Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase

Abstract

Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (10⁰ to 10^-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide.

The human genome encodes at least 16 DNA polymerases (Pol) that are involved in replicating and maintaining the integrity of genomic DNA. Human DNA polymerases are classified into four families: A, B, X, and Y. Y-family DNA polymerases are involved in DNA damage tolerance pathways, whereby a Y-family enzyme rescues stalled DNA replication at sites of DNA damage. Humans have four known Y-family members: Pol η, Pol ι, Pol κ, and Rev1. Rev1 is found in the genome of all eukaryotes (1) and is capable of functioning in both catalytic and structural roles. Composed of 1,251 amino acids (2), human Rev1 (hRev1) is organized into a central catalytic domain that is flanked by an N-terminal BRCT domain and a C-terminus with two ubiquitin-binding motifs and a domain for polymerase interactions (3). As a scaffold protein, Rev1 interacts with proliferating cell nuclear antigen (PCNA) (4-7), ubiquitinated proteins (5, 6), and DNA polymerases η, κ, ι, and ζ (8-15). These findings support a model, whereby Rev1 is involved in polymerase switching at sites of DNA damage (16-18). In regards to enzymatic activity, hRev1 preferentially inserts dCTP opposite a templating base dG (2, 19-22), however, unlike other human DNA polymerases, this incorporation event proceeds in a protein template-directed manner rather than a DNA template-dependent manner with Watson-Crick base pairing (23). Instead, the incoming dCTP hydrogen bonds with R357, and the extrahelical template base dG is accommodated in a hydrophobic pocket while L358 rests in the conventional location of a templating base (Figure 1) (23).

Figure 1. Active site of hRev1.

Important active site residues that interact with an incoming dCTP or the templating base dG are shown (PDB 3GQC). The dashed lines represent hydrogen bonds, and the four magnesium ions are shown as gray spheres.

Rev1 and Polζ are responsible for the majority of spontaneous and DNA damage-induced mutagenic events in yeast; early studies reveal similar findings in mammalian cell lines (24-26). In human tissues, the rev1 gene is ubiquitously expressed, but the highest level of expression is in human testis and ovary based on RT-PCR results (2, 8, 19). Furthermore, hRev1 has been observed at replication foci during both G1 and S phases following UV-irradiation (27). However, it has also been reported that the protein levels of hRev1 are unaffected by UV irradiation or cell cycle progression (28). In addition to a role in translesion synthesis, Rev1 has been implicated in somatic hypermutation, and current data suggests the catalytic domain participates in the generation of C to G transversions (29, 30). To better understand the enzymatic function of hRev1, we have performed pre-steady state kinetic analysis on a truncated version of hRev1. Our studies established a kinetic basis for nucleotide selection by hRev1.

Experimental Procedures

Materials

These chemicals were purchased from the following companies: [γ-³²P]ATP, MP Biomedicals; deoxyribonucleotide 5′-triphosphates, GE Healthcare; ribonucleotide 5′-triphosphates, MBI Fermentas; 2′-aracytidine-5′-triphosphate (araCTP), 2′-deoxy-2′,2′-difluorocytidine-5′-triphosphate (GemCTP), 2′-fluoro-2′-deoxycytidine-5′-triphosphate (2′-F-CTP), 2′-O-methylcytidine-5′-triphosphate (2′-OCH₃-CTP), and 5-nitroindole 5′-triphosphate (dNITP), TriLink Biotechnologies; Bio-Spin 6 columns, Bio-Rad Laboratories; OptiKinase™, USB Corporation; synthetic oligodeoxyribonucleotides 21-mer, 5′-phosphorylated 19-mer, and 41-mers, Integrated DNA Technologies. Pyrene 5′-triphosphate (dPTP) was a generous gift from Dr. John-Stephen Taylor (Washington University at St. Louis).

Expression and purification of hRev1

The expression plasmid pBAD-REV1S, a generous gift from K. Kamiya at Hiroshima University, encoded a truncated version of human Rev1 (341-829) (31). The expression and purification of truncated human Rev1 was performed as previously described (19).

