Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2010 Aug 2;78(11):4839–4849. doi: 10.1128/IAI.00248-10

Limited Role of Secreted Aspartyl Proteinases Sap1 to Sap6 in Candida albicans Virulence and Host Immune Response in Murine Hematogenously Disseminated Candidiasis▿

Alexandra Correia 1, Ulrich Lermann 2, Luzia Teixeira 3,4, Filipe Cerca 4,5, Sofia Botelho 4, Rui M Gil da Costa 4, Paula Sampaio 1, Fátima Gärtner 4, Joachim Morschhäuser 2, Manuel Vilanova 4,5, Célia Pais 1,*
PMCID: PMC2976357  PMID: 20679440

Abstract

Candida albicans secreted aspartyl proteinases (Saps) are considered virulence-associated factors. Several members of the Sap family were claimed to play a significant role in the progression of candidiasis established by the hematogenous route. This assumption was based on the observed attenuated virulence of sap-null mutant strains. However, the exclusive contribution of SAP genes to their attenuated phenotype was not unequivocally confirmed, as the Ura status of these mutant strains could also have contributed to the attenuation. In this study, we have reassessed the importance of SAP1 to SAP6 in a murine model of hematogenously disseminated candidiasis using sap-null mutant strains not affected in their URA3 gene expression and compared their virulence phenotypes with those of Ura-blaster sap mutants. The median survival time of BALB/c mice intravenously infected with a mutant strain lacking SAP1 to SAP3 was equivalent to that of mice infected with wild-type strain SC5314, while those infected with mutant strains lacking SAP5 showed slightly extended survival times. Nevertheless, no differences could be observed between the wild type and a Δsap456 mutant in their abilities to invade mouse kidneys. Likewise, a deficiency in SAP4 to SAP6 had no noticeable impact on the immune response elicited in the spleens and kidneys of C. albicans-infected mice. These results contrast with the behavior of equivalent Ura-blaster mutants, which presented a significant reduction in virulence. Our results suggest that Sap1 to Sap6 do not play a significant role in C. albicans virulence in a murine model of hematogenously disseminated candidiasis and that, in this model, Sap1 to Sap3 are not necessary for successful C. albicans infection.


The polymorphic yeast Candida albicans is an important opportunistic human pathogen causing infections that range from superficial mucosal lesions to life-threatening systemic disease. It is by far the most common cause of fungal invasive infections, which could be attributed to the little immunosuppression required to predispose an individual to invasive Candida infections (39). Host physical barriers and immune system integrity are crucial factors in controlling the establishment of infection. However, the high adaptability of C. albicans to different host niches, by the expression of appropriate sets of virulence-related genes, is also a determinant (19, 51). Several of these virulence attributes may participate in and influence the infective process, depending on the site and stage of invasion and on the nature of the host response (37). The secretion of hydrolytic enzymes during infection is required as a virulence attribute to aid adhesion, invasion, and the destruction of host immune factors, in addition to nutrient acquisition (21). Among these enzymes, secreted aspartyl proteinases (Sap), encoded by a 10-member gene family (SAP1 to SAP10) have been the most extensively studied (35). The 10 SAP genes that compose this family can be divided into subfamilies based on amino acid sequence homology alignments (SAP1 to SAP3, SAP4 to SAP6, SAP9, and SAP10). These genes exhibit differential expression profiles at different stages and sites of infection (33, 35, 46, 49) and have been linked with the virulence of the fungus since their discovery (10, 27, 48).

The contribution of the SAP1 to SAP3, SAP4 to SAP6, SAP7, and SAP9 and SAP10 genes to virulence in different models of infection has been studied by using sap-null mutant strains (1, 13, 16, 20, 23, 25, 26, 29, 34, 43, 54). The subfamily consisting of the SAP4 to SAP6 genes, in particular, was shown to contribute significantly to C. albicans virulence in models of acute systemic candidiasis, murine peritonitis, and Candida gastrointestinal infection (16, 25, 43). These genes are expressed mainly during hypha formation (22, 34), and SAP5 in particular was found to be upregulated at all time points after either intravenous (i.v.) or intraperitoneal (i.p.) infection of mice (44, 50, 57).

Hube et al. (20) previously reported that Δsap1, Δsap2, and Δsap3 null mutants displayed attenuated virulence in models of acute systemic candidiasis. The triple deletion of SAP4 to SAP6 resulted in a more marked impact on C. albicans virulence in similar experimental settings, suggesting an important role for these hypha-related genes in the establishment of disseminated candidiasis (43). These mutant strains were generated from auxotrophic laboratory strain CAI4 with the most common method used for disrupting genes in C. albicans, the Ura-blaster technique (17). The use of the URA3 marker for mutant construction in C. albicans can lead to a misinterpretation of the results in mutant virulence studies (5, 8, 11, 28). Although this can now be overcome by the integration of URA3 at the ENO1 (52) or RPS10 (8) locus, the mutant strains used in earlier studies did not share a site of URA3 integration. Therefore, it is conceivable that the Ura status could have influenced the results, and thus, the attenuated nature of these mutants during acute systemic candidiasis remains to be confirmed unequivocally (38). Therefore, in this study, we have used a set of Δsap null mutants constructed, as described previously by Lermann and Morschhäuser (29), from prototrophic wild-type (WT) strain SC5314 using the SAT1-flipping strategy (41) to readdress the importance of the SAP1 to SAP6 genes in a murine model of hematogenously disseminated candidiasis. In addition, we analyzed the histopathology of several organs and aspects of the immune response elicited in the spleens and kidneys of BALB/c mice infected with the wild-type strain and a sap-null mutant lacking SAP4 to SAP6.

MATERIALS AND METHODS

Mice.

Male BALB/c mice, 8 to 10 weeks old, were purchased from Charles River (Barcelona, Spain) and kept under specific-pathogen-free conditions at the Animal Facility of the Instituto de Ciências Biomédicas Abel Salazar, Porto, Portugal. All procedures involving mice were performed according to the European Convention for the Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes (ETS 123), the 86/609/EEC directive, and Portuguese rules (DL 129/92).

Candida albicans and culture conditions.

The C. albicans strains used in this study are listed in Table 1. All strains were maintained as frozen stocks in 30% glycerol at −80°C. Yeast growth was tested in synthetic glucose minimal (2% glucose, 0.67% Bacto yeast nitrogen base without amino acids) and complex yeast-peptone-dextrose (YPD) (2% glucose, 1% yeast extract, 2% Bacto peptone) liquid media at 30°C and 37°C in a shaking incubator for 24 h. Growth was measured at 60-min intervals, and the generation times were calculated. Hypha formation was induced by the addition of calf serum (10%) (Invitrogen, Carlsbad, CA) or N-acetylglucosamine (2.5 mM) (Sigma, St. Louis, MO) at 37°C. To prepare the inocula for infection, C. albicans strains were grown in a shaking incubator for 14 h at 30°C in Winge medium (0.2% glucose, 0.3% yeast extract). Yeast cells were harvested, washed twice with sterile, nonpyrogenic phosphate-buffered saline (PBS), counted in a hemocytometer, and resuspended at the appropriate concentrations. Inocula were confirmed by CFU counts on Sabouraud dextrose agar (Difco, Detroit, MI) for up to 48 h at 37°C.

TABLE 1.

