine (100 or 200 μg/kg i.p.) caused a reduction in body temperature in all genotype groups (∗, p < 0.05; ∗∗, p < 0.01; and ∗∗∗, p < 0.001 versus basal values in the absence of medetomidine; n = 12/genotype).

Role of Gα_i1, Gα_i2, and Gα_i3 Proteins in Hypothermia Mediated by α₂-Adrenoceptor Activation.

At rest, body core temperature did not differ between wild-type mice or animals deficient in Gα_i subunits (Fig. 5b). After administration of medetomidine, all groups showed a strong and dose-dependent hypothermic effect as measured by an average temperature decrease of 4.1 ± 0.22°C after treatment with 200 μg/kg medetomidine. Again, no significant differences in the α₂-agonist induced hypothermic effect were observed between the genotype groups (Fig. 5b).

Role of Gα_i1, Gα_i2, and Gα_i3 Isoforms in the Cardiovascular Effects of α₂-Adrenoceptor Stimulation.

Next, we analyzed the role of Gα_i proteins downstream of the α₂-adrenoceptor in cardiovascular function. It is interesting that basal heart rate and systolic or diastolic blood pressure as determined by microtip catheterization during isoflurane anesthesia did not differ between genotypes (Fig. 6). To assess the bradycardic and hypotensive effects of α₂-adrenoceptor stimulation, medetomidine was infused intravenously at increasing doses (Fig. 6). In wild-type mice, medetomidine (at the maximal dose of 500 μg/kg) lowered heart rate by 214 ± 11 beats/min. Systolic and diastolic blood pressure were decreased by 19.5 ± 5.9 and 20.0 ± 5.4 mm Hg by the α₂-agonist, respectively (Fig. 6, b and c). Comparable bradycardic or hypotensive effects of medetomidine were recorded in all three Gα_i-deficient mouse strains (p > 0.05).

Fig. 6.

Hemodynamic effects of α₂-adrenoceptor stimulation in mice deficient in Gα_i protein isoforms. Heart rate (a) and aortic systolic (b) and diastolic (c) pressures were determined during isoflurane anesthesia by Millar microtip catheterization. Medetomidine elicited similar bradycardic (a) and hypotensive (b and c) effects in mice from all genotype groups (n = 6–8 mice/group; p > 0.05 versus WT).

Expression of Gα_i Proteins in the Locus Coeruleus or Sympathetic Ganglia.

To determine the expression of Gα_i isoforms in neurons involved in the tested pharmacological α₂-agonist effects, Gα_i mRNA levels were measured by quantitative real-time PCR in wild-type tissue specimens. For this purpose, the locus coeruleus was identified by tyrosine hydroxylase immunohistochemistry (Fig. 7a), and the area of the locus coeruleus was microdissected from adjacent cryostat sections. In these specimens, Gα_i1 and Gα_i2 subunits were both expressed at similar levels (Fig. 7c). In contrast, 4-fold lower amounts of Gα_i3 mRNA were detected in the microdissected locus coeruleus. Also in stellate ganglia (Fig. 7b), which contain sympathetic neurons innervating the heart and thoracic blood vessels, Gα_i2 and Gα_i1 were more abundantly expressed than Gα_i3 (Fig. 7d).

Fig. 7.

Expression of Gα_i isoform mRNA in locus coeruleus and stellate ganglia from wild-type mice. a and b, identification of the locus coeruleus in cryostat sections through wild-type mouse brain (a) or sympathetic ganglion stellata (b) by anti-tyrosine hydroxylase immunostaining (green fluorescence). Nuclei were identified by blue 4′,6-diamidino-2-phenylindole (Dapi) fluorescence. Right, overlay of tyrosine hydroxylase and Dapi signals. Scale bars, 200 μm (a and b). c, quantification of Gα_i isoform mRNA in microdissected locus coeruleus or total stellate ganglia specimens by quantitative reverse transcription-PCR (∗, p < 0.05 versus Gα_i1).