DNA substrates

Commercially synthesized oligomers in Table 1 were purified using polyacrylamide gel electrophoresis (32, 33). The 21-mer primer was radiolabeled with [γ-³²P]ATP and OptiKinase™ according to the manufacturer's protocol, and the unreacted [γ-³²P]ATP was subsequently removed via a Bio-Spin 6 column. The primer-template DNA substrates (32) and single-nucleotide gap DNA substrate (33) were annealed as described previously.

Table 1.

Sequences of the D-DNA substrates^a

D-G	5′–CGCAGCCGTCCAACCAACTCA–3′
	3′–GCGTCGGCAGGTTGGTTGAGTGTCAGCTAGGTTACGGCAGG–5′
D-A	5′–CGCAGCCGTCCAACCAACTCA–3′
	3′–GCGTCGGCAGGTTGGTTGAGTATCAGCTAGGTTACGGCAGG–5′
D-T	5′–CGCAGCCGTCCAACCAACTCA–3′
	3′–GCGTCGGCAGGTTGGTTGAGTTTCAGCTAGGTTACGGCAGG–5′
D-C	5′–CGCAGCCGTCCAACCAACTCA–3′
	3′–GCGTCGGCAGGTTGGTTGAGTCTCAGCTAGGTTACGGCAGG–5′
D-G Gap	5′–CGCAGCCGTCCAACCAACTCA AGTCGATCCAATGCCGTCC–3′
	3′–GCGTCGGCAGGTTGGTTGAGTGTCAGCTAGGTTACGGCAGG–5′

^aEach DNA substrate is composed of a 5′-radiolabeled 21-mer and a 41-mer template which has the unique template bases in bold. D-G Gap has a 5′-phosphorylated 19-mer.

Measurement of the k_p and K_d for single nucleotide incorporation

Kinetic assays were completed using buffer R (50 mM HEPES, pH 7.5 at 37 °C, 5 mM MgCl₂, 50 mM NaCl, 0.1 mM EDTA, 5 mM DTT, 10% glycerol, and 0.1 mg/ml BSA). All kinetic experiments described herein were performed at 37 °C, and the reported concentrations were final after mixing all of the components. A pre-incubated solution containing hRev1 (120 nM) and 5′-[³²P]-radiolabeled DNA substrate (30 nM) was mixed with increasing concentrations (0.02-800 μM) of nucleotide in buffer R at 37 °C. Aliquots of the reaction mixtures were quenched at various times using 0.37 M EDTA. A rapid chemical-quench flow apparatus (KinTek) was utilized for fast nucleotide incorporations. Reaction products were resolved using sequencing gel electrophoresis (17% acrylamide, 8 M urea) and quantitated with a Typhoon TRIO (GE Healthcare). The time course of product formation at each nucleotide concentration was fit to a single-exponential equation (Eq. 1) using a nonlinear regression program, KaleidaGraph (Synergy Software), to yield an observed rate constant of nucleotide incorporation (k_obs). The k_obs values were then plotted as a function of nucleotide concentration and fit using the hyperbolic equation (Eq. 2) which resolved the k_p and K_d values for nucleotide incorporation catalyzed by hRev1.

$$[\text{Product}]=\text{A}[1-\text{exp}(-k_{\mathit{\text{obs}}}\text{t})]$$ Eq. 1