Candida albicans strains used in this study

Strain(s) Genotype Reference
SC5314 Prototrophic wild-type strain 18
SAP123MS4C and SAP123MS4D sap1Δ::FRT/sap1Δ::FRT 29
sap2Δ::FRT/sap2Δ::FRT
sap3Δ::FRT/sap3Δ::FRT
SAP456MS4A and SAP456MS4B sap4Δ::FRT/sap4Δ::FRT 29
sap5Δ::FRT/sap5Δ::FRT
sap6Δ::FRT/sap6Δ::FRT
SAP4MS4A sap4Δ::FRT/sap4Δ::FRT 29
SAP5MS4A sap5Δ::FRT/sap5Δ::FRT 29
SAP6MS4A sap6Δ::FRT/sap6Δ::FRT 29
CAF2-1 URA3/ura3Δ::imm434 17
M119 sap1Δ::hisG/sap1Δ::hisG 25
sap2Δ::hisG/sap2Δ::hisG
sap3Δ::hisG/sap3Δ::hisG::URA3::hisG
DSY459 sap6Δ::hisG/sap6Δ::hisG 43
sap4Δ::hisG/sap4Δ::hisG
sap5Δ::hisG/sap5Δ::hisG::URA3::hisG

C. albicans hematogenously disseminated infections.

Mice were injected intravenously (i.v.) in the lateral tail vein with 1 × 105 or 5 × 105 C. albicans yeast cells in 0.2 ml PBS. To evaluate the progress of hematogenously disseminated candidiasis, mice were weighed and monitored twice daily. Moribund mice were humanely terminated, and their deaths were recorded as occurring on the following day.

Other groups of mice were infected with 5 × 104 yeast cells and sacrificed 3 and 7 days postinfection to determine organ fungal burden and/or immunological parameters. Control mice were injected i.v. with PBS. Kidneys were aseptically removed, weighed, homogenized, and quantitatively cultured on Sabouraud dextrose agar (Difco) at 37°C. Values are expressed as log CFU per gram of tissue. Alternatively, kidneys, liver, lungs, and brain were fixed in 10% phosphate-buffered formaldehyde, followed by periodic acid-Schiff (PAS) reagent staining and counterstaining of the paraffin-embedded tissues with hematoxylin in order to evaluate both fungal morphology and the composition and distribution of inflammatory infiltrates.

Quantitative real-time PCR (qRT-PCR).

BALB/c mice were i.v. infected with 1 × 105 C. albicans SC5314, SAP123MS4C, and SAP456MS4A yeast cells. Total RNA was isolated from the kidneys of three mice per group 3 and 7 days after infection. Briefly, the kidneys were removed, homogenized in PBS, and centrifuged at 1,500 × g at 4°C for 10 min. Pellets were washed twice with ice-cold RNase-free water and frozen in liquid nitrogen until RNA extraction, which was performed by using the hot acidic phenol method (4). Total RNA was incubated with DNase I, amplification grade (Invitrogen), for 15 min at room temperature to eliminate genomic DNA contamination. DNase I was inactivated according to the manufacturer's instructions.

The Superscript III Platinum two-step qRT-PCR kit with SYBR green (Invitrogen) was used to generate first-strand cDNA from each DNase I-treated RNA sample, as follows: 10 min at 65°C, 60 min at 37°C, and 10 min at 65°C. Quantitative PCR (qPCR) was performed with Platinum SYBR green qPCR SuperMix-UDG (Invitrogen). Three microliters of each cDNA sample was added to a 25-μl PCR mixture containing 12.5 μl of Platinum SYBR green qPCR SuperMix-UDG, 0.5 μl of 10 μM specific forward and reverse primers (Table 2), and 8.5 μl of RNase-free water. Each reaction was performed with a Corbett Rotor-Gene 6000 instrument (Qiagen). Thermocycling conditions for SAP and ACT1 quantification were 2 min at 50°C (UDG incubation) and 5 min at 95°C, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. The specificity of each primer pair was verified by the presence of a single melting-temperature peak. The calibration and efficiency of SAP and ACT1 primers were assessed in titration experiments using C. albicans SC5314 genomic DNA (500 ng to 5 pg) in serial dilutions. A negative (water) control and a four-point curve of SC5314 genomic DNA were included in each run. DNase I-treated RNA was used to exclude genomic DNA contamination. SAP1 to SAP10 gene expression was normalized to the housekeeping gene ACT1 and analyzed by using both the standard curve and the comparative threshold cycle (CT) (ΔΔCT) methods. Data are presented as the fold difference in expression relative to wild-type (WT) gene expression from infected mice. Each experimental condition was performed in triplicate, and reactions were done in duplicate on different days for reproducibility purposes.

TABLE 2.

SAP and ACT1 primers and expected fragment lengths

Gene Primer (5′-3′)
Amplicon length (bp)
Forward Reverse
ACT1 TGCTGAACGTATGCAAAAGG TGAACAATGGATGGACCAGA 186
SAP1 TGAGGCTGCTGGTGATTATG TGCCAACAGCTTTGAGAGAA 224
SAP2 ATCAGCTGGTTTCGTTGCTT GGGACAGCTTGTCTTTTGGA 105
SAP3 TGTTACTGGTCCCCAAGGTGAA CTTGTCCTTGACCAGCTTGACAT 209
SAP4 AATGATGTGGGCAAAAGAGG ACGGCATTTGAATCTGGAAC 155
SAP5 ATTTCCCGTCGATGAGACTG ACCACGCCATTTTGGAATAC 205
SAP6 GTCAACGCTGGTGTCCTCTT GCAGGAACGGAGATCTTGAG 197
SAP7 TTCTCGTGATGCTGTCCAAG CCAGCAGGAAGACCATAAGC 183
SAP8 TTTGGTGGGGTTGATAATGC GGCAGCAGCCAATTTATCAG 198
SAP9 ACCGGGTCTTCAGATTTGTG TTCCTCGTCGGTTTCTATGG 180
SAP10 AACGGAAATGTTGCTTCTGG TGAATCGCCTATCGAAAACC 192

Flow cytometric analysis.

The assessment of cell surface and cytoplasmic lineage or activation markers on different splenic leukocyte populations was performed by flow cytometric analysis (fluorescence-activated cell sorter [FACS] analysis). Spleens were aseptically removed and homogenized to single-cell suspensions in Hanks’ balanced salt solution (HBSS) (Sigma). A total number of 1 × 106 leukocytes were stained per sample.

The following monoclonal antibodies (MAbs), along with the respective isotype controls, were used (at previously determined optimal dilutions) for immunofluorescence cytometric analysis with a FACScan apparatus (Becton Dickinson, San Jose, CA) using CELLQUEST software (Becton Dickinson): phycoerythrin (PE) anti-mouse CD40 (1C10) and biotin anti-mouse major histocompatibility complex (MHC) class II (NIMR-4) (Southern Biotechnology Associates, Birmingham, AL); fluorescein isothiocyanate (FITC) anti-mouse/rat Foxp3 (FJK-16S), PE-Cy5 anti-mouse CD4 (L3T4) (RM4-5), and PE anti-mouse F4/80 antigen (BM8) (eBioscience, San Diego, CA); and FITC anti-mouse CD11c (HL3), FITC anti-mouse Ly-6G and Ly-6C (Gr-1) (RB6-8C5), PE anti-mouse CD25 (PC61), FITC anti-mouse CD45R/B220 (RA3-6B2), PE anti-mouse CD80 (B7-1) (16-10A1), PE anti-mouse CD86 (B7-2) (GL1), PE rat anti-mouse interleukin-4 (IL-4) (BVD4-1D11), FITC anti-mouse gamma interferon (IFN-γ) (XMG1.2), and PE anti-mouse IL-10 (JES5-2A5) (BD Pharmingen, San Diego, CA). Biotin-conjugated MAbs were revealed with streptavidin-PE-Cy5 (BD Pharmingen). Cells were preincubated for 15 min with anti-FcγR (a kind gift of Jocelyne Demengeot, Gulbenkian Institute of Science, Oeiras, Portugal) before CD11c and Foxp3 staining. The Foxp3 Staining Buffer set (eBioscience) was used for the fixation and permeabilization of splenocytes previously surface stained with CD4 and CD25 MAbs.