Discussion

The diversity of G protein-coupled receptors and heterotrimeric G protein subunits translates into a wide variety of physiological and pharmacological effects that are propagated by different intracellular G protein-dependent effector mechanisms. However, the biological significance and potential subtype- or isoform-specific roles within receptor or G protein subfamilies has not been fully elucidated. In the present study, we have tested whether α₂-adrenoceptors that are known to couple to G_i proteins (the latter originally named for their ability to inhibit the activity of adenylyl cyclases) require specific Gα_i isoforms for their physiological function in mouse models in vivo. It is interesting that inhibition of locomotor activity and the anesthetic sparing effect of low doses of the α₂-adrenoceptor agonist medetomidine in the presence of isoflurane were blunted or absent in mice lacking Gα_i2 (Figs. 2 and 3). In contrast, several other functions elicited by α₂-adrenoceptor activation, including feedback inhibition of neurotransmitter release, bradycardia, hypotension, induction of sleep, antinociception, and hypothermia, did not essentially require individual Gα_i isoforms. Thus, functional redundancy of Gα_i isoforms may predominate over specificity to activate distinct intracellular α₂-receptor/Gα_i-driven signaling pathways in vivo. In this regard, previous phenotypic analysis of Gα_i knockout mouse strains revealed further shared as well as gene-specific functions of Gα_i proteins in vivo. For example, mice lacking both Gα_i2 and Gα_i3 are growth retarded and die in utero, clearly demonstrating functional redundancy between these two isoforms during embryonic development (Gohla et al., 2007). In contrast, the specific roles of Gα_i2 and Gα_i3 in alveolar macrophage function (Skokowa et al., 2005) and antiautophagic action (Gohla et al., 2007), respectively, cannot be compensated by each other.

α₂-Adrenoceptors are members of the family of adrenergic receptors that mediate the biological functions of the endogenous catecholamines epinephrine and norepinephrine (Hein, 2001; Gilsbach and Hein, 2008; Gilsbach et al., 2009). To date, nine different adrenergic receptor subtypes have been cloned and arranged into three receptor groups, including α_1A,B,D, α_2A,B,C, and β_1,2,3 (Bylund et al., 1994). For the subfamily of α₂-adrenoceptors, mouse models with targeted deletions of the individual subtypes have greatly advanced our understanding of the physiological role and the therapeutic potential of these receptors (for recent review, see Gilsbach and Hein, 2008). In this study, the α₂-agonists medetomidine and UK14,304 were used to activate α₂-mediated signaling pathways in vivo. Medetomidine and its active enantiomer dexmedetomidine is a partial agonist with similar potency at all three α₂-adrenoceptor subtypes and approximately 1000-fold selectivity for α₂- versus α₁-adrenoceptors (Jasper et al., 1998). Activation of α_2A-receptors could be linked with bradycardia and hypotension (MacMillan et al., 1996), sedation (Lakhlani et al., 1997; Gilsbach et al., 2009), and consolidation of working memory (Wang et al., 2007). Hypothermia and antinociception induced by α₂-agonists depend primarily on functional α_2A-adrenoceptors (Stone et al., 1997; Gilsbach et al., 2009), but other subtypes may also contribute to these pharmacological effects under certain conditions (Sallinen et al., 1997; Fairbanks et al., 2009). α_2B-receptors counteracted the hypotensive effect of α_2A-receptors (Link et al., 1996) and were essential for placenta vascular development (Philipp et al., 2002). α_2C-Receptors were identified as feedback regulators of adrenal catecholamine release (Brede et al., 2002). Thus, most of the pharmacological functions tested in the present study were mediated by the α_2A-adrenoceptor subtype, with one exception: in vitro experiments have demonstrated that all three α₂-adrenoceptor subtypes may participate in feedback inhibition of neurotransmitter release from adrenergic neurons (Trendelenburg et al., 2003). However, despite expression of all the α₂-adrenoceptor subtypes in postganglionic sympathetic neurons (Trendelenburg et al., 2003), functional specificity could be demonstrated. α_2A-Adrenoceptors inhibited norepinephrine release from isolated mouse atria primarily at high action potential frequencies, whereas α_2C-adrenoceptors operated at lower stimulation frequencies (Hein et al., 1999). In the present study, short trains of electrical stimulation at high frequency (100 Hz; “pseudo-one pulse condition”) were used to favor α_2A-adrenoceptor action.