$$k_{\mathit{\text{obs}}}=k_p[\text{dNTP}]/\{[\text{dNTP}]+K_d\}$$ Eq. 2

Results

Kinetic basis of dNTP selection

Transient state kinetic methods were employed to measure the substrate specificity and polymerase fidelity of a truncated form of hRev1. A pre-incubated solution of hRev1 (120 nM) and 5′-[³²P]-labeled D-G DNA (30 nM) was mixed with increasing concentrations of dCTP•Mg²⁺ (see Experimental Procedures). These single-turnover conditions in which hRev1 is in molar excess over DNA permits the direct observation of the DNA substrate being converted to the extended DNA product in a single pass through the enzymatic pathway (34). The extended DNA product was quantitated, plotted (Figure 2), and fit to the appropriate equations (Equations 1 or 2) that resolved a maximum rate of nucleotide incorporation (k_p) of 22.4 ± 0.9 s^-1 and an equilibrium dissociation constant (K_d) of 2.2 ± 0.3 μM (Table 2). Notably, Tsai and Johnson report that nucleotide binding to T7 DNA polymerase, an A-family enzyme, induces several conformational changes preceding the incorporation step, thereby arguing that the measured K_d value under single-turnover reaction conditions is not a true equilibrium dissociation constant (35). Since there is no published evidence to support the existence of such conformational changes for the protein template-directed hRev1, we assume the K_d values measured in this paper reflect the true nucleotide binding affinity (1/K_d). To examine how efficient hRev1 incorporates dCTP opposite other templating bases, we performed similar single-turnover assays using DNA substrates with dA (D-A), dC (D-C), and dT (D-T) as the template base (Table 2). The substrate specificity constants (k_p/K_d), efficiency ratio, and fidelity were calculated. The ground-state binding affinity dropped 4- to 55-fold while the rate for dCTP incorporation was reduced by 7- to 12-fold when the templating base was not dG. Overall, the catalytic efficiency was up to 360-fold greater when dCTP was inserted into D-G. The preferential order of dCTP incorporation opposite the four template bases was dG ≫ dA > dT ≈ dC.

Figure 2. Concentration dependence on the pre-steady state rate constant of deoxycytidyl transferase catalyzed by hRev1.

(A) A pre-incubated solution of hRev1 (120 nM) and 5′-[³²P]-labeled D-6T (30 nM) was rapidly mixed with increasing concentrations of dCTP •Mg²⁺ (0.2 μM, ●; 0.5 μM, ○; 1 μM, ■; 2 μM, □; 5 μM, ▲; 10 μM, △; and 25 μM, ◆) for various time intervals. The solid lines are the best fits to a single-exponential equation which determined the observed rate constant, k_obs. (B) The k_obs values were plotted as a function of dCTP concentration. The data (●) were then fit to a hyperbolic equation, yielding a k_p of 22.4 ± 0.9 s^-1 and a K_d of 2.2 ± 0.3 μM.

Table 2.

Kinetic parameters for nucleotide incorporation into D-DNA catalyzed by hRev1 at 37 °C.

dNTP	kp (s-1)	Kd (μM)	kp/Kd (μM-1s-1)	Efficiency Ratioa	Fidelityb
Template dG (D-G)
dCTP	22.4 ± 0.9	2.2 ± 0.3	10
dATP	0.050 ± 0.004	70 ± 20	7.1 × 10-4	1.4 × 104	7.0 × 10-5
dGTP	6.3 ± 0.3	90 ± 10	7.0 × 10-2	1.5 × 102	6.8 × 10-3
dTTP	0.88 ± 0.06	22 ± 7	4.0 × 10-2	2.5 × 102	3.9 × 10-3
Template dA (D-A)
dTTP	0.092 ± 0.007	44 ± 6	2.1 × 10-3	4.9 × 103
dCTP	1.87 ± 0.05	9.5 ± 0.8	2.0 × 10-1	5.2 × 101	9.9 × 10-1
Template dT (D-T)
dATP	0.00235 ± 0.00008	2.7 ± 0.4	8.7 × 10-4	1.2 × 104
dCTP	1.93 ± 0.05	35 ± 2	5.5 × 10-2	1.8 × 102	9.8 × 10-1
Template dC (D-C)
dGTP	0.0073 ± 0.0010	30 ± 10	2.4 × 10-4	4.2 × 104
dCTP	3.4 ± 0.2	120 ± 10	2.8 × 10-2	3.6 × 102	9.9 × 10-1
Template dG (D-G Gap)
dCTP	11 ± 1	8 ± 2	1.4	7.4

^aCalculated as (k_p/K_d)_dCTP:D-G/(k_p/K_d)_dNTP:dN.

^bCalculated as (k_p/K_d)_incorrect/[(k_p/K_d)_correct + (k_p/K_d)_incorrect].