The intracellular expression of the cytokines IFN-γ, IL-4, and IL-10 was detected in splenic CD4+ T lymphocytes. The intracellular expression of the cytokines IFN-γ and IL-4 was also detected in renal CD4+ T lymphocytes. Splenocytes were obtained as described above. Red blood cell lysis was performed by incubation with 0.15 M ammonium chloride. Cells were washed and resuspended in complete RPMI medium (Sigma) (RPMI 1640 medium supplemented with 50 U of penicillin/ml, 50 μg of streptomycin/ml, 1% HEPES buffer [Sigma], 10% fetal calf serum [FCS] [Invitrogen], and 5 μM 2-mercaptoethanol). The kidneys were minced with a razor blade and incubated for 30 min at 37°C in RPMI 1640 complete medium containing collagenase D (Sigma-Aldrich) at 2 μg/ml. Cells were homogenized to single-cell suspensions, washed, and resuspended in RPMI 1640 complete medium. Mononuclear cells were separated from the above-described suspensions by layering 5 ml onto 2.5 ml of a polysucrose-sodium ditrizoate solution (Histopaque 1083; Sigma) and centrifuged at 800 × g for 20 min at room temperature. Mononuclear cells collected from the medium-Histopaque interface were washed and resuspended in RPMI 1640 complete medium. Spleen and renal cells (1 × 106 cells) were transferred into 96-well tissue culture plates (Nunc, Roskilde, Denmark) and stimulated for 4.5 h with 20 ng/ml phorbol myristate acetate (Sigma) and 200 ng/ml ionomycin (Sigma) in the presence of 10 μg/ml of brefeldin A (Roche, Penzberg, Germany).

The staining of the cell surface marker CD4 was performed as described above, after a preincubation step of 15 min with anti-FcγR, followed by fixation with 2% formaldehyde. Cells were permeabilized with 0.5% saponin in flow cytometric buffer (PBS containing 1% bovine serum albumin [BSA] and 10 mM sodium azide), and subsequently, cells were incubated for 15 min with anti-FcγR and stained for 30 min at room temperature with the appropriate antibody. Intracellular staining with the isotypic controls was performed to confirm the specificity of antibody binding.

Th1 cells were defined as being CD4+ IFN-γ+ IL-4−, and Th2 cells were defined as being CD4+IFN-γ− IL-4+. Ratios of Th1/Th2 cells were generated to determine the presence of a polarized immune response. The immune response in noninfected mice was defined as being unpolarized.

Serum IFN-γ, IL-4, and IL-10 measurements.

The concentration of IL-4 in the sera of C. albicans-infected mice and noninfected controls was quantified with the Quantikine M murine IL-4 enzyme-linked immunosorbent assay (ELISA) kit, and serum IFN-γ and IL-10 concentrations were quantified with Duo-Set ELISA kits (all from R&D Systems, Minneapolis, MN) according to the manufacturer's instructions.

Statistical analysis.

Unless otherwise stated, results shown are from one experiment representative of three independent experiments. The statistical significance of results was determined by the unpaired Student t test, and survival data were analyzed with the log-rank test by using GraphPad Prism 4 software (GraphPad Software, Inc., La Jolla, CA). Results were considered statistically significant with P values of less than 0.05.

RESULTS

Virulence of C. albicans in a murine model of hematogenously disseminated infection.

Prior to the virulence studies, we determined the generation time for each strain in synthetic defined and complex media at 30° and 37°C and the ability to form hyphae in serum- or N-acetylglucosamine-containing media. No yeast growth defects were observed under the conditions tested (similar generation times), and filamentous growth was similar to that of wild-type (WT) strain SC5314 under the hypha-inducing conditions analyzed (data not shown).

To explore the role of the aspartyl proteinases Sap1 to Sap6 as virulence factors in the course of hematogenously disseminated candidiasis, BALB/c mice were initially infected i.v. with 5 × 105 and 1 × 105 cells of C. albicans WT strain SC5314 and two independent series of homozygous-deletion triple-mutant strains lacking the SAP1 to SAP3 genes (SAP123MS4C and SAP123MS4D) or lacking the SAP4 to SAP6 genes (SAP456MS4A and SAP456MS4B) (29). The independent mutant strains behaved indistinctively (data not shown), and therefore, the results presented below correspond to those obtained with strains SAP123MS4C and SAP456MS4A.

Mice infected with the highest inoculum showed 100% mortality for every group by day 6 after infection, and no differences could be observed (data not shown).

No differences in survival time were observed after i.v. infection of BALB/c mice with 1 × 105 CFU of the WT or Δsap123 mutant strain SAP123MS4C (P = 0.5698 by log-rank test) (Fig. 1A). Mice infected with Δsap456 mutant strain SAP456MS4A had an extended overall survival time compared to that of their WT-infected counterparts (Fig. 1). The median survival times of SAP456MS4A-infected mice were 13 and 16 versus 10 and 12 days for WT-infected mice, as determined for the independent experiments shown in Fig. 1A and B, respectively. All mice injected with either the WT or the triple-mutant strain SAP123MS4C succumbed to candidal infection within 17 days. In contrast, at the end of the experimental period (30 days), 15 to 20% of the mice infected with the Δsap456 mutant survived infection. Nevertheless, the kidneys of the surviving mice had Candida microabscesses and granulomas revealed by histopathological analysis (data not shown). Despite these differences, statistical comparisons of the survival curves revealed that the survival of mice infected with the WT strain did not differ significantly from that of mice infected with the Δsap456 mutant (P = 0.1405 and P = 0.1331) (Fig. 1A and B, respectively).

FIG. 1.

FIG. 1.

Influence of SAP1 to SAP6 on C. albicans virulence in a murine model of hematogenously disseminated candidiasis. Male BALB/c mice were i.v. injected with 1 × 105 cells of C. albicans WT strain SC5314 and mutant strains SAP123MS4C and SAP456MS4A (A); C. albicans WT strain SC5314 and mutant strains SAP4MS4A, SAP5MS4A, SAP6MS4A, and SAP456MS4A (B); and C. albicans WT strains SC5314 and CAF2-1 and mutant strains SAP123MS4C, M119, SAP456MS4A, and DSY459 (C). Each strain was injected into seven mice per group, per experiment, and survival was monitored twice daily for 30 days (A and B) or for 60 days (C). Results are representative of two to three independent experiments.

To ascertain the contribution of each of the deleted genes of the triple Δsap456 mutant to the slightly extended survival time observed, Δsap4, Δsap5, and Δsap6 single-mutant strains were used. As shown in Fig. 1B, the survival time of mice infected with strains SAP4MS4A, SAP5MS4A, and SAP6MS4A was statistically equivalent to that of their WT-infected counterparts (P = 0.6265, P = 0.2121, and P = 0.9465, respectively). The observed median survival time was, however, consistently longer for mice infected with mutants lacking SAP5, such as with strains SAP5MS4A and SAP456MS4A. The survival curves of mice injected with these two strains were similar (P = 0.8621).

These results are in apparent contrast with previous studies, with a similar model of murine hematogenously disseminated candidiasis, using single-mutant strains deficient in SAP1, SAP2, or SAP3 (20) and a triple mutant lacking the SAP4 to SAP6 genes (43), constructed with the Ura-blaster technique (17). In those studies, mutant strains deficient in each of the SAP1 to SAP3 genes and Δsap456 triple-mutant strain DSY459 were reported to survive longer than WT-infected mice, and the latter mutant was reported to have significantly decreased mean CFU in the kidneys (43). Therefore, parallel experiments with the SAT1-flipping mutants and Ura-blaster triple-mutant Δsap123 strain M119 (23) and Δsap456 strain DSY459 (43) were performed by using the same batch of BALB/c mice and the same experimental conditions. Strain CAF2-1 (17) was also included. As shown in Fig. 1C, significant differences in survival times were observed between mice infected with Δsap123 strain M119 and Δsap456 strain DSY459 and control strain CAF2-1 (P = 0.0089 and P = 0.0065, respectively). Mice infected with the Ura-blaster mutants survived significantly longer than mice infected with the equivalent SAT1-flipping mutants. The median survival times of mice infected with mutants lacking SAP1 to SAP3 were 21 days for the Ura-blaster-constructed Δsap123 mutant strain M119 and 10 days for Δsap123 mutant strain SAP123MS4C (P = 0.0127). Similar results were found when comparing the triple mutants lacking the SAP4 to SAP6 genes. The median survival times were 51 days for mice infected with the Ura-blaster mutant and 13 days for mice infected with the SAT1-flipping mutant (P = 0.0096). The survivals of mice infected with WT strain SC5314 and with URA3 heterozygous strain CAF2-1 were similar (P = 0.7005).