In contrast to the functional specificity observed with individual α₂-adrenoceptor subtypes expressed in the same neuron, we did not find any specificity for Gα_i isoforms in terms of inhibition of neurotransmitter release from prefrontal cortex brain slices or cardiac atria in this study. To test whether this lack of specificity was associated with a coexpression of Gα_i isoforms (and hence potential functional redundancy) in the same neurons, we determined the mRNA expression of Gα_i isoforms in microdissected locus coeruleus and stellate ganglia. Noradrenergic neurons from the locus coeruleus project to various regions in the central nervous system, including the prefrontal cortex. In addition, inhibition of the activity of locus coeruleus neurons has been implicated in the sedative and sleep-inducing effects of α₂-adrenoceptor agonists (Mizobe et al., 1996). It is interesting that although Gα_i1 and Gα_i2 subunits predominated in their expression levels over Gα_i3 in this brain nucleus (Fig. 7), genetic deletion of any of the three Gα_i subunits failed to affect feedback inhibition of [³H]norepinephrine release from isolated brain cortex (Fig. 1). In contrast, two tests to assess the sedative effects of high and low doses of α₂-adrenoceptor agonists differed in their requirement for Gα_i subunits. At high doses of medetomidine, ablation of expression of single Gα_i isoforms did not affect the agonist-induced loss of righting (Fig. 2c). In contrast, the anesthetic sparing effect of medetomidine given at 5- to 10-fold lower doses was specifically lost in mice with targeted deletion of the Gα_i2 gene (Fig. 3c). This observation is interesting given the fact that Gα_i3 is up-regulated in various tissues from Gα_i2-deficient mice (Rudolph et al., 1995; Gohla et al., 2007) by currently unknown mechanism(s). The present findings indicate that α_2A-adrenoceptors, especially at low levels of receptor activation, may couple specifically to Gα_i2-containing heterotrimeric G_i proteins. However, at higher agonist concentrations, specificity of receptor-G_i protein coupling may be lost, indicating functional redundancy among the Gα_i isoforms expressed. Alternatively, agonist-induced loss of righting and anesthetic sparing may be mediated by separate neurons and/or brain regions differing in their relative expression of Gα_i isoforms. Indeed, recent data suggest that in addition to their action in the locus coeruleus, α₂-adrenoceptor agonists may activate an endogenous sleep-promoting pathway (Nelson et al., 2002; Lu et al., 2008). Transgenic rescue experiments expressing α_2A-adrenoceptors under control of the dopamine β-hydroxylase promoter have demonstrated that only few functions of α₂-agonists were mediated by α₂-receptors in adrenergic neurons, including inhibition of norepinephrine release and inhibition of locomotor activity (Gilsbach et al., 2009). Future experiments using neuron-specific gene targeting strategies will be required to determine whether sleep and anesthetic sparing have different neuronal substrates. Furthermore, electrophysiological experiments in tissue slices from selected brain regions will be essential to demonstrate direct coupling of α_2A-adrenoceptors and Gα_i2 proteins.

In contrast to inhibition of locomotor activity and anesthetic sparing, we did not identify any other pharmacological effect of α₂-adrenoceptor activation that specifically required one Gα_i protein isoform. This may be due to a functional redundancy of Gα_i subunits as discussed above or due to involvement of other pertussis-sensitive Gα subunits in these effects, most notably the Gα_o proteins that are highly abundant in the central nervous system (Nürnberg, 2004). However, mice deficient in Gα_o could not be included in the present study, because constitutive deletion of Gα_o proteins already results in postnatal lethality and multiple neurological deficits (Jiang et al., 1998). It is interesting that Gα_o has been implicated as the primary signaling element coupling α₂-adrenoceptors to N-type calcium channels in sympathetic neurons (Jeong and Ikeda, 2000a,b). Moreover, in rat neurons expressing a Gα_o subunit resistant to pertussis toxin and regulators of G protein signaling proteins, norepinephrine-induced calcium current inhibition was shifted to lower concentrations (Jeong and Ikeda, 2000a,b). Thus, neuron type-specific and/or inducible deletion of the Gα_o gene will be required to test the functional significance of Gα_i versus Gα_o proteins in α₂-adrenoceptor function in the future.

The present study demonstrates for the first time that inhibition of locomotor activity and anesthetic sparing induced by α_2A-adrenoceptor activation specifically requires signaling via the Gα_i2 isoform of heterotrimeric G_i proteins.