Next, we measured the catalytic efficiency of nucleotide incorporation for the three remaining Watson-Crick base pair combinations under single-turnover conditions and the kinetic data are listed in Table 2. Compared to dCTP:dG, the catalytic efficiency of hRev1 dropped 4,900-, 12,000- and 42,000-fold for dTTP:dA, dATP:dT, and dGTP:dC, respectively. Despite a change in the identity of an incoming dNTP, the template preference remained the same based on the substrate specificity constant as observed with dCTP. The binding affinity remained high for dATP but was ∼14- and 20-fold weaker for dGTP and dTTP. Furthermore, the rate of dCTP incorporation into D-A, D-T, and D-C DNA was up to 820-fold faster than the canonical dNTP, therefore, the strong dCTP preference by hRev1 with templating bases dA, dT, and dC leads to an extremely low fidelity of ∼1 (Table 2). Please note, enzyme fidelity is calculated using the standard kinetic equation, (k_p/K_d)_incorrect/[(k_p/K_d)_correct + (k_p/K_d)_incorrect]. When fidelity approaches a value of 1, this indicates that a misincorporation is favored over the canonical Watson-Crick base pair and that a correct incorporation is not likely to occur. Therefore, to better understand the frequency of a correct incorporation catalyzed by hRev1, the following equation was used: (k_p/K_d)_correct/(k_p/K_d)_dCTP:dN. Here, the frequency of a correct incorporation is calculated to be 1.1 × 10^-2, 1.6 × 10^-2, and 8.6 × 10^-3 for dTTP:dA, dATP:dT, and dGTP:dC, respectively. These values translate into approximately one correct incorporation (dTTP, dATP, or dGTP) per 100 dCTP misincorporations.

Since hRev1 displayed greater catalytic efficiency when dG is the template base, we determined the substrate specificity constant for the incorporation of the other dNTPs into D-G DNA (Table 2). The efficiency to form base pairs dATP:dG, dGTP:dG, and dTTP:dG was 1-, 290-, and 20-fold greater than dATP:dT, dGTP:dC, and dTTP:dA, respectively. Surprisingly, relative to the other template bases, the rate of nucleotide incorporation was up to 860-fold faster when the substrate had dG positioned as the template base. Meanwhile, the K_d value was at least 10-fold higher for non-dCTP addition into D-G DNA. The fidelity of hRev1 inserting dNTPs opposite dG ranged from 10^-3 to 10^-5.

It has been shown that hRev1 may participate in cellular processes that involve gapped DNA (36). Determining the pre-steady state kinetic parameters for dCTP incorporation into a single-nucleotide gapped DNA substrate (D-G Gap) revealed that hRev1 is 7-fold more efficient with the primer-template D-G DNA substrate (Table 2). This modest effect can be attributed to a 2-fold slower rate and a 4-fold weaker binding affinity for dCTP incorporation.

Importance of hydrogen bonding and base stacking

Crystallographic studies have shown that hRev1 utilizes a protein template-directed mechanism to instruct dCTP incorporation through hydrogen bonding between cytosine and residue R357 of hRev1 (Figure 1) (23). To evaluate the roles of hydrogen bonding, base stacking, and base size during DNA synthesis, we have measured the catalytic efficiency of hRev1 incorporating two non-natural nucleotide analogs into D-G DNA (Figure 3A and Table 3). Both dPTP and dNITP lack the ability to form strong hydrogen bonds, possess greater base stacking energy, and are physically larger than dCTP (37). hRev1 can incorporate both analogs, although, the incorporation efficiency drops by 3,500- and 11,000-fold for dNITP and dPTP, respectively. Both analogs are incorporated with significantly reduced rates (at least 490-fold) and modestly weakened binding affinities (at least 7-fold). These data suggested that hydrogen bonding is not essential for catalysis, but it does enhance the rate and binding affinity for dCTP incorporation.

Figure 3. Chemical structures of nucleotide analogs.

(A) non-natural nucleotide analogs and (B) CTP analogs used in this work.

Table 3.