The evaluation of the fungal ability to invade the kidneys has been frequently used to measure the virulence of C. albicans strains (30, 38). The numbers of C. albicans CFU in the kidneys of mice infected with either the SAT1-flipping or the Ura-blaster mutants as well as with the respective control strains were similar, except for mice infected with Δsap456 strain DSY459 (Fig. 2). Seven days after infection, CFU numbers were significantly reduced in mice infected with the latter mutant (P = 0.0149 for CAF2-1 versus Δsap456 strain DSY459).

FIG. 2.

FIG. 2.

Kidney fungal burden of BALB/c mice 3 and 7 days after i.v. infection with 5 × 104 CAF2-1 (⧫), M119 (▴), DSY459 (○), SC5314 (□), SAP123MS4C (▵), and SAP456MS4A (•) C. albicans cells. Data are representative of two independent experiments. Each symbol represents an individual mouse, and horizontal bars are means of CFU numbers for each group.

The two sets of mutants tested behaved distinctly in the same experimental model, suggesting that the observed differences could be due to the effect of the ectopic URA3 insertion and not caused by the disruption of SAP genes. However, the limited impact of the SAP gene deletion in C. albicans virulence could be due to a compensatory expression of the nondeleted SAP genes, as reported previously for Ura-blaster mutants (34, 45). The expression of SAP1 to SAP10 in SC5314 and in SAT1-flipping triple mutants was evaluated by qRT-PCR in kidney samples 3 and 7 days after infection. Only the results for the latter time point analyzed are presented, since after 3 days, the fungal burden was often insufficient to obtain reproducible results. The expression levels were always inferior or similar to the level of ACT1 expression in the WT strain, except for SAP7.

No significant differences in SAP1 to SAP10 expression were observed for either mutant compared with SC5314. However, mRNA levels of SAP4 were higher in the Δsap123 mutant, and the levels of expression of SAP1, SAP2, and SAP3 trended higher in the Δsap456 mutant (Fig. 3). Thus, the virulence phenotypes observed do not seem to be due to significant compensatory upregulation.

FIG. 3.

FIG. 3.

Compensatory upregulation of SAP1 to SAP10 in sap triple-mutant strains SAP123MS4C and SAP456MS4A from kidney homogenates 7 days after i.v. infection with 1 × 105 cells. Results are presented as fold differences in expression relative to that of WT SC5314 from infected mice.

Although not significant, a reduction in virulence was consistently seen for the Δsap456 mutant. Therefore, the impact of a deficiency of SAP4 to SAP6 on C. albicans virulence was further evaluated.

The abilities of WT and Δsap456 triple-mutant strains to infect and injure several organs were assessed by histopathological analysis of the kidneys, liver, lungs, and brain 3 and 7 days after infection. As shown in Fig. 4, similar C. albicans cell morphologies and invasive abilities of the WT and mutant strains were observed. The kidneys of both mouse groups showed moderate multifocal renal medullary interstitial neutrophilic infiltration, with small areas of ductular necrosis. Intralesional PAS-positive organisms both in yeast and with septated, branched hyphal morphology were detected 3 days after C. albicans i.v. infection with strains SC5314 (Fig. 4A) and SAP456MS4A (Fig. 4B). At the later time point tested, 7 days after infection, analysis of the kidneys of WT-infected (Fig. 4C) and mutant-infected (Fig. 4D) mice showed moderate to severe, focally extensive to coalescing, renal medullary interstitial neutrophilic infiltration surrounding numerous PAS-positive organisms. These organisms were present mainly as septated, branched hyphal structures, which largely effaced the medulla and invaded the urothelium. Invasion of liver, lungs, and brain was not consistently seen (data not shown). Altogether, these results suggest that the SAP4 to SAP6 genes are not essential for the invasion of the kidneys during hematogenously disseminated candidiasis.

FIG. 4.

FIG. 4.

Representative photomicrographs of histological sections of kidneys from BALB/c mice infected with 5 × 104 SC5314 (A and C) and SAP456MS4A (B and D) C. albicans cells. At 3 days post-i.v. infection, PAS-positive hyphae and yeast-like organisms were present in the renal medulla, partially effacing the renal tubuli and eliciting moderate neutrophilic infiltration in both WT-infected (A) and mutant-infected (B) mice. At 7 days post-i.v. infection, numerous PAS-positive hyphae and yeast-like organisms were present in the renal medulla, extensively effacing the renal tubuli, eliciting intense neutrophilic infiltration, and invading the urothelium (arrows), with no clear differences between the WT (C) and mutant (D) strains. P, renal pelvis. Bar, 100 μm.

Host immune response to hematogenously disseminated candidiasis.

To determine the effect of the disruption of SAP4 to SAP6 on the immune response elicited by C. albicans systemic infection, BALB/c mice were infected i.v. with 5 × 104 C. albicans yeast cells of the WT and Δsap456 mutant strains. At days 3 and 7 upon infection, absolute numbers and phenotypes of different splenic leukocyte populations were determined by flow cytometric analysis. Macrophages and neutrophils represent the first line of host immune defense when C. albicans cells infect the bloodstream or the endothelia (47, 58). Macrophages typically express the F4/80 cell surface marker, whereas neutrophils have a Gr-1high surface phenotype. Murine splenic cells expressing both antigens with either inflammatory or immunosuppressive function have also been described in the context of C. albicans infections (31, 56). According to the expression of these two surface markers, three cell populations were analyzed in this study: F4/80high Gr-1neg, F4/80high Gr-1high, and F4/80neg/low Gr-1high. These cell populations were designated macrophages, inflammatory monocytes, and neutrophils, respectively (55). An extensive recruitment of neutrophils and inflammatory monocytes into the spleen could be observed for infected mice compared to noninfected controls at 3 and, more markedly, 7 days after infection. Higher numbers of spleen macrophages were also detected in the infected mice at 7 days after infection. The total numbers of these myeloid cell populations in WT-infected mice were equivalent to the ones in mice infected with the Δsap456 triple mutant (Fig. 5A).

FIG. 5.

FIG. 5.

(A) Scatter plots of the total numbers of neutrophils (F4/80neg/low Gr-1high), inflammatory monocytes (F4/80high Gr-1high), macrophages (F4/80high Gr-1neg), cDC (CD11chigh), B cells (B220+), Treg cells (CD4+ CD25+ Foxp3+), and Teffector cells (CD4+ CD25+ Foxp3−), as indicated, observed 3 and 7 days after infection in the spleens of noninfected control mice (open triangles) and mice challenged i.v. with 5 × 104 WT (open squares) and SAP456MS4A (filled circles) C. albicans cells. Data are representative of three independent experiments. Each symbol represents an individual mouse, and horizontal bars are means of cell numbers for each group (n = 3 for control and n = 4 to 5 for infected mouse groups). Statistically significant differences between controls and C. albicans-infected mice are indicated: *, P < 0.05; **, P < 0.01; ***, P < 0.001. (B) Relative proportions of splenic Teffector (black bars) and Treg (white bars) cells in the spleens of noninfected controls (PBS) and SC5314 or SAP456MS4A i.v. infected mice 3 and 7 days after challenge.

Dendritic cells were previously shown to play a major role in the induction of the cell-mediated immune response to C. albicans infection (9, 14) and to directly influence the infection outcome (6). Therefore, the numbers and surface maturation markers of splenic conventional dendritic cells (cDC), defined as CD11chigh cells, were assessed upon C. albicans infection. High numbers of splenic cDC, compared to noninfected controls, were observed at the earlier time point analyzed. The cDC surface expression of the costimulatory molecules CD40 and CD80 remained practically unchanged after C. albicans i.v. infection, as evaluated by flow cytometry and recorded as the mean fluorescence intensities (MFIs). In contrast, the costimulatory molecule CD86 was upregulated on the surface of splenic cDC from C. albicans-infected mice 3 and 7 days after infection. The cDC surface expression of MHC class II molecules was slightly downregulated in infected mice 3 days after infection and upregulated at day 7 postinfection compared to that of noninfected controls. No significant differences of cDC numbers (Fig. 5A) and surface expression of any of the assessed costimulatory and antigen-presenting molecules were detected between WT- and SAP456MS4A-infected mice at the two tested time points (Fig. 6).

FIG. 6.

FIG. 6.

Expression of CD40, CD80, CD86, and MHC class II molecules on the surface of spleen conventional dendritic cells (cDC) and B cells of BALB/c mice 3 and 7 days after i.v. injection with PBS (controls, gray histograms) or i.v. infection with 5 × 104 SC5314 (solid lines) and SAP456MS4A (dashed lines) C. albicans yeast cells. Staining with the respective isotypic controls was omitted for simplicity. Numbers below histograms represent means ± 1 standard deviation of the mean fluorescence intensities of antibody stainings for noninfected controls (top) and SC5314-infected (middle) or SAP456MS4A-infected (bottom) mice (n = 3 for control and n = 5 for infected mouse groups). Statistically significant differences between controls and C. albicans-infected mice are indicated (*, P < 0.05; **, P < 0.01). Results shown are from one experiment representative of three independent experiments.

B cells have been shown to mediate host resistance to i.v. established C. albicans systemic infection (61). B-cell numbers were significantly increased 7 days after infection in either WT- or SAP456MS4A-challenged mice (Fig. 5A). As observed for splenic cDC, an upregulation of the costimulatory molecule CD86 was observed 3 and 7 days postinfection on the surface of B cells of the infected mice compared to noninfected controls. The expression of CD80 and MHC class II molecules on the surface of B cells was observed to be upregulated only at day 7 after challenge. Challenge with the mutant deficient in SAP4 to SAP6 did not result in any differences compared to the WT strain, regarding either B-cell numbers or costimulatory molecule expression levels (Fig. 5A and 6).

Although CD4+ T cells have been reported to have little influence on survival and on fungal burden during acute systemic candidiasis (3, 24), the CD4+ T-cell subset of naturally occurring regulatory T (Treg) cells was shown to promote host susceptibility to C. albicans (36, 53) and to limit tissue damage and/or enhance healing but not to directly augment the clearance of the organism from infected tissues (32). To ascertain the impact of a deficiency of SAP4 to SAP6 on the immune response mediated by CD4+ T-lymphocyte cell populations, the numbers of CD4+, CD4+ CD25+, and CD4+ CD25+ Foxp3+ (Treg) cells and also of CD4+ CD25+ Foxp3− (Teffector) cells in the spleens of the infected BALB/c mice were assessed. The numbers of splenic CD4+ and CD4+ CD25+ T cells of infected mice were not significantly different from those of noninfected controls (data not shown). However, as assessed by Foxp3 expression within the CD4+ CD25+ T-cell population, reduced percentages and numbers of Treg cells were observed 7 days after C. albicans infection. This correlated with higher splenic percentages and numbers of Teffector cells in these mice (Fig. 5A), resulting in higher Teffector/Treg ratios than those for noninfected controls (Fig. 5B). The percentages and numbers of both Teffector and Treg cells were not significantly different between the two C. albicans-infected groups.

To better elucidate the effector function of the CD4+ T cells from WT- and SAP456MS4A-infected mice, the proportion of splenic CD4+ T cells producing IFN-γ, IL-4, and IL-10 was determined by intracytoplasmic cytokine staining analysis. An increased frequency of CD4+ T cells expressing IFN-γ or IL-4 was observed for C. albicans-infected mice compared to the noninfected controls. Although the frequency of cells producing either cytokine increased upon infection in the spleens of C. albicans-challenged mice, a bias toward a Th1-type response was observed (high IFN-γ/IL-4 ratio). The frequency of CD4+ T cells expressing IL-10 was also increased in the spleens of infected mice (Fig. 7). The intracellular expression of IFN-γ and IL-4 was also evaluated in kidney CD4+ T cells, as it is associated with the outcome of infection (48). As observed for the spleen, the frequency of CD4+ T cells expressing the cytokines IFN-γ and IL-4 increased in infected mice. Although a trend toward extended survival was observed for mice infected with mutant strain SAP456MS4A, the percentages of CD4+ T cells producing the cytokine IFN-γ or IL-4 in the kidneys of either group of infected mice were similar, resulting in equivalent Th1/Th2 cell ratios (Fig. 7). No serum IFN-γ, IL-4, and IL-10 was detected by ELISA 3 and 7 days after infection of either infected or uninfected mice (data not shown).

FIG. 7.

FIG. 7.

Cytokine production in the spleen and kidneys of BALB/c mice infected i.v. with 5 × 104 SC5314 and SAP456MS4A C. albicans cells. (A) Representative examples of flow cytometric analysis of intracellular IFN-γ and IL-4 expression on gated splenic and renal CD4+ T cells, as indicated. Numbers inside dot plot regions represent means ± 1 standard deviation of the frequency of IFN-γ+ or IL-4+ CD4+ T cells. (B) IFN-γ+/IL-4+ CD4+ T-cell ratio, normalized considering the ratio of noninfected controls as the basal value (zero value). (C) Dot plots showing the percentages of splenic CD4+ T cells producing IL-10. Numbers inside dot plots represent means ± 1 standard deviation of the frequency of IL-10+ CD4+ T cells. Data are representative of two independent experiments (n = 4 for noninfected control and n = 7 for infected mouse groups). Statistically significant differences between controls and C. albicans-infected mice are indicated (*, P < 0.05; **, P < 0.01).

Overall, these results indicate that a deficiency of SAP4 to SAP6 does not have a significant impact on the immune response elicited in the spleen and kidneys of BALB/c mice hematogenously challenged with C. albicans.

DISCUSSION

The secretion of aspartyl proteinases has long been recognized as a virulence-associated trait of Candida albicans (10, 27, 49). The importance of specific Sap isoenzymes for the pathogenicity of this fungus has been investigated with different infection models by comparing the virulence of mutants deficient in individual or multiple SAP genes with that of a WT control strain. In this study, the importance of SAP1 to SAP6 gene expression for C. albicans virulence was evaluated by using sap-null mutants derived from WT strain SC5314. The virulence of mutant strains lacking SAP1 to SAP3 was indistinguishable from that of WT strain SC5314, while the deletion of SAP4 to SAP6 caused a slight attenuation in virulence. Previous reports have shown that a deficiency in SAP4 to SAP6 attenuated virulence to a higher extent than did a deficiency in SAP1, SAP2, or SAP3 (20, 43). Here, an increased median survival time was consistently observed for mice infected with mutants lacking the SAP5 gene, such as the single-deletion mutant strain SAP5MS4A or the triple-deletion mutant strain SAP456MS4A, compared to that of animals infected with WT strain SC5314. However, the differences found were small and not always significant. Moreover, histopathology analysis did not indicate a reduced ability of the SAP456MS4A mutant to invade the kidneys, although sap-null mutant strains lacking the SAP6 gene were previously shown to have reduced invasiveness in a model of experimental peritonitis (16). The deletion of SAP4 to SAP6 did not result in clear differences in hypha formation, and similar morphotypes were observed, both in vitro and in vivo, for WT and mutant strains. This is not unexpected, as SAP4 to SAP6 expression is associated with, but not required for, hyphal morphology (16). Additionally, expression levels of SAP4 to SAP6 may not be directly linked to organ invasion, since a previously reported C. albicans strain expressing high levels of SAP4 to SAP6 was noninvasive (57).