Kinetic parameters for non-natural nucleotide analog incorporation into D-G DNA catalyzed by hRev1 at 37 °C.

dNTP	kp (s-1)	Kd (μM)	kp/Kd (μM-1s-1)	Efficiency Ratioa
dCTP	22.4 ± 0.9	2.2 ± 0.3	10
dATP	0.050 ± 0.004	70 ± 20	7.1 × 10-4	1.4 × 104
dNITP	0.0457 ± 0.0006	15.8 ± 0.6	2.9 × 10-3	3.5 × 103
dPTP	0.0228 ± 0.0008	25 ± 3	9.1 × 10-4	1.1 × 104

^aCalculated as (k_p/K_d)_dCTP/(k_p/K_d)_dNTP.

Kinetic basis of ribonucleotide selection

The concentration of cellular dNTP pools fluctuate during the cell cycle, and the levels are 10- to 200-fold less than the ribonucleotide (rNTP) pools which remain relatively high and constant (38, 39). Since hRev1 has been shown to be present outside of S phase (28), we have evaluated the sugar selectivity of hRev1 by measuring the substrate specificity constant for various CTP analogs (Figure 3B and Table 4). hRev1 discriminates between dCTP and rCTP by 280-fold, and this is mostly due to a 230-fold rate decrease. To better understand how size and orientation affect the degree of sugar selectivity, we have used araCTP (an anti-cancer drug that is a steric isomer of rCTP with the 2′-OH pointed above the ribose ring), 2′-F-CTP (the 2′-F group is smaller than the 2′-OH), GemCTP (an anti-cancer drug with two fluorines at the 2′ position), and 2′-OCH₃-CTP (the 2′-OCH₃ group is larger than the 2′-OH). Orientation and reduced size of the 2′ group are important factors because the efficiency of hRev1 incorporating araCTP and 2′-F-CTP was similar to dCTP. In contrast, the increased volume of the 2′-methoxy group enhanced the magnitude of discrimination to 6,700. Surprisingly, most of the sugar selection was k_p driven for hRev1. The one exception is for GemCTP where the K_d value increased by 13-fold.

Table 4.

Kinetic parameters for CTP analog incorporation into D-G DNA catalyzed by hRev1 at 37 °C.

NTP	kp (s-1)	Kd (μM)	kp/Kd (μM-1s-1)	Sugar Selectivitya
dCTP	22.4 ± 0.9	2.2 ± 0.3	10
rCTP	0.098 ± 0.002	2.7 ± 0.2	3.6 × 10-2	280
araCTP	6.3 ± 0.5	4 ± 1	1.6	6
2′-F-CTP	19.2 ± 0.5	3.5 ± 0.4	5.5	2
GemCTP	6.8 ± 0.4	29 ± 6	2.3 × 10-1	43
2′-OCH3-CTP	0.0122 ± 0.0006	8 ± 1	1.5 × 10-3	6,700

^aCalculated as (k_p/K_d)_dCTP/(k_p/K_d)_analog.

Discussion

Comparison of base substitution fidelity

As a dCTP transferase, Rev1 is a DNA polymerase with extremely low fidelity due to the preference to form dCTP:dN base pairs over canonical Watson-Crick base pairs dTTP:dA, dATP:dT, and dGTP:dC. Using pre-steady state kinetic methods, we have established a base substitution fidelity of 10⁰ to 10^-5 for truncated hRev1 synthesizing undamaged DNA (Table 2). This fidelity range is similar to other human Y-family DNA polymerases (40) and a fidelity range of 10⁰ to 10^-4 that was estimated for full-length hRev1 under semi-steady-state kinetic conditions by Zhang et al. (22). In their studies, Zhang et al. used too much full-length hRev1 (14 fmol) in the reactions with 50 fmol of DNA and various dNTPs at 30 °C (22), possibly due to the lack of quantifiable reaction products during non-dCTP incorporations. Thus, their semi-steady-state kinetic parameters cannot be used to kinetically describe nucleotide incorporation catalyzed by hRev1. In this paper, we employed pre-steady state kinetic methods to investigate the kinetic basis for nucleotide selection and enzyme fidelity for hRev1. Our kinetic data revealed that hRev1 discriminates at both the nucleotide binding (K_d) and incorporation (k_p) steps. Overall, hRev1 prefers dCTP:dG with a 20-fold tighter binding affinity and 14-fold faster rate of incorporation (on average) with undamaged DNA relative to the other tested dNTP:dN base pair combinations (Table 2).