The results obtained with SAT1-flipping mutants contrast with those obtained when using the Ura-blaster sap-null mutants, which survived much longer. When another parameter associated with C. albicans virulence was analyzed, such as kidneys CFU, no differences were observed among mouse groups, except for the ones infected with strain DSY459, which presented a lower fungal burden. Discrepancies between different methods of evaluating virulence have already been reported for mice intravenously infected with C. albicans mutant strains, including sap-null mutants, where differences in mouse survival were not associated with differences in organ fungal burden (20, 54, 62). The differences found between the two sets of mutants are most likely due to the ectopic insertion of URA3, which must have contributed to the reduced virulence of the Ura-blaster-constructed mutant strains. It is widely known that the Ura status of C. albicans strains influences adherence (5) and virulence (28, 52). Although this can be overcome by the integration of URA3 at the ENO1 (52) or RPS10 (8) locus, the strains used in this study and in previously reported studies (20, 43) did not share a site of URA3 integration.

The disruption of SAP1 to SAP3 and SAP4 to SAP6 led to an increased level of expression of SAP4 and SAP1 to SAP3, respectively, suggesting that C. albicans attempts to compensate the functional loss of these subfamilies by upregulating alternative SAP genes during hematogenously disseminated candidiasis. Therefore, the compensatory upregulation observed could be, to some extent, contributing to the lack of a phenotype seen for these mutants. However, the equivalent Ura-blaster mutants, despite the compensatory upregulation reported previously (34, 45), showed markedly reduced virulence in this model.

Recently, Lermann and Morschhäuser (29) and Naglik et al. (34) reevaluated the role of SAP1 to SAP6 in a model of reconstituted human epithelia (RHE) and reported that SAP1 to SAP6 were not essential for successful C. albicans RHE infection, in contrast to previous reports (45, 46). The present study thus reports an additional model in which the SAP gene subfamilies SAP1 to SAP3 and SAP4 to SAP6 seem to have little influence on the outcome of infection.

As mice infected with the Δsap456 triple mutant displayed a slightly extended survival time, it could be expected that it might result from a more effective host immune response. This would be in agreement with a previous report suggesting an immunomodulatory role of Sap4 to Sap6 upon macrophage phagocytosis (7). However, the analysis of diverse features of the innate and acquired immune response elicited in BALB/c mice upon infection with either the WT or the Δsap456 triple mutant did not show any significant differences between these two yeast strains. The similar abilities of both strains to recruit inflammatory cells are in accordance with their similar observed virulences, taking into account the prominent role of innate immunity and of neutrophils in particular, in host protection against disseminated candidiasis (2, 60).

The proportions of splenic Teffector and Treg cells in the spleens of mice infected with either the WT or the Δsap456 mutant were highly similar. Likewise, the frequencies of CD4+ T cells expressing IFN-γ, IL-4, and IL-10, cytokines previously shown to be relevant for resistance or susceptibility to systemic candidiasis (48), were similar in the two infected mouse groups. In vivo models indicate that regulatory T cells attenuate Th1-type antifungal responses and induce tolerance to the fungus (32, 36). As higher IFN-γ/IL-4 ratios were observed for splenic and renal CD4+ T cells of infected mice than those of noninfected controls, it can be assumed that even though the kidneys of infected mice presented a high fungal burden 7 days after challenge, a protective Th1-type response of an equivalent magnitude might be occurring in both WT- and Δsap456 mutant-infected mice.

Although our results suggest that B cells may have a role in the activation of T cells during experimental disseminated candidiasis, in accordance with the increased susceptibility observed for B-cell-deficient mice (61), they also indicate that the deficiency of SAP4 to SAP6 does not affect such a role of B cells.

Differences in C. albicans morphology have been frequently shown to influence both the type and magnitude of the host immune response in the course of candidiasis. Dendritic cells, and also neutrophils, modulate adaptive responses to the fungus, depending on the Candida morphotype encountered (14, 42, 47). As indistinguishable morphotypes were found for the WT and the Δsap456 mutant strain both in vitro and in vivo, this is also in agreement with the lack of significant differences observed in the immune responses elicited by these strains.

A relative independence on aspartyl proteinase activity for the establishment of hematogenously disseminated candidiasis was previously reported (15), as treatment with pepstatin A, a potent protease inhibitor, did not protect mice against intravenous infection with C. albicans. As previously suggested, an explanation for these observations may be the requirement for Sap only where anatomical barriers had to be crossed prior to dissemination (15, 26). When C. albicans cells are delivered directly into the bloodstream, low-molecular-weight peptides are available, and yeast growth may be protease independent.

The relative importance of specific SAP genes for C. albicans pathogenicity is greatly determined by the type of infection and its dependence on protease activity for the successful invasion and colonization of various host niches. Treatment with pepstatin A resulted in reduced virulence in intranasal (15) and intraperitoneal (26) models but had no protective effect in the intravenous model. The subfamily of the SAP genes SAP1 to SAP3, and SAP2 in particular, was proven to be important in a model of rat vaginal infection, while SAP4 to SAP6 had little impact on this infection model (12). In contrast, only Δsap456 mutants, and Δsap6 in particular, showed reduced virulence in a murine model of Candida peritonitis and keratitis, while the deletion of the SAP1, SAP2, or SAP3 gene had no significant effect on these infection models (16, 23). Moreover, immunological neutralization of Sap2 was shown to have a protective effect on C. albicans-infected hosts during vaginal and oral infection (12, 40) and also in experimental peritonitis (59).

Although individual processes resulting from the action of a single gene or a small group of genes may be important in specific stages of infection, cooperative gene functions are essential for the multiple processes of C. albicans infection (38). Thus, although the proteinase family as a whole may contribute to C. albicans virulence in the course of acute systemic candidiasis, other factors must be the major contributors to invasion and cell damage in this model.

Acknowledgments

We are indebted to Bernhard Hube from Hans Knoell Institute, Jena, Germany, for providing C. albicans CAF2-1 and the Ura-blaster sap mutant strains.

This work was supported by Fundação para a Ciência e Tecnologia grant POCI/SAU-IMI/58014/2004 and FEDER. Alexandra Correia and Filipe Cerca were supported by FCT fellowships SFRH/BD/31354/2006 and SFRH/BD/27638/2006, respectively. Luzia Teixeira was supported by FSE and MCTES through POPH-QREN-Tipologia 4.2.

Editor: G. S. Deepe, Jr.

Footnotes

▿

Published ahead of print on 2 August 2010.