Pre-steady state kinetic analyses have been completed with a truncated form of yeast Rev1 (yRev1, 1-746) (41). In stark contrast, yRev1 selects incoming nucleotides mostly at the nucleotide binding step (K_d). The catalytic efficiency for dCTP:dG is 660-fold greater for the human enzyme, and this effect is governed by a ∼1,900-fold faster rate of dCTP incorporation catalyzed by hRev1 at 37 °C (22.4 s^-1) versus yRev1 at 22 °C (0.012 s^-1), although, hRev1 (2.2 μM) binds dCTP with a 3-fold weaker affinity than yRev1 (0.78 μM) (41). Interestingly, significant kinetic differences have been observed for human and yeast Polη at varying reaction temperatures, too (42). Thus, it is important to exercise caution when extending conclusions about DNA polymerase homologs derived from different organisms (14, 43).

Effect of DNA substrate on the catalytic efficiency of hRev1

Translesion DNA synthesis has been proposed to proceed through a polymerase-switching or gap-filling model (44). Also, Rev1 has been shown to be important during UV-induced post replicative gap-filling processes that likely occur outside of S phase (36, 44). Although the incorporation efficiency dropped by ∼7-fold from non-gapped to gapped DNA, hRev1 is capable of accommodating a single-nucleotide gap DNA substrate despite lacking the signature helix-hairpin-helix (HhH) motif that Polβ and Polλ, two X-family DNA polymerases specialized for gap-filling DNA synthesis, use to bind the downstream strand. Moreover, the gap-filling efficiency of 1.4 μM^-1s^-1 for hRev1 is close or similar to the values measured for rat Polβ (6.6 μM^-1s^-1) and human Polλ (1.8 μM^-1s^-1) (Table 2) (45, 46). More studies are needed to evaluate whether hRev1 plays a role in gap-filling DNA synthesis in vivo.

Kinetic basis for nucleotide selection

Watson-Crick hydrogen bond formation between the template base and incoming dNTP has been shown to play an important role in nucleotide selection by many DNA polymerases including T7 DNA polymerase (47). However, hRev1 does not use this DNA template-dependent mechanism to select incoming dNTPs. Instead, it uses the protein template-directed mechanism while the templating base dG is evicted from the active site by L358 so that it fits into a hydrophobic pocket surrounded by F525, K770, and H774 (Figure 1). To probe whether hydrogen bonds between cytosine and R357 are essential for catalysis by hRev1, we examined if hRev1 could incorporate dNITP and dPTP which are unable to form hydrogen bonds. Although efficiency was reduced dramatically (Table 3), these non-natural nucleotide analogs were incorporated into DNA by hRev1. These results suggested that hydrogen bonds formed between the incoming dNTP and R357 are important, but not absolutely essential for efficient nucleotide incorporation catalyzed by hRev1 and that an oversized nucleobase with strong base stacking energy can be accommodated. To better understand the role of hydrogen bonds, additional studies need to be performed using isosteric, non-hydrogen bonding dCTP analogs.

Previously, Howell et al. (41) proposed possible interactions (i.e. hydrogen bonds and base conformations) for the four dNTP:Arg combinations based on the X-ray crystal structures of yRev1•DNA•dCTP (48) and E. coli MutM DNA glycosylase•DNA (49). Interestingly, the number of hydrogen bonds correlates with the substrate specificity of dNTP incorporation into DNA with dG as the template for both yRev1 and hRev1: dCTP (2 hydrogen bonds) > dGTP (2 hydrogen bonds if dGTP adopts a syn conformation) ≈ dTTP (1 hydrogen bond) > dATP (0 hydrogen bonds) (41, 50). However, the identity of the template base also contributes to catalytic efficiency since dCTP misincorporation is less efficient for hRev1 (Table 2). Thus, optimal catalytic activity (k_p/K_d) of hRev1 depends on both substrates: an incoming dCTP and the template base dG.