REFERENCES

  • 1.Albrecht, A., A. Felk, I. Pichova, J. R. Naglik, M. Schaller, P. de Groot, D. MacCallum, F. C. Odds, W. Schäfer, F. Klis, M. Monod, and B. Hube. 2006. Glycosylphosphatidylinositol-anchored proteases of Candida albicans target proteins necessary for both cellular processes and host-pathogen interactions. J. Biol. Chem. 281:688-694. [DOI] [PubMed] [Google Scholar]
  • 2.Ashman, R. B. 2008. Protective and pathologic immune responses against Candida albicans infection. Front. Biosci. 13:3334-3351. [DOI] [PubMed] [Google Scholar]
  • 3.Ashman, R., C. S. Farah, S. Wanasaengsakul, Y. Hu, G. Pang, and R. L. Clancy. 2004. Innate versus adaptive immunity in Candida albicans infection. Immunol. Cell Biol. 82:196-204. [DOI] [PubMed] [Google Scholar]
  • 4.Ausubel, F. M. (ed.). 1993. Current protocols in molecular biology, 2nd ed. Wiley, New York, NY.
  • 5.Bain, J. M., C. Stubberfield, and N. A. Gow. 2001. Ura-status-dependent adhesion of Candida albicans mutants. FEMS Microbiol. Lett. 204:323-328. [DOI] [PubMed] [Google Scholar]
  • 6.Bonifazi, P., T. Zelante, C. D'Angelo, A. De Luca, S. Moretti, S. Bozza, K. Perruccio, R. G. Iannitti, G. Giovannini, C. Volpi, F. Fallarino, P. Puccetti, and L. Romani. 2009. Balancing inflammation and tolerance in vivo through dendritic cells by the commensal Candida albicans. Mucosal Immunol. 2:362-374. [DOI] [PubMed] [Google Scholar]
  • 7.Borg-von Zepelin, M., S. Beggah, K. Boggian, D. Sanglard, and M. Monod. 1998. The expression of the secreted aspartyl proteinases Sap4 to Sap6 from Candida albicans in murine macrophages. Mol. Microbiol. 28:543-554. [DOI] [PubMed] [Google Scholar]
  • 8.Brand, A., D. M. MacCallum, A. J. P. Brown, N. A. Gow, and F. C. Odds. 2004. Ectopic expression of URA3 can influence the virulence phenotypes and proteome of Candida albicans but can be overcome by targeted reintegration of URA3 at the RPS10 locus. Eukaryot. Cell 3:900-909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Buentke, E., and A. Sheynius. 2003. Dendritic cells and fungi. APMIS 111:789-796. [DOI] [PubMed] [Google Scholar]
  • 10.Cassone, A., F. de Bernardis, F. Mondello, T. Ceddia, and L. Agatensi. 1987. Evidence for a correlation between proteinase secretion and vulvovaginal candidosis. J. Infect. Dis. 156:777-783. [DOI] [PubMed] [Google Scholar]
  • 11.Cheng, S., M. H. Nguyen, Z. Zhang, H. Jia, M. Handfield, and C. J. Clancy. 2003. Evaluation of the roles of four Candida albicans genes in virulence by using gene disruption strains that express URA3 from the native locus. Infect. Immun. 71:6101-6103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.De Bernardis, F., M. Boccanera, D. Adriani, A. Girolamo, and A. Cassone. 2002. Intravaginal and intranasal immunizations are equally effective in inducing vaginal antibodies and conferring protection against vaginal candidiasis. Infect. Immun. 70:2725-2729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.De Bernardis, F., S. Arancia, L. Morelli, B. Hube, D. Sanglard, W. Schäfer, and A. Cassone. 1999. Evidence that members of the secretory aspartyl proteinase gene family, in particular SAP2, are virulence factors for Candida vaginitis. J. Infect. Dis. 179:201-208. [DOI] [PubMed] [Google Scholar]
  • 14.d'Ostiani, C. F., G. Del Sero, A. Bacci, C. Montagnoli, A. Spreca, A. Mencacci, P. Ricciardi-Castagnoli, and L. Romani. 2000. Dendritic cells discriminate between yeasts and hyphae of the fungus Candida albicans: implications for initiation of T helper cell immunity in vitro and in vivo. J. Exp. Med. 191:1661-1673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Fallon, K., K. Bausch, J. Noonan, E. Huguenel, and P. Tamburini. 1997. Role of aspartic proteases in disseminated Candida albicans infection in mice. Infect. Immun. 65:551-556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Felk, A., M. Kretschmar, A. Albrecht, M. Schaller, S. Beinhauer, T. Nichterlein, D. Sanglard, H. C. Korting, W. Schäfer, and B. Hube. 2002. Candida albicans hyphal formation and the expression of the Efg1-regulated proteinases Sap4 to Sap6 are required for the invasion of parenchymal organs. Infect. Immun. 70:3689-3700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gillum, A. M., E. Y. Tsay, and D. R. Kirsch. 1984. Isolation of the Candida albicans gene for orotidine-5′-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol. Gen. Genet. 198:179-182. [DOI] [PubMed] [Google Scholar]
  • 19.Hostetter, M. K. 1994. Adhesins and ligands involved in the interaction of Candida spp. with epithelial and endothelial surfaces. Clin. Microbiol. Rev. 7:29-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hube, B., D. Sanglard, F. C. Odds, D. Hess, M. Monod, W. Schäfer, A. J. Brown, and N. A. Gow. 1997. Disruption of each of the secreted aspartyl proteinase genes SAP1, SAP2, and SAP3 of Candida albicans attenuates virulence. Infect. Immun. 65:3529-3538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hube, B., and J. Naglik. 2001. Candida albicans proteinases: resolving the mystery of a gene family. Microbiology 147:1997-2005. [DOI] [PubMed] [Google Scholar]
  • 22.Hube, B., M. Monod, D. A. Schofield, A. J. Brown, and N. A. Gow. 1994. Expression of seven members of the gene family encoding secretory aspartic proteinases in Candida albicans. Mol. Microbiol. 14:87-99. [DOI] [PubMed] [Google Scholar]
  • 23.Jackson, B. E., K. R. Wilhelmus, and B. Hube. 2007. The role of secreted aspartyl proteinases in Candida albicans keratitis. Invest. Ophthalmol. Vis. Sci. 48:3559-3565. [DOI] [PubMed] [Google Scholar]
  • 24.Jones-Carson, J., A. Vazquez-Torres, T. Warner, and E. Balish. 2000. Disparate requirement for T cells in resistance to mucosal and acute systemic candidiasis. Infect. Immun. 68:2363-2365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kretschmar, M., A. Felk, P. Staib, M. Schaller, D. Hess, M. Callapina, J. Morschhäuser, W. Schäfer, H. C. Korting, H. Hof, B. Hube, and T. Nichterlein. 2002. Individual acid aspartic proteinases (Saps) 1-6 of Candida albicans are not essential for invasion and colonization of the gastrointestinal tract in mice. Microb. Pathog. 32:61-70. [DOI] [PubMed] [Google Scholar]
  • 26.Kretschmar, M., B. Hube, T. Bertsch, D. Sanglard, R. Merker, M. Schröder, H. Hof, and T. Nichterlein. 1999. Germ tubes and proteinase activity contribute to virulence of Candida albicans in murine peritonitis. Infect. Immun. 67:6637-6642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kwon-Chung, K. J. K., D. Lehman, C. Good, and P. T. Magee. 1985. Genetic evidence for role of extracellular proteinase in virulence of Candida albicans. Infect. Immun. 49:571-575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lay, J., K. Henry, J. Clifford, Y. Koltin, C. E. Bulawa, and J. M. Becker. 1998. Altered expression of selectable marker URA3 in gene-disrupted Candida albicans strains complicates interpretation of virulence studies. Infect. Immun. 66:5301-5306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lermann, U., and J. Morschhäuser. 2008. Secreted aspartic proteases are not required for invasion of reconstituted human epithelia by Candida albicans. Microbiology 154:3281-3295. [DOI] [PubMed] [Google Scholar]
  • 30.MacCallum, D. M., and F. C. Odds. 2004. Temporal events in the intravenous challenge model for experimental Candida albicans infections in female mice. Mycoses 48:151-161. [DOI] [PubMed] [Google Scholar]
  • 31.Mencacci, A., C. Montagnoli, A. Bacci, E. Cenci, L. Pitzurra, A. Spreca, M. Kopf, A. H. Sharpe, and L. Romani. 2002. CD80+Gr-1+ myeloid cells inhibit development of antifungal Th1 immunity in mice with candidiasis. J. Immunol. 169:3180-3190. [DOI] [PubMed] [Google Scholar]