Kinetic basis for ribonucleotide exclusion

Most DNA polymerases prevent ribonucleotide incorporation via a steric clash between the 2′-OH group of an incoming rNTP and a protein backbone segment (51) or bulky side chain residue of the enzyme (52-56). This mechanism usually yields sugar selectivity values greater than 1,000-fold (51, 52, 54-57). hRev1 discriminates between dCTP and rCTP by 280-fold, a value that is relatively low compared to other DNA polymerases (Table 4). Like other DNA polymerases, hRev1 possesses a putative steric gate residue F428 but its benzene ring almost parallels and stacks to the ribose ring (Figure 1) (23). Thus, it is unclear how hRev1 discriminates against rNTPs. In general, the kinetic basis for rNTP discrimination by most DNA polymerases is via weakened binding and slowed incorporation of rNTPs. Using CTP analogs, we showed that the mechanism of ribonucleotide selection employed by hRev1 is influenced by both the size and orientation of the 2′ group (Table 5). With varying sizes of the 2′ substituent, the K_d values for 2′-F-CTP, rCTP, araCTP, and 2′-OCH₃-CTP were not affected significantly. This is probably due to the favorable hydrogen bonding interactions between residue R357 of hREV1 and the cytosine base which compensated for the steric effect of the 2′ substituent. However, the binding of GemCTP to hRev1•D-G DNA was perturbed the most with a 13-fold lower affinity than dCTP. The geminal difluoro group of GemCTP has more electronegativity than the deoxyribose of dCTP, and an embedded GemCMP residue in duplex DNA adopts a C3′-endo pucker (58). These may affect how GemCTP was positioned in the active site and how it interacted with R357 and F428 of hRev1, leading to the lower affinity. Interestingly, a similar conclusion has been drawn for the human mitochondrial DNA polymerase γ incorporating GemCTP (59). In comparison, Table 4 shows that the k_p variation is much larger than the K_d range for the CTP analogs. If the ribose 2′ substituent either has a small size (e.g. 2′-F in both 2′-F-CTP and GemCTP) or is orientated above the ribose ring (e.g. 2′-OH in araCTP), it has a small impact on the k_p value. Contrary to these trends, the k_p values for rCTP and 2′-OCH₃-CTP are 200- to 2,000-fold lower than that of dCTP. Together, these results suggested that, inconsistent with the general kinetic trends observed with other DNA polymerases (see above), the steric clash of the 2′-OH of the incoming rCTP with F428 of hRev1 mostly impacts the incorporation step (k_p) rather than the ground-state binding step (K_d). In addition to the major contribution of the templating base dG to the high dCTP incorporation efficiency (see above discussion), our kinetic data further dissect the contribution of each chemical moiety toward the high efficiency of dCTP incorporation catalyzed by hRev1: the ribose 2′-H of dCTP significantly contributes to the fast k_p while the cytosine of dCTP contributes to the low K_d for dCTP binding. We are currently elucidating the kinetic mechanism of dCTP incorporation in order to mechanistically understand how these chemical moieties of dCTP influence its k_p and K_d.

Abbreviations

2′-F-CTP

2′-fluoro-2′-deoxycytidine-5′-triphosphate

2′-OCH₃-CTP

2′-O-methylcytidine-5′-triphosphate

araCTP

2′-aracytidine-5′-triphosphate

BSA

bovine serum albumin

dNITP

5-nitroindole 5′-triphosphate

dNTP

2′-deoxyribonucleotide 5′-triphosphate

dPTP

pyrene 5′-triphosphate

DTT

dithiothreitol

EDTA

ethylenediaminetetraacetic acid

GemCTP

2′-deoxy-2′,2′-difluorocytidine-5′-triphosphate

HhH

helix-hairpin-helix

hRev1

human Rev1

PCNA

proliferating cell nuclear antigen

Pol

DNA polymerase

Polη

DNA polymerase eta

Polι

DNA polymerase iota

Polκ

DNA polymerase kappa

rNTP

ribonucleotide-5′-triphosphate

yRev1

yeast Rev1