  • 32.Montagnoli, C., A. Bacci, S. Bozza, R. Gaziano, P. Mosci, A. H. Sharpe, and L. Romani. 2002. B7/CD28-dependent CD4+CD25+ regulatory T cells are essential components of the memory-protective immunity to Candida albicans. J. Immunol. 169:6298-6308. [DOI] [PubMed] [Google Scholar]
  • 33.Naglik, J., A. Albrecht, O. Bader, and B. Hube. 2004. Candida albicans proteinases and host/pathogen interactions. Cell. Microbiol. 6:915-926. [DOI] [PubMed] [Google Scholar]
  • 34.Naglik, J. R., D. Moyes, J. Makwana, P. Kanzaria, E. Tsichlaki, G. Weindl, A. R. Tappuni, C. A. Rodgers, A. J. Woodman, S. J. Challacombe, M. Schaller, and B. Hube. 2008. Quantitative expression of the Candida albicans secreted aspartyl proteinase gene family in human oral and vaginal candidiasis. Microbiology 154:3266-3280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Naglik, J. R., S. J. Challacombe, and B. Hube. 2003. Candida albicans secreted aspartyl proteinases in virulence and pathogenesis. Microbiol. Mol. Biol. Rev. 67:400-428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Netea, M. G., R. Sutmuller, C. Hermann, C. A. A. Van der Graaf, J. W. M. Van der Meer, J. H. van Krieken, T. Hartung, G. Adema, and B. J. Kullberg. 2004. Toll-like receptor 2 suppresses immunity against Candida albicans through induction of IL-10 and regulatory T cells. J. Immunol. 172:3712-3718. [DOI] [PubMed] [Google Scholar]
  • 37.Odds, F. C. 1994. Candida species and virulence. ASM News 60:313-318. [Google Scholar]
  • 38.Odds, F. C., N. A. R. Gow, and A. J. Brown. 2006. Toward a molecular understanding of Candida albicans virulence, p. 305-319. In J. Heitman et al. (ed.), Molecular principles of fungal pathogenesis. ASM Press, Washington, DC.
  • 39.Pappas, P. G. 2006. Invasive candidiasis. Infect. Dis. Clin. North Am. 20:485-506. [DOI] [PubMed] [Google Scholar]
  • 40.Rahman, D., M. Mistry, S. Thavarai, S. J. Challacombe, and J. R. Naglik. 2007. Murine model of concurrent oral and vaginal Candida albicans colonization to study epithelial host-pathogen interactions. Microbes Infect. 9:615-622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Reuß, O., Å. Vik, R. Kolter, and J. Morschhäuser. 2004. The SAT1 flipper, an optimized tool for gene disruption in Candida albicans. Gene 341:119-127. [DOI] [PubMed] [Google Scholar]
  • 42.Romani, L., C. Montagnoli, S. Bozza, K. Perruccio, A. Spreca, P. Allavena, S. Verbeek, R. A. Calderone, F. Bistoni, and P. Puccetti. 2004. The exploitation of distinct recognition receptors in dendritic cells determines the full range of host immune relationships with Candida albicans. Int. Immunol. 16:149-161. [DOI] [PubMed] [Google Scholar]
  • 43.Sanglard, D., B. Hube, M. Monod, F. C. Odds, and N. A. Gow. 1997. A triple deletion of the secreted aspartyl proteinase genes SAP4, SAP5, and SAP6 of Candida albicans causes attenuated virulence. Infect. Immun. 65:3539-3546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Saville, S. P., A. L. Lazzell, C. Monteagudo, and J. L. Lopez-Ribot. 2003. Engineered control of cell morphology in vivo reveals distinct roles for yeast and filamentous forms of Candida albicans during infection. Eukaryot. Cell 2:1053-1060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Schaller, M., H. C. Korting, W. Schäfer, J. Bastert, W. Chen, and B. Hube. 1999. Secreted aspartic proteinase (Sap) activity contributes to tissue damage in a model of human oral candidosis. Mol. Microbiol. 34:169-180. [DOI] [PubMed] [Google Scholar]
  • 46.Schaller, M., M. Bein, H. C. Korting, S. Baur, G. Hamm, M. Monod, S. Beinhauer, and B. Hube. 2003. The secreted aspartyl proteinases Sap1 and Sap2 cause tissue damage in an in vitro model of vaginal candidiasis based on reconstituted human vaginal epithelium. Infect. Immun. 71:3227-3234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Shoham, S., and S. M. Levitz. 2005. The immune response to fungal infections. Br. J. Haematol. 129:569-582. [DOI] [PubMed] [Google Scholar]
  • 48.Spellberg, B., D. Johnston, Q. T. Phan, J. E. Edwards, Jr., S. W. French, A. S. Ibrahim, and S. G. Filler. 2003. Parenchymal organ, and not splenic, immunity correlates with host survival during disseminated candidiasis. Infect. Immun. 71:5756-5764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Staib, F. 1969. Proteolysis and pathogenicity of Candida albicans strains. Mycopathol. Mycol. Appl. 37:345-348. [DOI] [PubMed] [Google Scholar]
  • 50.Staib, P., M. Kretschmar, T. Nichterlein, H. Hof, and J. Morschhäuser. 2000. Differential activation of a Candida albicans virulence gene family during infection. Proc. Natl. Acad. Sci. U. S. A. 97:6102-6107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Sundstrom, P. 1999. Adhesins in Candida albicans. Curr. Opin. Microbiol. 2:353-357. [DOI] [PubMed] [Google Scholar]
  • 52.Sundstrom, P., J. E. Cutler, and J. F. Staab. 2002. Reevaluation of the role of HWP1 in systemic candidiasis by use of Candida albicans strains with selectable marker URA3 targeted to the ENO1 locus. Infect. Immun. 70:3281-3283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Sutmuller, R. P., M. H. den Brok, M. Kramer, E. J. Bennink, L. W. Toonen, B. J. Kullberg, L. A. Joosten, S. Akira, M. G. Netea, and G. J. Adema. 2006. Toll-like receptor 2 controls expansion and function of regulatory T cells. J. Clin. Invest. 116:485-494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Taylor, B. N., H. Hannemann, M. Sehnal, A. Biesemeier, A. Schweizer, M. Röllinghoff, and K. Schröppel. 2005. Induction of SAP7 correlates with virulence in an intravenous infection model of candidiasis but not in a vaginal infection model in mice. Infect. Immun. 73:7061-7063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Taylor, P. R., G. D. Brown, A. B. Geldhof, L. Martinez-Pomares, and S. Gordon. 2003. Pattern recognition receptors and differentiation antigens define murine myeloid cell heterogeneity ex vivo. Eur. J. Immunol. 33:2090-2097. [DOI] [PubMed] [Google Scholar]
  • 56.Taylor, P. R., S. V. Tsoni, J. A. Willment, K. M. Dennehy, M. Rosas, H. Findon, K. Haynes, C. Steele, M. Botto, S. Gordon, and G. D. Brown. 2007. Dectin-1 is required for b-glucan recognition and control of fungal infection. Nat. Immunol. 8:31-38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Thewes, S., M. Kretschmar, H. Park, M. Schaller, S. G. Filler, and B. Hube. 2007. In vivo and ex vivo comparative transcriptional profiling of invasive and non-invasive Candida albicans isolates identifies genes associated with tissue invasion. Mol. Microbiol. 63:1606-1628. [DOI] [PubMed] [Google Scholar]
  • 58.Vázquez-Torres, A., and E. Balish. 1997. Macrophages in resistance to candidiasis. Microbiol. Mol. Biol. Rev. 61:170-192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Vilanova, M., L. Teixeira, I. Caramalho, E. Torrado, A. Marques, P. Madureira, A. Ribeiro, P. Ferreira, M. Gama, and J. Demengeot. 2004. Protection against systemic candidiasis in mice immunized with secreted aspartic proteinase 2. Immunology 111:334-342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Vonk, A. G., M. G. Netea, J. W. M. van der Meer, and B. J. Kullberg. 2006. Host defence against disseminated Candida albicans infection and implications for antifungal immunotherapy. Expert Opin. Biol. Ther. 6:891-903. [DOI] [PubMed] [Google Scholar]
  • 61.Wagner, R. D., A. Vazquez-Torres, J. Jones-Carson, T. Warner, and E. Balish. 1996. B cell knockout mice are resistant to mucosal and systemic candidiasis of endogenous origin but susceptible to experimental systemic candidiasis. J. Infect. Dis. 174:589-597. [DOI] [PubMed] [Google Scholar]
  • 62.Warenda, A. J., S. Kauffman, T. P. Sherrill, J. M. Becker, and J. B. Konopka. 2003. Candida albicans septin mutants are defective for invasive growth and virulence. Infect. Immun. 71:4045-4051. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES