Characterizing the Effects of Inorganic Acid and Alkaline Shock on the Staphylococcus aureus Transcriptome and Messenger RNA Turnover

Abstract

Staphylococcus aureus pathogenesis can be partially attributed to its ability to adapt to otherwise deleterious host-associated stresses. Here, Affymetrix GeneChips^® were used to examine the S. aureus responses to inorganic acid and alkaline shock and to assess whether stress dependent changes in mRNA turnover are likely to facilitate the organism’s ability to tolerate pH challenge. Results indicate that S. aureus adapts to pH shock by eliciting responses expected of cells coping with pH alteration, including neutralizing cellular pH, DNA repair, amino acid biosynthesis and virulence factor expression. Further, the S. aureus response to alkaline conditions is strikingly similar to that of stringent response induced cells. Indeed, we show that alkaline shock stimulates accumulation of the stringent response activator (p)ppGpp. Results also revealed that pH shock significantly alters the mRNA properties of the cell. A comparison of the mRNA degradation properties of transcripts whose titers either increased or decreased in response to sudden pH change revealed that alterations in mRNA degradation may, in part, account for the changes in the mRNA levels of factors predicted to mediate pH tolerance. A set of small stable RNA molecules were induced in response to acid or alkaline shock conditions and may mediate adaptation to pH stress.

INTRODUCTION

Steady-state messenger RNA levels are a function of both transcript synthesis and degradation. Yet studies of prokaryotic mRNA regulation have historically attributed regulated changes in mRNA titers as occurring at the level of transcript synthesis alone. Recent studies have shown that this is likely to be an oversimplification. Like messenger RNA synthesis, mRNA degradation is a highly regulated process that affects transcript titers and, consequently, gene expression [reviewed in (Anderson and Dunman 2009)]. For instance, during cold-shock conditions Escherichia coli increases production of CspA: a protein which resolves low temperature mediated mRNA secondary structures that would otherwise impede mRNA translation (Goldstein et al. 1990; Jones et al. 1996; Jiang et al. 1997). Upon temperature downshift, increased cspA mRNA stability, as opposed to increased transcript synthesis, primarily accounts for the elevated levels of CspA production (Goldenberg et al. 1996; Fang et al. 1997; Fang et al. 1999). Regulated changes in mRNA turnover are also well recognized to affect Vibrio angustum and Klebsiella pneumoniae adaptation to nutrient and nitrogen stress, respectively [Reviewed in (Takayama and Kjelleberg 2000)].

Staphylococcus aureus is a Gram-positive pathogen that is capable of causing various types of infections which range in severity from skin and soft tissue infections to life-threatening pneumonia and endocarditis (Gordon and Lowy 2008). Due, in part, to the emergence of antibiotic resistance and strains that are capable of causing infection in otherwise-healthy individuals S. aureus is now estimated to be responsible for more U.S. deaths annually than HIV/AIDS (Klevens et al. 2007; Boucher and Corey 2008). The organism’s ability to cause disease can be largely attributed to the production of an expansive repertoire of cell surface- and extracellular-virulence factors (Novick 2003; Bronner et al. 2004), as well as its ability to maintain cellular homeostasis while enduring host-associated and other environmental challenges (Voyich et al. 2005). Understanding virulence factor regulatory networks and the mechanisms by which the organism copes with otherwise detrimental environmental conditions may provide novel strategies for the therapeutic intervention of staphylococcal infections.

Recent studies indicate that regulated changes in mRNA turnover promote the organism’s ability to adapt to certain stress conditions. For instance, we have shown that S. aureus globally alters its mRNA turnover properties in response to temperature shock and stringent response inducing conditions (Anderson et al. 2006). Further stress dependent changes in transcript degradation correlate to changes in protein production, supporting the hypothesis that the modulation of mRNA turnover plays an important role in mediating the organism’s ability to adapt to environmental stress (Anderson et al. 2006). Interestingly, the global modulation of mRNA turnover does not seem to be a component of adaptation to all stresses, as the RNA degradation properties of SOS induced cells mimics that of unstressed S. aureus (Anderson et al. 2006).

Many S. aureus environmental- and host-associated niches are in continual pH fluctuation due to natural (menstruation) or artificial (exposure to cleaning agents) occurrences. Thus, to colonize, survive and ultimately cause infection, S. aureus must successfully acclimate to transient alterations in pH. Indeed, S. aureus colonizing the external labia must adapt to brief exposures to vaginal secretions [pH 3.8 to 4.5;(Manka et al. 2002)]. Similarly, although classically considered an extracellular pathogen, the organism is capable of invading and temporarily surviving within the lysosomal compartment (pH 4.5 to 5.5) before escaping into the cytosol of nonphagocytic cells (Jarry and Cheung 2006). The organism is also likely to encounter elevated pH environmental conditions (pH 8.9) at sites of wound secretions and must adapt to persist and cause disease (Schneider et al. 2007). Consequently, S. aureus is likely to have evolved biological mechanisms to cope with acidic and/or alkaline conditions that contribute to the organism’s ability to cause disease.

Recent microarray studies revealed that S. aureus does indeed respond to pH stress in an orchestrated manner that is likely to augment the organism’s ability to adapt to alterations in pH. Weinrick and colleagues showed that during steady-state mildly acidic growth (pH 5.5) S. aureus induces expression of gene products that are ostensibly involved in intracellular pH maintenance (ure operon), osmoprotection (opuC operon), and both acid and osmoprotection (kdp operon) (Booth 1985; Sleator and Hill 2002; Weinrick et al. 2004). Moreover, that study revealed that steady-state mild acid growth redirects expression of many of the organism’s virulence factors, in part, by diminishing the growth phase-dependent expression properties of the virulence regulatory locus, sae (Weinrick et al. 2004). More recently, Bore and colleagues showed that sudden inorganic acid stress (20 min pH 4.5) induces S. aureus acid-defense systems, including the ure operon, as well as other biological processes, such as proton efflux and DNA repair; these systems are likely to facilitate adaptation by maintaining intracellular pH homeostasis and repairing acidification-associated damage. Like steady-state acid stress, sudden acid exposure was also shown to decrease sae expression, and the expression properties of several virulence factor transcripts (Bore et al. 2007). In comparison to acid-shock conditions, less is known about the organism’s ability to adapt to alkaline stress. However, it is clear that alkaline conditions modulate numerous S. aureus cellular processes including virulence factor production. Indeed, Regassa and colleagues found that alkaline growth conditions decrease RNAIII expression and virulence factor production (Regassa and Betley 1992). More recently, Pané-Farré and colleagues identified 122 RNA species, including members of the capsule biosynthesis operon, an Na⁺/H⁺ antiporter system and autolysin, to be upregulated in response to sudden alkaline shock conditions (Pane-Farre et al. 2006). That study also revealed that the induction of most (59%) of alkaline shock genes is likely to occur via activation of the alternative sigma factor, σ^B.

In the current work Affymetrix GeneChips^® were used to further characterize the S. aureus acid-and alkaline-shock responses and distinguish whether the modulation of mRNA turnover is likely to contribute the organism’s ability to adapt to extreme pH. As previously reported, we found that sudden inorganic acid exposure results in a physiological state that is geared toward acid-neutralization, transport, and increasing the organism’s reducing power while simultaneously reducing purine and pyrimidine ribonucleotide biosynthesis and proton motive force, but we also found that the response includes more members of the organism’s virulon than previously recognized and also includes such virulence factors as clumping factor B and protein A (Bore et al. 2007). Our results revealed that alkaline shock conditions results in a cellular state that is likely to promote alkaline-neutralization, diminishing oxidative stress-induced DNA and protein lesions, and increased capsule production. Further, we demonstrated that capsule expression is σ^B independent and does not appear to directly result in a protective effect during cellular growth at elevated pH. We also found that the organsim’s alkaline shock response is strikingly similar to that of the stringent response, which is required for S. aureus survival within the host. Mass-spectrometry confirmed that alkaline-shock conditions induce accumulation of the stringent response inducing factor ppGpp. Furthermore, we show that both acid- and alkaline-shock conditions profoundly alter the mRNA turnover properties of S. aureus cells. A survey of the transcript degradation properties of mRNA species that are either increased or decreased in response to acid or alkaline shock conditions suggests that key components of these pH adaptation responses are post-transcriptionally regulated in a manner that involves modulating their mRNA turnover. Finally, we also observed that a set of small non-coding stable RNA molecules (SSRs) were also components of each stress response. Given the importance of SSR-like molecules in other organisms, it is likely that these RNA species play an important role(s) in acid- and alkaline-responsive functions

MATERIALS & METHODS

Bacterial strain

Staphylococcus aureus strain UAMS-1 is a well-characterized osteomyelitis clinical isolate (Gillaspy et al. 1995; Cassat et al. 2005). S. aureus strains CYL6194 and UAMS-1274 are isogenic capsule and sigma β deficient strains, respectively (Gillaspy et al. 1998; Anderson et al. 2006).

Oligonucleotides

Oligonucleotides used in this study for quantitative reverse transcription-mediated PCR (qRT-PCR) and reverse transcription-mediated PCR (RT-PCR) are listed in Table 1.

Table 1.

Oligonucleotides used in this study.

Name	Oligonucleotide sequence (5′-3′)
asp23-F	TGTATCTGTTGAAGTTGGTGAAAAA
asp23-R	TCTTTTTGAGTCATTACATCGTCAA
capA-F	CCTCAGTTTATGGCGCAAGAGGTTC
capA-R	GTGCGACTTTAACTGCTGTACCGTC
kdpD-F	TTGAAGTATACCGCTTTGACTATCC
kdpD-R	TTGATTAATTTGGTATCCAGCATTT
ureB-F	GAAATGGCATATGGAAAACATTTAG
ureB-R	TTTCAGTACCGTTATCTCCGAATAC

Growth Conditions

To assess the S. aureus response to acid or alkaline shock conditions, overnight cultures of UAMS-1 cells were inoculated 1:100 into fresh Brain Heart Infusion (BHI) broth and grown to early-exponential phase with aeration (250 RPM) at 37°C. Alkaline and acid shock responses were induced by adjusting/maintaining the pH of the culture medium to pH 10 with 1N NaOH or pH 4 with 1N HCl, respectively. For bacterial survival assays, a 50 μl of aliquot of cells was collected at 30 min and at every hour for a total of 6 hr after stress induction. Cells were serially diluted in 0.8% NaCl, plated on BHI plates, incubated overnight at 37°C and the number of viable colony forming units were enumerated and presented as Log₁₀ cfu ml⁻¹. For microarray studies, stress responses were induced for 30 min at which point 20 ml of cells were removed and mixed with an equal volume of ice-cold acetone:ethanol (1:1) solution and stored at −80°C until RNA isolation. To assess the mRNA turnover properties of alkaline and acid shocked cells, Rifampicin (Sigma, St. Louis, MO; 200 μg ml⁻¹) was immediately added to the culture to arrest transcription and twenty-one ml of cells were removed at 0, 2.5, 5, 15, and 30 min post-transcriptional arrest. Twenty milliliters of each post-transcriptional arrest aliquot were added to an equal volume of ice-cold acetone:ethanol (1:1) solution and stored overnight at −80°C until RNA isolation; the remaining 1 ml of each aliquot was diluted in BHI and plated on to both BHI (10⁻⁷) and BHI containing Rifampicin (10⁻¹) agar plates. Plates were incubated overnight at 37°C then colony forming units (cfu) were enumerated to assure that cellular proliferation was arrested and to monitor for Rifampicin resistance, as previously described (Anderson et al. 2006; Roberts et al. 2006). If Rifampicin resistant colonies were detected, the experiment was discarded and repeated. In total, at least two independent biological replicates corresponding to each pH condition (neutral, low or high pH) and post-transcriptional arrest time point were used for RNA isolation and GeneChip^® analysis, as described below.

RNA purification

RNA was isolated and prepared for GeneChip^® analysis as previously described (Beenken et al. 2004; Bischoff et al. 2004; Weinrick et al. 2004; Anderson et al. 2006; Roberts et al. 2006). Briefly, aliquots of acetone:ethanol cell suspensions equaling 1 × 10⁹ cfu were pelleted by centrifugation at 3000 RPM for 10 min at 4°C. Cell pellets were washed twice then resuspended in 500 μl TE buffer (10mM Tris, 1mM EDTA, pH 7.6). Suspensions were then transferred to BIO101 lysing matrix B tubes (MP Biomedical; Pasadena, CA) and mechanically disrupted in a FastPrep120 shaker (MP Biomedical). Cell debris was collected by centrifugation at 4°C for 15 min, whereas supernatants were used for RNA isolation using the Qiagen RNeasy^® Mini Kits, following manufacturer’s recommendations (Valencia, CA). RNA concentrations were determined spectrophotometrically (OD₂₆₀ 1.0 = 40 μg ml⁻¹) and the RNA integrity of ribosomal RNA was evaluated on 1.2% agarose-0.66 M formaldehyde denaturing gels. RNA used for quantitative real time-PCR or reverse-transcriptase mediated PCR was subsequently treated with 10 units RNase-free DNase I (Amersham BioSciences; Piscataway, NJ) at 37°C for 30 min and repurified using Qiagen RNeasy^® Mini Kits according to the manufacturer’s instructions for RNA clean-up.

RNA labeling and GeneChip^® analysis

Ten micrograms of total bacterial RNA from each sample was labeled and hybridized to a S. aureus GeneChip^® following the manufacturer’s recommendations for antisense prokaryotic arrays (Affymetrix; Santa Clara, CA). Briefly, exogenous Eukaryotic Poly-A RNA (Affymetrix) was added to each RNA sample and reverse transcribed. Resulting cDNA was purified using Qiagen PCR Clean-up kits, fragmented with DNase I (Amersham BioSciences) and 3′ end-labeled with biotin using the Enzo Bioarray Terminal Labeling Kit (Enzo Life Sciences; Farmingdale, NY). A total of 1.5 μg of labeled material was hybridized to an Affymetrix S. aureus GeneChip^® then washed, stained, and scanned as previously described (Dunman et al. 2001; Beenken et al. 2004). Commercially available GeneChips^® were used in this study representing > 3,300 S. aureus open reading frames (ORF) and >4,800 intergenic regions from strains N315, Mu50, NCTC 8325, and COL (Affymetrix). GeneChip^® signal intensity values for each ORF and intergenic region at each replicate time point (n ≥ 2) were averaged and then either normalized to control poly(A) RNA signals for half life determinations, as previously described (Anderson et al. 2006; Roberts et al. 2006) or normalized to total GeneChip^® signal values to investigate the acid- or alkaline-shock regulon, as previously described (Beenken et al. 2004; Bischoff et al. 2004; Anderson et al. 2006; Roberts et al. 2006) using GeneSpring 7.2 software (Agilent Technologies; Redwood City, CA). A comparison of T0 signal intensity values to corresponding mock treated cells (pH 7.2) allowed identification of RNA transcripts that significantly increased or decreased ≥ 2-fold in response to acid- or alkaline-challenge (T-test p=0.05). The half-life of each transcript was calculated as the time point at which the T0 signal decreased by a factor of 2, as previously described (Bernstein et al. 2002; Anderson et al. 2006; Roberts et al. 2006). All corresponding GeneChip data files have been archived in MIAME-compliant format in the NCBI Gene Expression Omnibus repository (GSE22233).

qRT-PCR and RT-PCR

For qRT-PCR reactions, 25 ng of RNA was reverse transcribed, amplified, and measured using a LightCycler^® RNA Master SYBR Green I kit following the manufacturer’s recommendations (Roche Applied Science). As an internal control, 0.5 pg of RNA was used to quantify the amount of 16S rRNA in each sample. Transcript concentrations were calculated using LightCycler^® software and LightCycler^® Control Cytokine RNA titration kit as a standard (Roche Applied Science). Concentration values were then normalized to 16S rRNA abundance. For RT-PCR reactions, between 0.75 and 25 ng (as indicated in text) of RNA were reverse transcribed and PCR amplified using the AccessQuick^™ RT-PCR Kits, according to the manufacturer’s recommendations (Promega, Madison, WI). Amplified products were electophoresed in a 2.0% agarose gel and visualized by ethidium bromide staining.

Detection of capsular polysaccharide

Overnight cultures of UAMS-1 cells were inoculated 1:100 into fresh BHI broth and grown to early-exponential phase with aeration at 37°C. Alkaline and acid shock responses were induced, as described above. Forty-five ml of mock-treated or stress-induced cells were pelleted by centrifugation at 1600 × g for 10 min. Capsule was isolated and quantified as described previously (Luong et al. 2002; Luong et al. 2003), with modifications. Briefly, each pellet was resuspended in Phosphate Buffered Saline (PBS) to an OD₆₆₀ of 5.0. Two hundred and fifty microliters of this suspension was pelleted and resuspensed in 50μl PBS to concentrate. Cell suspensions were subsequently treated with Lysostaphin (5 μg for 30 min at 37°C), DNase I (1 unit for 30 min at 37°C), and Proteinase K (5 ug for 30 min at 50°C; repeated twice). Proteinase K was inactivated by heat treatment at 75°C for 15 min, pelleted by centrifugation, and 45 μl supernatant was used for immunoblotting. Capsule production was quantitated by immuno-dot-blotting with rabbit anti-CP8 serum for 1 hr, followed by washing with PBS containing 0.1% Tween 20 and incubation with horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin antiserum for 1 hr. The membrane was developed with a chemiluminescent substrate.

Liquid chromatography-mass spectrometry (LCMS) of ppGpp

ppGpp was purchased from TriLink BioTechnologies (San Diego CA) and used as a standard to measure cellular ppGpp levels, as previously described (Geiger et al. 2010) but with the following modifications. One hundred milliliters of exponential phase cells were used to induce either the stringent response (Anderson et al. 2006), acid shock response, alkaline shock response, or were mock treated (pH 7.4) for 30 min. Total bacterial RNA was isolated from 10 ml aliquot of each condition and subjected to RT-PCR to ensure that each stress response was induced. Fifty milliliters of cell lysates from each condition (stringent, acid, alkaline or mock) correlating to 1.0 to 5.0 × 10⁷ cfu ml⁻¹ were resuspended in 500 μl of 5 mM NH₄-acetate. Twenty microliters of each sample lysate was subjected to LCMS analysis using a Phenomenex JupiterTM C5 column (50 × 2 mm) coupled to an Agilent 1100 series LC system and an Agilent MSD instrument using a 15–65% gradient of 5 mM OAA (stationary phase) and 5 mM OAA + 80% acetonitrile (mobile phase). ppGpp levels of samples were monitored by mass spectrometry at a 599–605 h/z which correlates with the profile of purified ppGpp (601.9 h/z). Quantitation of peak values at 601.9 h/z was accomplished by standard curve analysis where the area under the curve (AUC) for commerically available ppGpp was determined by linear regression analysis providing a value of 250 AUC units × nM⁻¹. Measured ppGpp levels were then normalized to cfu of the starting sample. A total of three biological replicates of mock and each stress response induced cells were assessed; resulting ppGpp measurements were averaged.

RESULTS

Acid shock response

We set out to compare the mRNA turnover properties of exponential phase S. aureus during growth during homeostatic pH (pH 7.4) and inorganic acid-shock conditions to determine whether changes in mRNA stability contribute to changes in the transcript titers of mRNA species believed to play a role in S. aureus acid-shock adaptation. To do so, a combination of cell viability and quantitative reverse transcription mediated PCR assays were initially used to identify conditions that were suitable to study the acid-shock response in S. aureus strain UAMS-1. Accordingly, the culture medium of exponential phase cells was adjusted to pH 2.0 or 4.0 for 30 min and colony forming units were enumerated to determine whether pH lowering conditions affected cell viability. Adjusting the culture medium to pH 2.0 proved to be lethal, whereas pH 4 did not appreciably affect S. aureus cell viability during these assay conditions (data not shown). Quantitative real time-polymerase chain reaction (qRT-PCR) results revealed that the mRNA titers of two known S. aureus acid shock responsive genes, kdpD and ureB, were induced 2.0- and 37.5-fold, respectively, following 30 min exposure to pH 4.0, indicating that these experimental conditions elicit the organism’s acid-shock response (data not shown). Using Affymetrix GeneChips^® the transcriptional response of mock-treated and acid-challenged cells were compared to further establish that these conditions were appropriate to study the S. aureus acid-shock response.

An analysis of genes that exhibited ≥ 2-fold change in expression between experimental conditions revealed that adjusting the pH to 4.0 for 30 min produced a response expected of acid-shocked S. aureus (Figure 1A; Table 2). A total of fifty-eight genes were significantly induced (≥ 2-fold; P = 0.05) in response to the acid-shock conditions used in this study (Table 2). Of these, twenty-five mRNA species (43%) were previously identified acid-shock inducible genes and included factors proposed to be involved in acid-neutralization, transport, and increasing the organism’s reducing power (Bore et al. 2007). Among this list were the urease genes ureA and ureB, which were upregulated 13.4- and 11.6-fold, respectively, in response to low pH growth conditions and are thought to promote acid neutralization. Other components of the urease operon (ureC, ureD, and ureF) were also up-regulated but were not considered to be significantly differentially expressed. Four previously identified acid-shock inducible transport proteins (SACOL2347, SACOL0086, SACOL2356, and SACOL2357) were also determined to be up-regulated between 3.9- and 27.7-fold in the current study. Likewise, members of the energy production machinery were up-regulated SACOL2534 (2.7-fold), SACOL0409 (3.1-fold), SACOL0874 (2.2-fold), SACOL0162 (3.8-fold), SACOL0410 (4.2-fold) and SACOL2594 (2.8-fold), presumably allowing for increased reducing power. Moreover, genes involved in converting acetate to ethanol alsD (SACOL2198; 9.7-fold) and alsS (SACOL2199; 15.8-fold), which would ostensibly raise the intracellular pH, were induced in response to acid stress. Likewise, acetoin reductase (SACOL0111), which catalyzes production of the neutral product 2,3-butanediol from acetoin and would promote a rise in pH was induced (7-fold). The majority of genes that were found to be up-regulated in the current study, but not previously defined as members of the acid-shock response represent hypothetical open reading frames (18 in total; Table 2).

Figure 1. Transcriptional Response to Acid- or Alkaline-shock conditions.

Shown are the number of genes predicted to participate in the indicated biological process (X-axis) that exhibit increased (Red; Induced) or decreased (Blue; Repressed) transcript titers in response to acid-shock (Panel A) or alkaline-shock conditions (Panel B).

Table 2.

Genes up-regulated in acid-shocked cells.

Category and qualifier	Fold induction	mRNA half-life (min)		Gene	Locus†	Description
		pH 7.2	pH 4
Amino acid transport and metabolism
sa_c4765s4076_a_at	15.8	ND	30	budB	SA2199	acetolactate synthase
sa_c5023s4322_at*	13.4	15	30	ureA	SA2280	urease subunit gamma
sa_c5029s4326_a_at*	11.6	15	30	ureB	SA2281	urease subunit beta
sa_c839s639_a_at	3.9	2.5	30		SA0085	M20/M25/M40 family peptidase
sa_c5373s4646_a_at*	3.6	2.5	stable		SA1915	amino acid ABC transporter
sa_c3655s3137_a_at*	2.5	5	stable		SA1916	amino acid ABC transporter, permease
Carbohydrate transport and metabolism
sa_c5644s4894_a_at	14.7	2.5	stable	gpm	SA2415	phosphoglycerate mutase
sa_c7036s9080_a_at	6.3	2.5	30		SA0408	glyoxalase family protein
sa_c6058s5252_a_at	3.3	2.5	30		SA2533	glyoxalase family protein
sa_c10529s9046_a_at	3.7	2.5	2.5		SA2590	glyoxalase family protein
Inorganic ion transport and metabolism
sa_c6180s5357_a_at	6.8	ND	30	feoB	SA2564	ferrous iron transport protein B
Energy production and conversion
sa_c6062s5256_a_at	2.7	15	stable	frp	SA2534	NAD(P)H-flavin oxidoreductase
sa_c9528s8308_a_at	7.0	5	30		SA0111	acetoin reductase
sa_c10345s9018_a_at	3.8	ND	5		SA0162	formate dehydrogenase
sa_c7041s6150_a_at	3.1	2.5	30		SA0409	hypothetical protein
sa_c7043s6153_a_at	4.2	ND	30		SA0410	FMN reductase-related protein
sa_c8493s7455_a_at	2.2	2.5	2.5		SA0874	nitroreductase family protein
sa_c6293s5471_a_at	2.8	2.5	30		SA2594	short chain dehydrogenase
Secondary metabolites biosynthesis, transport and catabolism
sa_c4757s4072_at	9.7	ND	stable	budA1	SA2198	alpha-acetolactate decarboxylase
Transport
sa_c875s677_a_at	3.9	2.5	stable		SA0086	putative drug transporter
sa_c5303s4583_a_at	18.9	ND	stable		SA2356	ABC transporter, ATP-binding protein
sa_c5307s4587_at	27.7	ND	stable		SA2357	ABC transporter, permease protein
sa_c5640s9379_a_at	7.6	ND	2.5		N315-SA2203	hypothetical protein
Transcription
sa_c4939s4249_a_at	2.6	2.5	2.5	sarV	SA2258	staphylococcal accessory regulator V
sa_c3732s3210_a_at	2.5	2.5	30	vraR	SA1942	DNA-binding response regulator
sa_c441s275_a_at*	3.7	5	30		SA2593	transcriptional regulator, TetR family
sa_c6285s5463_a_at*	3.1	2.5	2.5		SA2591	hypothetical protein
Translation
sa_c8966s7880_a_at	5.3	2.5	30		SA0815	ribosomal subunit interface protein
Posttranslational modification
sa_c278s123_a_at	3.6	2.5	30	clpB	SA0979	ATP-dependent Clp protease, ATP-binding subunit
Cell wall and membrane biogenesis
sa_c1825s9344_a_at	10.0	2.5	30		SA0119	cell wall surface anchor family protein
sa_c6575s5743_a_at*	5.3	2.5	2.5		SA2668	LPXTG cell wall surface anchor family
Cell division
sa_c6135s5319_a_at	22.7	ND	2.5		SA2554	LrgA family protein
Resistance
sa_c342s182_a_at	6.0	2.5	2.5		SA2347	EmrB/QacA family drug resistance transporter
Virulence
sa_c7169s10140_a_at	7.5	2.5	2.5		SA0901	pathogenicity island protein
sa_c10151s10571_a_at	2.6	2.5	30		SA0902	pathogenicity island protein
sa_c10150s10567_a_at	2.8	2.5	30		SA0903	pathogenicity island protein
sa_c7177s10148_a_at	3.1	ND	2.5		SA0905	pathogenicity island protein
Phage
sa_c7182s10152cs_s_at*	2.6	2.5	30		SA2014	phage terminase family protein
Unkown function
sa_c2968s2524_a_at	3.3	ND	2.5		SA0156	hypothetical protein
sa_c3224s2774_a_at	7.8	2.5	2.5		SA0161	hypothetical protein
sa_c6700s5841_a_at	2.1	2.5	2.5		SA0259	hypothetical protein
sa_c7203s6269_a_at	6.5	ND	2.5		SA0445	hypothetical protein
sa_c7760s6763_at*	23.5	15	30		SA0625	hypothetical protein
sa_c8897s7814_a_at	6.5	ND	2.5		SA0692	hypothetical protein
sa_c629s448_at	3.9	2.5	30		SA1071	hypothetical protein
sa_c1960s1685_a_at	9.8	2.5	2.5		SA1438	hypothetical protein
sa_c2144s1843_a_at	2.3	2.5	2.5		SA1491	hypothetical protein
sa_c2942s2505_a_at*	10.6	2.5	2.5		SA1705	hypothetical protein
sa_c9309s8152_at	6.0	2.5	2.5		SA2315	hypothetical protein
sa_c6182s5363_at	38.1	ND	2.5		SA2565	FeoA domain-containing protein
sa_c6206s5387_a_at*	126.3	ND	2.5		SA2571	hypothetical protein
sa_c6289s5467_a_at	5.7	ND	2.5		SA2592	hypothetical protein
sa_c259s100_a_at	2.6	2.5	30		SA2596	hypothetical protein
sa_c6345s5512_a_at	2.6	15	stable		SA2609	hypothetical protein
sa_c6499s10083_at	3.1	ND	15		SA2649	conserved hypothetical protein
sa_c6147s5329_at	3.0	ND	30		N315-SA2331	hypothetical protein
sa_c6176s10079cs_s_at	5.4	ND	2.5		N315-SAS088	hypothetical protein
sa_c2938s2500_at	4.9	2.5	2.5		MW1600	hypothetical protein

^*Functional category and GeneChip^® qualifier indicated.

^†S. aureus strain COL locus unless otherwise indicated.

Acid-shock conditions decreased the transcript titers of 438 mRNA species (Table 2), 173 of which (39.5 %) were previously determined to be down-regulated in response to sudden acid shock (Bore et al. 2007). Most decreased gene products are predicted to be involved in nucleotide biosynthesis, amino acid metabolism, and translation (Figure 1A; Table 2), suggesting that gross alterations in cell metabolism contribute to the organism’s adaptation to low pH conditions, as previously reported (Bore et al. 2007). Nonetheless, we also considered the possibility that although 30 min exposure to pH 4.0 does not result in an immediate loss of S. aureus viability (data not shown), the observed decrease in the transcript titers of genes belonging to essential biological processes may reflect a change in cellular metabolism that precedes bacterial death. Meaning, the mass down regulation of these essential processes could be an experimental artifact corresponding to S. aureus undergoing the early stages of death as opposed to eliciting a response that promotes the organism’s adaptation to acidic conditions. To distinguish between these possibilities, S. aureus cell viability measurements were extended over a course of 6 hr in medium maintained at pH 7.4 or pH 4.0. As shown in Figure 2A, while S. aureus growth increased approximately 100-fold at neutral pH, viable cell numbers remained constant during extended growth at pH 4.0. These data indicate that the aforementioned down-regulation of translation machinery, nucleotide biosynthesis and amino acid metabolism factors contributes to cellular adaptation to low pH, as opposed to reflecting the inception of cell death. Similar to Bore and colleagues, we also observed that gene transcripts involved in proton motive force (F0F1ATPase; 8 genes) were reduced between 2.5 to 4.2-fold (Bore et al. 2007). It was also found that the transcript abundance of Na⁺/H⁺ antiporter coding genes mnhDEFG were decreased between 2.9 to 4-fold in response to acid shock, which is expected to aid in raising the intracellular pH as proton import would be reduced.

Figure 2. Growth Characteristics of S. aureus in Neutral, Acidic and Alkaline Medium.

Plotted are the numbers of viable colony forming units (CFUs) per milliliter of exponential phase S. aureus following growth for 6 hours after adjusting the medium to pH of 7.4 (diamonds), pH 4.0 (squares) or pH 10.0 (circles). Panel A shows growth properties of wild type S. aureus UAMS-1 cells. Panel B shows growth properties of isogenic capsule mutant cells. Standard deviation is indicated.

Sudden acid-shock affected the expression of more putative virulence factors than previously appreciated; presumably, this reflects differences in genomic content of the strains investigated. More specifically, while the pathogenicity island gene SACOL0902 is a recognized acid-shock inducible factor, our work revealed that adjacent genes (SACOL0901 and SACOL0903) were also induced 7.9- and 2.8-fold, respectively, in response to low pH (Bore et al. 2007). The putative virulence factor, SACOL2668 (containing the LPXTG motif), was also found to be up-regulated in the present study. Fifteen virulence factors were determined to exhibit lower transcript titers in response to acid-shock conditions, including seven known members of the acid-shock response: phospholipase C (hlb, 2.4-fold), immunodominant antigen A (isaA, 2.9-fold), fibronectin-binding protein A (fnbA, 11.4-fold), staphyloxanthin biosynthesis protein (SACOL2291, 13.4-fold and SACOL2581, 3.8-fold), IgG-binding protein SBI (SACOL2418; 18.3-fold), and fibrinogen binding-related protein (SACOL1164, 7.4-fold) (Bore et al. 2007). Our study also revealed five additional well-characterized virulence factors to be down-regulated in response to acid-shock conditions: chemotaxis-inhibiting protein CHIPS (chp, 10.3-fold), clumping factor B (clfB, 8.1-fold), fibrinogen-binding protein (efb; 6.3-fold), staphylokinase precursor (sak, 4.7-fold) and protein A (spa, 2.3-fold). Consistent with previous reports, we observed that the two-component signal transduction system SaeRS (saeR, 4.5-fold and saeS, 3-fold), which controls expression of many virulence factors, was decreased in response to acid stress (Weinrick et al. 2004; Bore et al. 2007). However, we also observed that three previously unrecognized acid-responsive virulence factor regulators were also down-regulated: LytSR (lytS, 4.4-fold and lytR, 6.8-fold), ArlSR (arlS, 2.9-fold), and GdpS (SACOL0809; 4-fold) (Bronner et al. 2004; Shang et al. 2009).

Collectively, these results verify that the conditions used effectively induce the S. aureus acid-shock response and extend previous reports suggesting that response induction results in a physiological state that is recalcitrant to acidification; the organism up-regulates acid-neutralization processes and gene products that may increase its reducing power while simultaneously reducing macromolecular processes and systems that influx H⁺.

Alkaline Shock Response

To define conditions appropriate for characterizing the S. aureus alkaline shock response we used a combination of cell viability and quantitative RT-PCR approaches to assess the organism’s tolerance of alkali stress and to determine whether these conditions induced expression of the known sigma B regulated alkaline-shock gene, alkaline shock protein 23 [asp23; (Kuroda et al. 1995)]. The organism’s tolerance of alkaline conditions was measured by adjusting the pH of exponential-phase S. aureus UAMS-1 cells to 8.0, 9.0, or 10.0 for 30 min and monitoring cell viability. None of these conditions affected S. aureus’ ability to survive brief exposure to high pH (data not shown). Quantitative RT-PCR was performed to compare the transcript titers of asp23 at elevated pH to that of mock treated cells (pH 7.2). While adjusting the pH to 8.0 or 9.0 did not appreciably affect asp23 expression, 30 min exposure to pH 10.0 induced asp23 transcript titers (2.8-fold; data not shown), suggesting that these conditions were appropriate for studying the organism’s alkaline-shock response. Accordingly, the pH of exponential phase UAMS-1 cells was adjusted to pH 10.0 for 30 min and transcript titers of alkaline-shocked S. aureus were compared to mock treated cells by GeneChip^® analysis. As shown in Figure 1B., transient exposure of exponential phase S. aureus to alkaline conditions (pH 10.0 for 30 min) resulted in a striking reduction in messenger RNA titers constituting roughly a third of the organism’s transcriptome. A survey of the 773 alkaline-shock decreased transcripts (Figure 1B, Table 4) indicated that the major functional categories of genes are predicted to be involved in nucleotide biosynthesis, amino acid metabolism, and translation. These same systems were found to be lowered during acid-shock conditions, suggesting that gross alterations in cell metabolism are a generalized response to extreme pH stress. To ensure that diminished expression of these essential biological processes is a function of cellular adaptation to high pH, as opposed to a bacterial cell death phenotype, the cell viability of cultures exposed to prolonged elevated pH was monitored (pH 10.0 for 6 hr). As shown in Figure 2A, as was the case for growth at low pH, viable cell numbers remained constant during extended growth at pH 10.0, suggesting that the aforementioned down-regulation of translation machinery, nucleotide biosynthesis and amino acid metabolism factors contributes to cellular adaptation, as opposed to being an artifact of the initiation of cell death.

Table 4.

Genes down-regulated in acid-shocked cells.

Category and qualifier*	Fold reduction	mRNA half-life (min)		Gene	Locus†	Description
		pH 7.2	pH 4
Amino acid transport and metabolism
sa_c2759s2334_a_at*	4.5	2.5	30	aroE	SA1652	shikimate 5-dehydrogenase
sa_c9420s8234_a_at*	3.7	2.5	2.5	betA	SA2627	choline dehydrogenase
sa_c3567s9159_a_at	4.6	2.5	ND	brnQ1	SA0171	branched-chain amino acid transport system II carrier protein
sa_c1974s1697_a_at	5.9	2.5	2.5	brnQ3	SA1443	branched-chain amino acid transport system II carrier protein
sa_c1159s942_a_at	7.3	2.5	ND	carA	SA1214	carbamoyl-phosphate synthase, small subunit
sa_c1165s946_a_at	8.5	5	30	carB	SA1215	carbamoyl-phosphate synthase, large subunit
sa_c7368s9209_a_at*	4.3	2.5	2.5	cysM	SA0502	cysteine synthase/cystathionine beta-synthase family protein
sa_c5246s4544_a_at*	7.2	2.5	15	gltS	SA2340	sodium:glutamate symporter
sa_c1139s920_a_at*	6.5	2.5	2.5	IspA	SA1208	lipoprotein signal peptidase
sa_c10721s11169cv_s_at*	7.8	2.5	2.5	metB	N315-SA0419	cystathionine gamma-synthase
sa_c7100s6210_a_at	3.0	2.5	30	metE	SA0428	homocysteine methyltransferase
sa_c3445s9086_a_at*	8.3	2.5	15	metK	SA1837	S-adenosylmethionine synthetase
sa_c6092s5283_a_at*	2.7	2.5	2.5	sdaAB	SA2545	L-serine dehydratase, beta subunit
sa_c3834s3303_a_at	4.2	15	2.5	sspB	SA1970	cysteine protease precursor
sa_c7372s10188cs_s_at	5.2	2.5	15		SA0503	trans-sulfuration enzyme family
sa_c7431s6453_a_at*	4.4	2.5	2.5		SA0519	acetyltransferase
sa_c8536s7494_a_at	3.5	5	30		SA0916	cysteine desulfurase
sa_c574s400_a_at	2.3	2.5	2.5		SA1058	aminotransferase, class I
sa_c5349s4625_a_at*	11.7	2.5	2.5		SA1108	spermidine/putrescine ABC transporter, ATP-binding protein
sa_c9028s7925_a_at*	6.8	2.5	2.5		SA1109	spermidine/putrescine ABC transporter, permease protein
sa_c795s596_a_at*	9.9	2.5	2.5		SA1110	spermidine/putrescine ABC transporter, permease protein
sa_c803s604_a_at*	11.4	2.5	2.5		SA1111	spermidine/putrescine transporter
sa_c1215s998_a_at*	4.9	2.5	30		SA1231	protein phosphatase
sa_c10578s11035_s_at*	4.1	2.5	stable		SA1232	protein kinase
sa_c1431s1205_a_at	4.4	2.5	30		SA1298	M16 family peptidase
sa_c1675s1413_a_at	5.0	2.5	2.5		SA1367	amino acid permease
sa_c1778s9167_a_at	4.4	2.5	30		SA1392	sodium:alanine symporter family
sa_c1934s1655_a_at	2.5	2.5	30		SA1433	M20/M25/M40 family peptidase
sa_c10579s11036cv_s_at	5.5	2.5	2.5		SA1454	Hypothetical protein
sa_c2910s2472_a_at*	5.0	2.5	2.5		SA1698	hypothetical protein
sa_c3178s2725_a_at*	3.2	2.5	ND		SA1765	aminotransferase, class V
sa_c4460s3803_a_at*	5.8	2.5	15		SA2109	modification methylase
sa_c5126s4423_a_at*	7.3	2.5	15		SA2309	amino acid permease
sa_c5638s4893_a_at	6.6	2.5	30		SA2412	amino acid ABC transporter,
sa_c5835s5075_a_at	3.8	2.5	ND		SA2472	peptide ABC transporter
sa_c5837s5079_a_at	2.2	2.5	2.5		SA2473	peptide ABC transporter
sa_c9357s8184_a_at	2.5	2.5	ND		SA2474	peptide ABC transporter
sa_c5847s5088_a_at	2.4	2.5	ND		SA2476	peptide ABC transporter
sa_c6082s5268_a_at	5.3	2.5	2.5		SA2541	acetyltransferase
sa_c6378s5547_a_at	2.1	2.5	ND		SA2619	amino acid permease
Carbohydrate transport and metabolism
sa_c6411s5581_a_at	3.9	2.5	30	bglA	SA0251	6-phospho-beta-glucosidase
sa_c8986s7896_a_at	2.9	15	stable	gapA	SA0838	glyceraldehyde 3-phosphate dehydrogenase
sa_c7032s9332_a_at*	5.4	2.5	stable	glpT	SA0407	glycerol-3-phosphate transporter
sa_c9250s8097_a_at	2.2	2.5	stable	pflB	SA0204	formate acetyltransferase
sa_c8390s7366_a_at	3.0	15	30	pgk	SA0839	phosphoglycerate kinase
sa_c853s654_a_at	10.4	2.5	15	pyc	SA1123	pyruvate carboxylase
sa_c8397s7370_a_at*	2.7	15	stable	tpiA	SA0840	triosephosphate isomerase
sa_c3742s3217_a_at*	6.7	5	stable		SA0175	PTS system, IIABC components
sa_c6381s5549_a_at	2.2	2.5	ND		SA0250	PTS system, IIA component
sa_c7422s6445_a_at*	5.0	2.5	2.5		SA0517	alpha-amylase family protein
sa_c3212s2761_a_at*	5.2	2.5	stable		SA1775	PTS system, IIBC components
sa_c3661s3140_a_at	6.2	2.5	2.5		SA1917	PTS system, IIC component
sa_c4910s4214_a_at	6.1	15	2.5		SA2246	putative sugar transporter
sa_c5504s9245_a_at*	4.0	2.5	2.5		SA2376	putative PTS system, sucrose-specific IIBC components
sa_c6096s5287_a_at*	3.0	2.5	30		SA2546	putative perfringolysin O regulator
sa_c6123s5305_a_at*	6.1	2.5	2.5		SA2552	PTS system, IIABC components
Inorganic ion transport and metabolism
sa_c7931s6914_a_at*	3.5	2.5	ND	mnhD	SA0682	putative Na+/H+ antiporter
sa_c8887s7802_a_at*	3.6	2.5	2.5	mnhE	SA0684	putative Na+/H+ antiporter
sa_c7937s6924_at*	2.9	2.5	ND	mnhF	SA0685	putative Na+/H+ antiporter
sa_c7941s6928_a_at*	4.0	2.5	ND	mnhG	SA0686	putative Na+/H+ antiporter
sa_c4989s4292_a_at*	2.0	2.5	30	modC	SA2270	molybdenum ABC transporter
sa_c1739s1473_a_at	3.0	2.5	2.5	mscL	SA1383	mechanosensitive channel protein
sa_c5070s4366_a_at	5.4	2.5	ND	nhaC	SA2292	Na+/H+ antiporter
sa_c904s700_a_at	25.1	2.5	2.5		SA0088	Na/Pi cotransporter family
sa_c7236s6302_a_at	4.7	2.5	stable		SA0454	sodium:dicarboxylate symporter
sa_c7333s6374_a_at*	2.6	15	2.5		SA0491	putative cobalamin synthesis
sa_c7365s6401_a_at	3.5	2.5	2.5		SA0501	sodium-dependent transporter
sa_c7475s6499_a_at*	3.5	2.5	15		SA0531	tetrapyrrole methylase family
sa_c7871s6863_a_at*	7.2	2.5	stable		SA0665	putative iron compound ABC transporter
sa_c8909s7826_a_at*	6.0	2.5	15		SA0722	phosphate transporter family
sa_c8633s7584_a_at	3.1	2.5	15		SA0946	Na+/H+ antiporter family protein
sa_c9037s7935_a_at	8.0	2.5	2.5		SA1096	TrkA potassium uptake family
sa_c3767s3239_at	6.1	2.5	stable		SA1952	ferritins family protein
sa_c5013s4315_a_at	2.2	2.5	2.5		SA2277	iron compound ABC transporter
sa_c5160s4458_a_at*	7.1	2.5	2.5		SA2319	Na+/H+ antiporter family
sa_c5522s4780_a_at*	5.9	2.5	15		SA2382	proton/sodium-glutamate symport
sa_c5534s4791_a_at*	5.8	2.5	ND		SA2386	nitrite extrusion protein
sa_c5739s4980_a_at	3.9	2.5	2.5		SA2442	putative Na+/H+ antiporter
sa_c10690s11140_s_at*	2.7	2.5	30		SA2718	anion transporter family protein
Lipid transport and metabolism
sa_c9605s8367_a_at*	6.6	2.5	15	cdsA	SA1280	phosphatidate cytidylyltransferase
sa_c1260s1035_a_at*	5.4	2.5	30	fabD	SA1244	malonyl CoA-acyl transacylase
sa_c318s157_a_at*	2.7	2.5	30	fabF	SA0988	acyl-carrier-protein synthase II
sa_c4695s4014_a_at	5.8	2.5	2.5		SA0207	hypothetical protein
sa_c6975s6099_a_at	6.3	2.5	2.5		SA0317	lipase precursor
sa_c10609s11066_s_at	3.3	2.5	ND		SA0390	lipase precursor
sa_c1242s1022_a_at*	4.3	2.5	15		SA1240	DAK2 domain protein
Nucleotide transport and metabolism
sa_c4816s4124_at*	2.8	15	stable	adk	SA2218	adenylate kinase
sa_c2883s2448_at*	3.5	2.5	15	apt	SA1690	adenine phosphoribosyltransferase
sa_c9216s8076_a_at*	6.3	2.5	30	guaB	SA0460	inosine-5-monophosphate dehydrogenase
sa_c1697s1432_a_at*	5.5	2.5	stable	guaC	SA1371	guanosine 5′-monophosphate oxidoreductase
sa_c7543s6563_at*	6.2	2.5	2.5	hpt	SA0554	hypoxanthine phosphoribosyltransferase
sa_c8803s7743_a_at*	8.0	2.5	2.5	nupC	SA0566	nucleoside permease NupC
sa_c7261s6323_a_at	14.4	2.5	30	pbuX	SA0459	xanthine permease
sa_c9157s8026_a_at*	3.6	2.5	30	prsA	SA0544	ribose-phosphate pyrophosphokinase
sa_c65s61_a_at*	10.2	2.5	2.5	purA	SA0018	adenylosuccinate synthetase
sa_c660s471_at	4.0	2.5	ND	purC	SA1075	phosphoribosylaminoimidazole-succinocarboxamide synthase
sa_c652s462_a_at	3.0	2.5	ND	purE	SA1073	phosphoribosylaminoimidazole carboxylase, catalytic subunit
sa_c678s484_a_at	3.3	2.5	ND	purF	SA1079	amidophosphoribosyltransferase
sa_c658s466_a_at	3.8	2.5	2.5	purK	SA1074	phosphoribosylaminoimidazole carboxylase, ATPase subunit
sa_c674s480_a_at	2.8	2.5	ND	purL	SA1078	phosphoribosylformylglycinamidine synthase II
sa_c680s488_a_at	3.5	2.5	ND	purM	SA1080	phosphoribosylformylglycinamidine cyclo-ligase
sa_c686s494_a_at	4.2	2.5	2.5	purN	SA1081	phosphoribosylglycinamide formyltransferase
sa_c9991s8687_a_at	6.6	2.5	ND	pyrB	SA1212	aspartate carbamoyltransferase catalytic subunit
sa_c1155s937_a_at*	9.7	2.5	30	pyrC	SA1213	dihydroorotase
sa_c6327s5497_a_at*	11.7	2.5	2.5	pyrD	SA2606	dihydroorotate dehydrogenase 2
sa_c9989s8682_a_at	4.1	5	2.5	pyrE	SA1217	orotate phosphoribosyltransferase
sa_c1167s950_a_at*	6.6	5	15	pyrF	SA1216	orotidine 5-phosphate decarboxylase
sa_c1147s928_a_at*	8.2	2.5	2.5	pyrR	SA1210	pyrimidine regulatory protein PyR
sa_c9220s8080_a_at	5.5	2.5	stable	quaA	SA0461	bifunctional GMP synthase/glutamine amidotransferase protein
sa_c9829s8568_a_at*	5.2	2.5	2.5	tdk	SA2111	thymidine kinase
sa_c9569s8332_a_at*	3.7	2.5	30	udk	SA1666	uridine kinase
sa_c4446s3792_a_at*	2.5	15	2.5	upp	SA2104	uracil phosphoribosyltransferase
sa_c1151s932_a_at*	4.8	2.5	ND	uraA	SA1211	uracil permease
sa_c7257s6317_a_at	13.7	2.5	15	xpt	SA0458	xanthine phosphoribosyltransferase
sa_c83s9423_s_at	4.6	2.5	stable		SA0024	5-nucleotidase family protein
sa_c6934s6055_a_at	3.1	15	stable		SA0303	5′-nucleotidase/nucleotide metab
sa_c7681s6690_a_at*	5.0	2.5	2.5		SA0604	deoxynucleoside kinase family
sa_c7977s6963_a_at	7.6	2.5	2.5		SA0701	putative nucleoside permease
sa_c3326s2869_a_at	4.7	2.5	2.5		SA1803	pseudouridine synthase family 1
sa_c4896s4204_a_at*	4.7	2.5	2.5 15		SA2242	xanthine/uracil permease family
Energy production and conversion
sa_c4418s3765_a_at*	3.2	15	30	atpA	SA2097	F0F1 ATP synthase subunit beta
sa_c4434s3779_a_at*	4.2	15	30	atpB	SA2101	F0F1 ATP synthase subunit A
sa_c9843s8585_at*	2.5	15	stable	atpC	SA2094	F0F1 ATP synthase subunit epsilon
sa_c9839s8581_a_at*	3.0	15	stable	atpD	SA2095	F0F1 ATP synthase subunit β
sa_c4430s3777_at*	3.3	15	stable	atpE	SA2100	F0F1 ATP synthase subunit C
sa_c4426s3773_a_at*	3.5	15	30	atpF	SA2099	F0F1 ATP synthase subunit B
sa_c4414s3760_at*	3.3	15	stable	atpG	SA2096	F0F1 ATP synthase subunit γ
sa_c4422s3769_a_at*	3.1	15	30	atpH	SA2098	F0F1 ATP synthase subunit δ
sa_c6417s5584_a_at*	2.9	2.5	30	betB	SA2628	betaine aldehyde dehydrogenase
sa_c736s544_a_at	22.7	2.5	15	cydA	SA1094	cytochrome d ubiquinol oxidase, subunit I
sa_c740s548_a_at	29.2	2.5	30	cydB	SA1095	cytochrome d ubiquinol oxidase, subunit II
sa_c5235s4535_a_at	2.7	2.5	30	ldh	SA0222	L-lactate dehydrogenase
sa_c5574s4827_a_at*	3.5	2.5	ND	narG	SA2395	respiratory nitrate reductase, α
sa_c5570s4822_a_at*	2.8	2.5	ND	narH	SA2394	respiratory nitrate reductase, β
sa_c5564s4818_a_at*	3.3	5	ND	narJ	SA2393	respiratory nitrate reductase, δ
sa_c5584s4840_a_at	2.6	2.5	ND	nirB	SA2398	nitrite reductase [NAD(P)H], large subunit
sa_c623s446_a_at*	3.3	30	stable	qoxA	SA1069	quinol oxidase, subunit I
sa_c9054s7945_a_at*	3.1	30	stable	qoxB	SA1070	quinol oxidase, subunit II
sa_c619s442_at*	2.6	15	stable	qoxC	SA1068	quinol oxidase, subunit III
sa_c3158s2704_a_at	2.7	2.5	15		SA0160	hypothetical protein
sa_c6985s6107_a_at*	4.3	2.5	2.5		SA0392	NADH-dependent flavin oxidoreductase
sa_c8540s7497_at	3.2	5	stable		SA0917	NifU domain-containing protein
sa_c2220s1920_a_at*	4.7	2.5	30		SA1514	glycerol-3-phosphate dehydrogenase
sa_c5074s4372_a_at	7.1	2.5	2.5		SA2293	NAD/NADP octopine/nopaline dehydrogenase family protein
Transport
sa_c6427s5598_a_at	3.8	2.5	15	cudT	SA2632	osmoprotectant transporter
sa_c10649s11102cv_s_at	5.9	2.5	2.5	opuD1	SA1384	osmoprotectant transporter
sa_c3118s2672_a_at*	2.1	2.5	2.5		SA0159	ABC transporter
sa_c5333s4606_a_at	3.5	2.5	stable		SA0264	ABC transporter
sa_c5387s4658_a_at*	2.4	2.5	30		SA0422	ABC transporter
sa_c5431s4700_a_at	2.8	2.5	30		SA0882	ABC transporter
sa_c8512s7471_a_at	4.7	2.5	ND		SA0883	ABC transporter
sa_c8518s7475_a_at	2.8	2.5	30		SA0884	ABC transporter
sa_c1908s1632_a_at*	7.3	2.5	30		SA1427	ABC transporter
sa_c2626s2200_a_at*	3.9	2.5	2.5		SA1612	ABC transporter
sa_c2630s2204_a_at	5.2	2.5	2.5		SA1613	ABC transporter
sa_c5227s4529_a_at	5.6	2.5	2.5		SA2335	ABC transporter
sa_c5608s4864_a_at	3.9	2.5	2.5		SA2403	ABC transporter
sa_c5801s5043_a_at*	2.6	2.5	30		SA2460	putative drug transporter
sa_c6017s5213_a_at*	4.4	2.5	15		SA2521	putative transporter
sa_c5345s4618_a_at*	7.4	2.5	2.5		SA2525	ABC transporter
sa_c6186s5364_a_at*	2.2	2.5	2.5		SA2566	putative MmpL efflux pump
sa_c3043s2596_a_at*	2.1	2.5	ND		SACOL0158	ABC transporter
Coenzyme transport and metabolism
sa_c2753s2324_a_at*	3.2	2.5	30	nadD	SA1650	nicotinate (nicotinamide) nucleotide adenylyltransferase
sa_c3173s2721_a_at*	5.5	2.5	30	thiI	SA1764	thiamine biosynthesis protein ThiI
sa_c8256s7233_at*	3.3	2.5	stable		SA0789	7-cyano-7-deazaguanine reductase
sa_c2711s2285_a_at*	3.1	2.5	2.5		SA1640	coproporphyrinogen III oxidase
Transcription
sa_c6194s5372_a_at*	6.8	2.5	15	lytR	SA0246	response regulator
sa_c1384s1156_a_at*	4.3	2.5	30	nusA	SA1285	transcription elongation factor
sa_c7637s6652_a_at*	2.8	15	stable	ropC	SA0589	RNA polymerase, β
sa_c4796s4102_at*	2.7	15	stable	rpoA	SA2213	RNA polymerase, α
sa_c7633s6648_a_at*	3.3	5	stable	rpoB	SA0588	RNA polymerase, β
sa_c2650s2225_a_at*	3.5	2.5	15	rpoD	SA1618	RNA polymerase sigma factor
sa_c8190s7169_at	4.5	2.5	2.5	saeR	SA0766	response regulator
sa_c5056s4355_a_at	4.9	2.5	ND	sarY	SA2289	staphylococcal accessory regulator Y
sa_c5529s4783_a_at	6.0	2.5	ND	sarZ	SA2384	staphylococcal accessory protein Z
sa_c1214s994_a_at*	5.8	2.5	15	sun	SA1229	Sun protein
sa_c10502s10951cv_s_at*	2.8	2.5	2.5	tcaR	SA2353	transcriptional regulator
sa_c791s594_at*	8.1	2.5	stable		SA1107	transcriptional regulator
sa_c3623s3103_a_at*	8.7	2.5	2.5		SA1904	putative transcriptional regulator
sa_c446s279_a_at*	4.6	2.5	2.5		SA2290	transcriptional regulator
sa_c6509s5677_a_at*	3.3	2.5	30		SA2653	transcriptional regulator
Translation
sa_c7865s6854_a_at*	3.6	2.5	15	argS	SA0663	arginyl-tRNA synthetase
sa_c9153s8021_a_at	3.5	2.5	30	cbf1	SA1898	3′-5′ exoribonuclease YhaM,
sa_c1203s985_a_at*	4.7	2.5	2.5	def2	SA1227	polypeptide deformylase
sa_c1207s989_a_at*	4.7	2.5	2.5	fmt	SA1228	methionyl-tRNA formyltransferase
sa_c1362s1136_a_at*	4.7	2.5	30	frr	SA1278	ribosome recycling factor
sa_c8835s7770_a_at*	2.5	15	stable	fusA	SA0593	elongation factor G
sa_c1346s1119_a_at	5.9	2.5	30	gid	SA1268	tRNA (uracil-5-)-methyltransferase
sa_c9653s8413_a_at	5.2	2.5	30	glyS	SA1622	glycyl-tRNA synthetase
sa_c4812s4120_at*	2.3	15	stable	infA	SA2217	translation initiation factor IF-1
sa_c1394s1169_a_at*	3.5	2.5	30	infB	SA1288	translation initiation factor IF-2
sa_c3036s2591_a_at	4.4	2.5	2.5	infC	SA1727	translation initiation factor IF-3
sa_c1410s1184_a_at*	5.3	2.5	30	pnp	SA1293	polynucleotide phosphorylase/polyadenylase
sa_c4462s3807_at*	9.2	2.5	2.5	prfA	SA2110	peptide chain release factor 1
sa_c469s298_a_at	3.9	2.5	15	prfC	SA1025	peptide chain release factor 3
sa_c10084s8804_a_at*	3.7	5	30	queA	SA1695	S-adenosylmethionine:tRNA ribosyltransferase-isomerase
sa_c1316s1090_a_at*	3.8	2.5	2.5	rbgA	SA1260	ribosomal biogenesis GTPase
sa_c1294s1067_a_at*	5.3	2.5	2.5	rimM	SA1255	16S rRNA processing protein
sa_c6841s5976_a_at	3.9	2.5	2.5	rnpA	SA2739	ribonuclease P protein
sa_c7620s6631_a_at*	4.3	15	stable	rplA	SA0584	50S ribosomal protein L1
sa_c9959s8654_a_at*	3.4	15	stable	rplB	SA2236	50S ribosomal protein L2
sa_c4888s4195_a_at*	3.1	5	stable	rplC	SA2239	50S ribosomal protein L3
sa_c4880s4187_at	4.0	5	30	rplD	SA2238	50S ribosomal protein L4
sa_c4848s4156_at*	2.8	15	stable	rplE	SA2227	50S ribosomal protein L5
sa_c9951s8647_at*	2.8	15	stable	rplF	SA2224	50S ribosomal protein L6
sa_c7621s6634_a_at*	3.1	5	stable	rplJ	SA0585	50S ribosomal protein L10
sa_c8818s7755_a_at*	2.8	15	stable	rplK	SA0583	50S ribosomal protein 11
sa_c7625s6638_at*	3.8	2.5	stable	rplL	SA0586	50S ribosomal protein L7/L12
sa_c9943s8640_a_at*	2.7	2.5	30	rplM	SA2207	50S ribosomal protein L13
sa_c9955s8651_a_at*	2.8	15	stable	rplN	SA2229	50S ribosomal protein L14
sa_c4824s4130_a_at*	2.7	15	stable	rplO	SA2220	50S ribosomal protein L15
sa_c4864s4170_at*	2.7	15	stable	rplP	SA2232	50S ribosomal protein L16
sa_c4792s4098_at*	2.3	15	stable	rplQ	SA2212	50S ribosomal protein L17
sa_c4836s4142_at*	2.4	15	stable	rplR	SA2223	50S ribosomal protein L18
sa_c1302s1077_a_at*	2.8	15	stable	rplS	SA1257	50S ribosomal protein L19
sa_c3028s2585_at*	3.9	2.5	2.5	rplT	SA1725	50S ribosomal protein L20
sa_c2926s2487_at*	3.2	5	30	rplU	SA1702	50S ribosomal protein L21
sa_c4872s4181_at*	2.6	15	stable	rplV	SA2234	50S ribosomal protein L22
sa_c10192s8875_a_at	3.7	5	30	rplW	SA2237	50S ribosomal protein L23
sa_c4852s4158_at*	2.4	15	stable	rplX	SA2228	50S ribosomal protein L24
sa_c7511s6531_a_at*	2.6	15	stable	rplY	SA0545	50S ribosomal Protein L25
sa_c2922s2484_a_at*	2.4	5	stable	rpmA	SA1700	50S ribosomal protein L27
sa_c4860s4166_at*	2.7	15	stable	rpmC	SA2231	50S ribosomal protein L29
sa_c4828s4134_at*	2.4	15	stable	rpmD	SA2221	50S ribosomal protein L30
sa_c891s9388_a_at*	2.4	2.5	30	rpmF	SA1137	50S ribosomal protein L32
sa_c3032s2589_x_at*	3.3	5	2.5	rpmI	SA1726	50S ribosomal protein L35
sa_c9623s9171_a_at*	3.1	2.5	2.5	rpsB	SA1274	30S ribosomal protein S2
sa_c4868s4175_a_at*	3.5	15	stable	rpsC	SA2233	30S ribosomal protein S3
sa_c3188s2737_a_at	3.9	2.5	30	rpsD	SA1769	30S ribosomal protein S4
sa_c4832s4138_at*	2.8	15	stable	rpsE	SA2222	30S ribosomal protein S5
sa_c7136s6248_at*	2.9	15	30	rpsF	SA0437	30S ribosomal protein S6
sa_c8830s7766_a_at*	3.1	15	stable	rpsG	SA0592	30S ribosomal protein S7
sa_c4840s4147_a_at*	2.7	15	stable	rpsH	SA2225	30S ribosomal protein S8
sa_c4770s4080_a_at*	3.0	2.5	30	rpsI	SA2206	30S ribosomal protein S9
sa_c9963s8658_a_at*	3.0	5	stable	rpsJ	SA2240	30S ribosomal protein S10
sa_c4800s4106_at*	3.1	15	stable	rpsK	SA2214	30S ribosomal protein S11
sa_c7645s6658_a_at*	2.5	15	stable	rpsL	SA0591	30S ribosomal protein S12
sa_c4804s4110_at*	2.4	15	stable	rpsM	SA2215	30S ribosomal protein S13
sa_c4844s4152_at*	3.1	15	stable	rpsN	SA2226	30S ribosomal protein S14
sa_c10032s8739_a_at*	3.0	5	stable	rpsO	SA1292	30S ribosomal protein S15
sa_c1290s1065_at*	3.5	2.5	stable	rpsP	SA1254	30S ribosomal protein S16
sa_c10191s8871_a_at*	2.2	15	stable	rpsQ	SA2230	30S ribosomal protein S17
sa_c7144s6255_a_at*	4.1	5	stable	rpsR	SA0439	30S ribosomal protein S18
sa_c4876s4184_at*	2.7	5	stable	rpsS	SA2235	30S ribosomal protein S19
sa_c2719s2293_at*	2.0	15	stable	rpsT	SA1642	30S ribosomal protein S20
sa_c9438s8253_a_at*	4.2	5	30	tgt	SA1694	queuine tRNA-ribosyltransferase
sa_c1300s1073_a_at*	5.6	2.5	stable	trmD	SA1256	tRNA -methyltransferase
sa_c6837s5972_a_at*	5.1	2.5	15	trmE	SA2738	tRNA modification GTPase
sa_c9619s8379_a_at	3.9	2.5	30	tsf	SA1276	translation elongation factor Ts
sa_c8838s7774_a_at*	2.3	30	stable	tuf	SA0594	translation elongation factor Tu
sa_c8748s7692_a_at*	7.4	2.5	30	tyrS	SA1778	tyrosyl-tRNA synthetase
sa_c10017s10482cv_s_at	3.4	2.5	2.5		SA0067	conserved hypothetical
sa_c8822s7758_at	4.8	2.5	2.5		SA0587	hypothetical protein
sa_c7641s6656_a_at*	3.0	15	2.5		SA0590	30S ribosomal protein L7
sa_c1143s924_a_at*	5.5	2.5	30		SA1209	ribosomal large subunit pseudouridine synthase D
sa_c1390s1164_a_at*	3.8	2.5	30		SA1287	30S ribosomal protein L7
sa_c2640s2213_a_at	9.2	2.5	2.5		SA1615	ATP dependent DNA helicase
sa_c2765s2337_a_at	4.5	2.5	15		SA1653	GTP-binding protein YqeH
sa_c3647s3130_a_at*	3.1	2.5	2.5		SA1913	RNA methyltransferase
Posttranslational modification, protein turnover, chaperone
sa_c855s656_a_at*	5.1	2.5	2.5	ctaA	SA1124	cytochrome oxidase assembly protein
sa_c859s660_a_at	10.3	2.5	2.5	ctaB	SA1125	protoheme IX farnesyltransferase
sa_c10672s11124_a_at	8.4	30	Stable		N315-SA1775	putative conserved Clp protease
Replication, recombination and repair
sa_c22s9176_a_at	2.4	2.5	stable	gyrA	SA0006	DNA gyrase, A subunit
sa_c9918s10462_a_at	4.3	2.5	2.5	int	N315-SA1810	integrase
sa_c3689s3168_a_at	3.6	2.5	2.5	mutY	SA1926	A/G-specific adenine glycosylase
sa_c2636s2209_a_at	5.7	2.5	30	nfo	SA1614	endonuclease IV
sa_c8270s7248_a_at	6.6	2.5	30	nrdE	SA0792	ribonucleotide-diphosphate reductase α
sa_c8453s7413_a_at	5.8	15	stable	nuc	SA0860	thermonuclease precursor
sa_c2914s2476_a_at*	4.6	2.5	30	obgE	SA1699	GTPase ObgE
sa_c1773s1505_a_at	4.9	2.5	30	parC	SA1390	DNA topoisomerase IV, A subunit
sa_c2887s2452_a_at*	3.3	2.5	2.5	recJ	SA1691	single-stranded-DNA-specific exonuclease
sa_c1320s1091_a_at*	3.8	2.5	ND	rnhB	SA1261	ribonuclease HII
sa_c2908s2469_a_at*	4.0	2.5	2.5	ruvA	SA1697	Holliday junction DNA helicase RuvA
sa_c9430s8244_a_at*	2.9	2.5	30	ruvB	SA1696	Holliday junction DNA helicase RuvB
sa_c7140s6251_at*	2.5	15	stable	ssb	SA0438	single-stranded DNA-binding protein
sa_c9288s8130_a_at	7.7	2.5	2.5	topA	SA1267	DNA topoisomerase I
sa_c2521s2102_a_at*	2.8	2.5	30	xseB	SA1567	exodeoxyribonuclease VII, small subunit
sa_c7463s6487_a_at	4.0	2.5	30		SA0528	DNA replication intiation control protein
sa_c7541s6559_a_at*	5.2	2.5	2.5		SA0553	Hypothetical protein
sa_c1344s1117_a_at*	4.1	2.5	2.5		SA1266	putative DNA processing protein
sa_c1643s1381_at*	3.4	2.5	2.5		SA1357	thermonuclease
sa_c3053s2604_a_at*	2.4	2.5	30		SA1732	replication initiation and membrane attachment protein
Signal transduction
sa_c1996s1713_a_at	2.9	2.5	15	arlS	SA1450	sensor histidine kinase
sa_c6155s5336_a_at*	4.4	2.5	2.5	lytS	SA0245	sensor histidine kinase
sa_c8186s7165_a_at	3.0	2.5	30	saeS	SA0765	sensor histidine kinase
sa_c831s632_a_at*	4.8	2.5	15	typA	SA1118	GTP-binding protein
sa_c8316s7293_a_at*	4.0	2.5	2.5		SA0809	GGDEF domain-containing protein
Cell wall and membrane biogenesis
sa_c10639s11094_s_at	4.4	2.5	30	atl	SA1062	bifunctional autolysin
sa_c2727s2300_a_at	2.3	2.5	stable	cap5M	SA0148	capsular polysaccharide
sa_c2767s2340_a_at	2.6	2.5	stable	cap5N	SA0149	capsular polysaccharide
sa_c5976s5182_a_at*	3.6	2.5	2.5	galU	SA2508	UTP-glucose-1-phosphate
sa_c6835s5969_a_at*	4.7	2.5	stable	gidB	SA2736	glucose-inhibited division protein
sa_c10310s8999_a_at*	3.3	2.5	ND	murAA	SA2092	UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1
sa_c6119s5300_a_at	2.4	15	stable	scdA	SA0244	cell wall biosynthesis protein
sa_c9611s8371_a_at*	4.8	2.5	2.5	uppS	SA1279	undecaprenyl diphosphate synthase
sa_c10723s11171cv_s_at*	10.5	2.5	2.5		SA0507	LysM domain protein
sa_c8045s7032_at	8.3	2.5	15		SA0723	LysM domain-containing protein
sa_c3330s2873_at*	5.9	2.5	2.5		SA1804	polysaccharide biosynthesis protein
sa_c8776s7720_a_at*	5.6	2.5	2.5		SA1825	N-acetylmuramoyl-L-alanine amidase
sa_c5094s4391_a_at*	6.0	2.5	2.5		SA2298	N-acetylmuramoyl-L-alanine amidase
sa_c4394s3743_a_at	2.6	2.5	2.5		SA2088	putative sceD protein
Cell division
sa_c9724s8471_a_at*	3.6	2.5	15	engA	SA1515	GTP-binding protein
sa_c1104s883_a_at*	2.9	5	30	ftsA	SA1198	cell division protein
sa_c9453s8264_a_at*	4.6	2.5	30	gidA	SA2737	tRNA uridine 5-carboxymethylaminomethyl modification enzyme
Intracellular trafficking and secretion
sa_c9947s8643_a_at*	2.4	15	stable	secY	SA2219	preprotein translocase
sa_c10080s8800_at*	3.1	5	stable	yajC	SA1693	preprotein translocase
sa_c2899s2464_a_at*	7.1	2.5	15		SA1692	preprotein translocase
Virulence
sa_c3966s9857_a_at	10.3	5	ND	chp	N315-SA1755	chemotaxis-inhibiting protein
sa_c6506s5675_a_at	8.1	2.5	2.5	clfB	SA2652	clumping factor B
sa_c1007s793_a_at	6.3	5	ND	efb	SA1168	fibrinogen-binding protein
sa_c5980s5185_a_at	11.4	2.5	stable	fnbA	SA2511	fibronectin-binding protein A
sa_c4094s3450_a_at	2.4	2.5	2.5	hlb	SA2003	phospholipase C
sa_c6259s5439_a_at	12.9	2.5	stable	isaA	SA2584	immunodominant antigen A
sa_c3972s9863_a_at	4.7	30	ND	sak	N315-SA1758	staphylokinase precursor
sa_c1082s9604cv_s_at*	2.3	30	stable	spa	SA0095	protein A
sa_c3561s9828_a_at*	2.9	2.5	ND	yent2	SA1644	enterotoxin
sa_c995s782_a_at	7.4	2.5	stable		SA1164	fibrinogen binding-related protein
sa_c2775s9782_at*	2.3	2.5	2.5		SA1657	putative enterotoxin type A
sa_c5066s4362_a_at*	13.4	2.5	stable		SA2291	staphyloxanthin biosynthesis
sa_c5082s4380_a_at*	14.9	2.5	2.5		SA2295	staphyloxanthin biosynthesis
sa_c5652s4904_a_at	18.3	2.5	2.5		SA2418	IgG-binding protein
sa_c6250s5428_a_at*	3.8	2.5	stable		SA2581	staphyloxanthin biosynthesis
Resistance
sa_c5721s4964_a_at*	4.9	2.5	2.5	bcr	SA2437	bicyclomycin resistance protein
sa_c8155s7139_a_at	3.2	5	15	norA	SA0754	multi drug resistance protein
sa_c6618s5778_a_at	4.1	2.5	ND	pls	SA0050	methicillin-resistance surface protein
Unknown function
sa_c8661s7610_a_at	5.3	2.5	2.5	kapB	SA0956	hypothetical protein
sa_c8544s7501_a_at	2.7	5	30	sufB	SA0918	putative FeS assembly protein
sa_c692s500_a_at	2.5	2.5	2.5		SA0077	hypothetical protein
sa_c3008s2564_a_at	2.9	15	2.5		SA0157	hypothetical protein
sa_c9241s8090_a_at	14.5	2.5	2.5		SA0199	hypothetical protein
sa_c6847s5978_a_at	6.9	2.5	30		SA0265	hypothetical protein
sa_c6849s5983_a_at	8.1	2.5	ND		SA0266	hypothetical protein
sa_c6853s5989_a_at	9.8	15	2.5		SA0267	hypothetical protein
sa_c6861s5997_a_at	4.4	2.5	2.5		SA0272	hypothetical protein
sa_c6867s6000_a_at	2.5	2.5	stable		SA0273	hypothetical protein
sa_c10505s9038_a_at	2.5	2.5	ND		SA0274	hypothetical protein
sa_c6869s6002_a_at	2.7	2.5	2.5		SA0275	hypothetical protein
sa_c6883s6013_x_at	2.1	2.5	2.5		SA0285	hypothetical protein
sa_c7088s6200_a_at*	4.1	2.5	2.5		SA0425	hypothetical protein
sa_c7833s10214_at	5.0	2.5	ND		SA0653	hypothetical protein
sa_c7835s10216_x_at	4.2	2.5	2.5		SA0654	hypothetical protein
sa_c8905s7823_a_at*	6.5	2.5	2.5		SA0721	hypothetical protein
sa_c8928s7841_a_at*	4.5	2.5	2.5		SA0755	hypothetical protein
sa_c8934s7849_a_at	7.5	2.5	2.5		SA0767	hypothetical protein
sa_c8196s7173_a_at	12.2	2.5	stable		SA0768	hypothetical protein
sa_c8228s7205_a_at*	3.6	2.5	30		SA0777	hypothetical protein
sa_c8262s7237_a_at*	2.1	2.5	30		SA0790	membrane domain protein
sa_c8296s7275_a_at*	5.9	2.5	ND		SA0802	hypothetical protein
sa_c8324s10230_a_at*	4.2	2.5	2.5		SA0812	degV family protein
sa_c8463s7426_a_at*	5.9	2.5	2.5		SA0864	hypothetical protein
sa_c8528s7487_a_at	17.3	2.5	2.5		SA0913	hypothetical protein
sa_c8637s7585_a_at	2.5	2.5	2.5		SA0947	hypothetical protein
sa_c275s119_a_at	2.8	2.5	ND		SA0978	hypothetical protein
sa_c429s262_a_at*	10.1	2.5	2.5		SA1017	hypothetical protein
sa_c470s302_at	3.5	2.5	15		SA1026	hypothetical protein
sa_c517s346_a_at*	6.8	15	stable		SA1041	hypothetical protein
sa_c525s350_at*	14.2	2.5	2.5		SA1044	hypothetical protein
sa_c807s608_a_at*	4.3	2.5	2.5		SA1112	hypothetical protein
sa_c863s665_at*	9.2	2.5	15		SA1126	hypothetical protein
sa_c8780s7721_a_at*	5.8	2.5	2.5		SA1132	hypothetical protein
sa_c9975s8671_a_at*	8.1	2.5	15		SA1230	hypothetical protein
sa_c10333s9011_a_at*	3.8	2.5	30		SA1286	hypothetical protein
sa_c1453s1230_a_at*	3.3	2.5	2.5		SA1307	hypothetical protein
sa_c1699s1436_a_at*	3.3	2.5	2.5		SA1373	hypothetical protein
sa_c1711s1447_a_at*	2.1	5	stable		SA1378	hypothetical protein
sa_c1762s1498_a_at*	5.9	2.5	30		SA1388	hypothetical protein
sa_c2066s1777_a_at*	9.1	2.5	2.5		SA1468	hypothetical protein
sa_c2109s1814_a_at*	23.2	2.5	ND		SA1481	hypothetical protein
sa_c2120s1823_a_at*	7.8	2.5	2.5		SA1483	hypothetical protein
sa_c2481s2059_at	2.8	2.5	2.5		SA1556	hypothetical protein
sa_c10583s11040_a_at*	2.2	2.5	ND		SA1585	hypothetical protein
sa_c2644s2217_a_at	5.0	2.5	30		SA1616	hypothetical protein
sa_c2647s2221_a_at	7.5	2.5	30		SA1617	hypothetical protein
sa_c2693s2265_a_at*	4.1	2.5	30		SA1633	hypothetical protein
sa_c2695s2269_a_at*	3.0	2.5	2.5		SA1634	hypothetical protein
sa_c2745s2315_a_at*	4.5	2.5	30		SA1647	hypothetical protein
sa_c9631s8387_a_at*	3.3	2.5	30		SA1648	hypothetical protein
sa_c2747s2320_a_at	3.1	2.5	30		SA1649	hypothetical protein
sa_c2757s2330_a_at*	3.3	2.5	2.5		SA1651	hypothetical protein
sa_c9407s9231_a_at*	2.6	5	stable		SA1701	hypothetical protein
sa_c3170s2715_a_at*	3.4	2.5	2.5		SA1763	hypothetical protein
sa_c10660s11112cv_s_at*	2.3	2.5	ND		SA1805	hypothetical protein
sa_c3441s2971_a_at*	2.9	2.5	30		SA1836	hypothetical protein
sa_c3481s3008_a_at*	3.7	2.5	30		SA1847	hypothetical protein
sa_c3491s9181_a_at*	2.9	2.5	ND		SA1850	hypothetical protein
sa_c3621s3099_a_at	7.7	2.5	2.5		SA1903	hypothetical protein
sa_c10121s8844_a_at	3.3	2.5	stable		SA1940	hypothetical protein
sa_c3838s3307_a_at	2.7	2.5	ND		SA1971	hypothetical protein
sa_c3924s3392_a_at*	4.1	2.5	30		SA1993	hypothetical protein
sa_c3932s3401_a_at*	5.5	2.5	15		SA1995	hypothetical protein
sa_c4171s3522_a_at*	5.4	2.5	stable		SA2033	hypothetical protein
sa_c4173s3526_a_at*	8.5	2.5	15		SA2034	hypothetical protein
sa_c4185s3537_a_at	2.8	2.5	ND		SA2037	hypothetical protein
sa_c4365s3717_a_at	4.0	2.5	2.5		SA2082	hypothetical protein
sa_c4438s3783_a_at*	2.8	15	2.5		SA2102	hypothetical protein
sa_c4593s3925_a_at*	5.8	2.5	2.5		SA2152	hypothetical protein
sa_c10197s8880_a_at*	3.9	2.5	2.5		SA2250	hypothetical protein
sa_c4919s4228_a_at*	3.2	2.5	2.5		SA2251	hypothetical protein
sa_c5005s4307_a_at*	3.7	2.5	2.5		SA2275	BioY family protein
sa_c5199s4501_a_at*	24.4	2.5	2.5		SA2328	hypothetical protein
sa_c5223s4525_a_at*	5.8	2.5	2.5		SA2334	hypothetical protein
sa_c10593s9072cs_s_at	2.9	2.5	2.5		SA2338	hypothetical protein
sa_c5492s4755_a_at*	2.1	2.5	30		SA2373	hypothetical protein
sa_c9334s8169_a_at*	5.1	2.5	2.5		SA2383	hypothetical protein
sa_c5606s4859_a_at*	2.8	2.5	30		SA2402	hypothetical protein
sa_c6038s5239_a_at*	3.6	2.5	2.5		SA2528	hypothetical protein
sa_c6102s5291_a_at	5.1	2.5	2.5		SA2548	hypothetical protein
sa_c6151s5333_a_at*	3.5	2.5	ND		SA2557	hypothetical protein
sa_c6815s10098_at*	4.6	2.5	ND		SA2728	hypothetical protein
sa_c9448s8258_a_at*	2.1	2.5	ND		SA2734	hypothetical protein
sa_c7837s10217_at	3.8	2.5	ND		N315-SA0556	hypothetical protein
sa_c8222s10227_at*	3.9	2.5	2.5		N315-SA0671	hypothetical protein
sa_c9400s10363_at*	2.7	2.5	stable		N315-SA0692	hypothetical protein
sa_c2124s1827_at	2.0	stable	stable		N315-SA1278	hypothetical protein
sa_c3962s9856_a_at*	4.0	15	2.5		N315-SA1754	hypothetical protein
sa_c9895s10439_a_at*	3.9	30	ND		N315-SA1759	lytic enzyme
sa_c3973s9865_a_at*	3.0	stable	ND		N315-SA1760	hypothetical protein
sa_c3979s9871_at*	3.9	stable	ND		N315-SA1762	hypothetical protein
sa_c9897s10440_s_at*	5.1	15	stable		N315-SA1765	hypothetical protein
sa_c3992s9884_a_at*	5.4	15	stable		N315-SA1766	hypothetical protein
sa_c3995s9886_a_at*	5.2	30	stable		N315-SA1767	hypothetical protein
sa_c4003s9891_a_at*	3.0	30	stable		N315-SA1768	hypothetical protein
sa_c4005s9893_a_at*	4.9	30	stable		N315-SA1769	hypothetical protein
sa_c4009s9897_a_at*	4.2	30	stable		N315-SA1770	hypothetical protein
sa_c4010s9899_at*	6.6	15	stable		N315-SA1771	hypothetical protein
sa_c4012s9901_a_at*	5.6	30	stable		N315-SA1772	hypothetical protein
sa_c4014s9903_a_at*	7.3	30	30		N315-SA1773	hypothetical protein
sa_c10670s11122_a_at*	7.1	30	stable		N315-SA1774	hypothetical protein
sa_c4020s9905_at*	7.5	15	stable		N315-SA1776	hypothetical protein
sa_c10134s10547_a_at*	4.7	2.5	stable		N315-SA1777	hypothetical protein
sa_c4550s9974_x_at	4.5	2.5	2.5		N315-SAS070	hypothetical protein
sa_c4556s9980_at	2.7	2.5	2.5		N315-SAS072	hypothetical protein
sa_c9380s9405_a_at*	9.8	2.5	ND		SACOL2526	putative membrane protein, authentic point mutation
sa_c3984s9875_at*	5.2	30	30		SAR2047	hypothetical protein
sa_c10668s11120_a_at*	4.5	30	2.5		SAR2051	hypothetical protein
sa_c4001s9889_a_at*	5.3	30	stable		SAR2053	hypothetical protein
sa_c3987s9878_at*	4.7	15	30		SAV1953	phi PVL ORF 20 and 21 homolog
sa_c4073s9945_at	3.4	2.5	2.5		SAV1992	hypothetical protein

^*Functional category and GeneChip qualifier indicated.

^†S. aureus strain COL locus unless otherwise indicated.

Alkaline-shock conditions increased the transcript titers of 128 genes (Figure 1B; Table 3). Interestingly, the majority of induced genes of known function were involved in amino acid biosynthesis and are not believed to be members of the σ^B regulon (Bischoff et al. 2004). More specifically, genes encoding enzymes required for lysine biosynthesis, dapA, dapB, and dapD, where up-regulated 4.5 to 9.4–fold. Genes involved in synthesis of the branched amino acids valine and isoleucine (ilvB and ilvC), as well as leucine (leuA-leuD), histidine (hisC, hisG, hisH, and hisZ), and threonine (thrB and thrC) were up-regulated between 2.2 and 23.3-fold in response to alkaline shock conditions. In addition to increased expression of amino acid biosynthesis genes, alkaline-shock induced the transcript titers of genes of the Opp oligopeptide system (oppA-oppC, 7.3 to 12.1-fold), which is believed to mediate the influx of essential amino acids (Hiron et al. 2007). It was also determined that alkaline conditions induced expression of genes that are presumed to maintain intracellular homeostasis and oxidative damage protection (Musarrat and Ahmad 1991). More specifically, the mnh operon (mnhA-mnhG; 3.1 to 4.6-fold), which is believed to encode a Na⁺/H⁺ antiporter and participate in neutralizing alkalinized conditions within other bacterial species, was found to be induced in response to alkali conditions (Hiramatsu et al. 1998). Likewise, alkaline shock induced expression of reactive oxygen species detoxifying proteins (katA and two OsmC-peroxidase family proteins) and several oxidative DNA damage repair enzymes, including: uvrA, uvrB, sbcC, and sbcD.

Table 3.

Genes up-regulated in alkaline-shocked cells.

Category and qualifier*	Fold induction	mRNA half-life (min)		Gene	Locus†	Description
		pH 7.2	pH 10
Amino acid transport and metabolism
sa_c1918s1640_a_at	7.1	ND	2.5	asd	SA1429	aspartate-semialdehyde dehydrogenase
sa_c1922s1644_a_at	9.4	ND	2.5	dapA	SA1430	dihydrodipicolinate synthase
sa_c1924s1648_a_at	5.7	ND	5	dapB	SA1431	dihydrodipicolinate reductase
sa_c1928s1652_a_at	4.5	ND	5	dapD	SA1432	dicarboxylate N-succinyltransferase
sa_c8240s7220_a_at	2.2	2.5	2.5	hisC	SA0784	histidinol-phosphate aminotransferase
sa_c6724s5865_a_at	3.2	ND	2.5	hisG	SA2703	ATP phosphoribosyltransferase
sa_c6708s5850_a_at	2.9	ND	5	hisH	SA2699	imidazole glycerol phosphate synthase, glutamine amidotransferase subunit
sa_c6728s5871_a_at	4.1	ND	2.5	hisZ	SA2704	ATP phosphoribosyltransferase regulatory subunit
sa_c1659s1395_a_at	17.0	5	2.5	hom	SA1362	homoserine dehydrogenase
sa_c5195s4497_a_at*	2.7	2.5	2.5	hutG	SA2327	formiminoglutamase
sa_c4213s3565_a_at	14.8	ND	2.5	ilvB	SA2043	acetolactate synthase, large subunit, biosynthetic type
sa_c9931s8627_a_at	18.5	ND	5	ilvC	SA2045	ketol-acid reductoisomerase
sa_c4217s3569_at	56.9	ND	5	ilvN	SA2044	acetolactate synthase 1 regulatory subunit
sa_c4223s3575_a_at	23.3	ND	5	leuA	SA2046	2-isopropylmalate synthase
sa_c4229s3580_a_at	4.1	ND	15	leuC	SA2048	3-isopropylmalate dehydratase, subunit 1
sa_c4239s3588_a_at	4.4	ND	15	leuD	SA2049	3-isopropylmalate dehydratase, subunit 2
sa_c10571s9056_a_at	7.3	ND	2.5	oppB	SA0991	oligopeptide ABC transporter
sa_c324s166_a_at	12.1	ND	2.5	oppC	SA0992	oligopeptide ABC transporter
sa_c350s191_a_at	9.7	ND	5	oppA	SA0995	oligopeptide ABC transporter
sa_c1669s1406_a_at	12.3	2.5	2.5	thrB	SA1364	homoserine kinase
sa_c1665s1401_a_at	10.2	ND	2.5	thrC	SA1363	threonine synthase
sa_c1810s1538_a_at	3.4	ND	5	tyrA	SA1401	prephenate dehydrogenase
sa_c4120s3473_a_at	3.3	ND	2.5		SA0191	M23/M37 peptidase domain protein
sa_c7102s6213_a_at	3.0	ND	5		SA0429	homocysteine methyltransferase
sa_c7199s6265_a_at	2.9	15	15		SA0444	conserved hypothetical protein
sa_c9581s8342_a_at	10.6	ND	2.5		SA1360	aspartate kinase
sa_c3202s2750_a_at	2.9	ND	2.5		SA1772	aminotransferase, class V
sa_c5176s4476_a_at	2.2	ND	5		SA2322	M20/M25/M40 family peptidase
sa_c5470s4736_a_at	2.7	ND	2.5		SA2368	acetyltransferase, GNAT family
sa_c5355s4632_a_at	2.2	2.5	2.5		SA2453	ABC transporter
sa_c6224s5400_a_at	3.2	2.5	2.5		SA2575	aminotransferase, class I
Carbohydrate transport and metabolism
sa_c1812s1540_a_at	6.2	2.5	5		SA1402	putative glutamyl aminopeptidase
Lipid transport and metabolism
sa_c10513s9045_a_at	2.1	ND	15	fabG	SA2482	3-oxoacyl-reductase
sa_c2791s2362_a_at	5.4	2.5	2.5		SA1661	putative acetyl-CoA carboxylase
sa_c2799s2367_a_at	4.6	ND	2.5		SA1662	putative acetyl-CoA carboxylase
Inorganic ion transport and metabolism
sa_c1679s1417_a_at	2.0	2.5	15	katA	N315-SA1170	Catalase
sa_c7917s9265_a_at	3.1	ND	2.5	mnhA	SA0679	putative Na+/H+ antiporter
sa_c7931s6914_a_at*	3.1	2.5	5	mnhD	SA0682	putative Na+/H+ antiporter
sa_c8887s7802_a_at*	4.1	2.5	5	mnhE	SA0684	putative Na+/H+ antiporter
sa_c7937s6924_at*	4.6	2.5	15	mnhF	SA0685	putative Na+/H+ antiporter
sa_c7941s6928_a_at*	4.0	2.5	15	mnhG	SA0686	putative Na+/H+ antiporter
sa_c9538s8314_a_at	2.2	ND	2.5	phnD	SA0128	phosphonate ABC transporter
Energy production and conversion
sa_c4225s3576_a_at	10.8	ND	5	leuB	SA2047	3-isopropylmalate dehydrogenase
sa_c8930s7847_a_at	2.4	5	5		SA0763	oxidoreductase
sa_c8671s7618_a_at	2.3	2.5	5		SA0959	NADH-dependent flavin oxidoreductase
sa_c5174s4471_a_at	4.0	2.5	5		SA2321	oxidoreductase
Coenzyme transport and metabolism
sa_c3204s2753_a_at	4.8	ND	5	serA	SA1773	D-3-phosphoglycerate dehydrogenase
sa_c6220s5396_a_at	2.6	2.5	5		SA2574	2-hydroxyacid dehydrogenase family
Transport
sa_c6938s6059_a_at	2.2	2.5	2.5		SA0305	ABC transporter
sa_c2783s2353_a_at	3.3	ND	5		SA1659	hypothetical protein
Transcription
sa_c10143s10555cv_s_at	7.9	2.5	15		N315-SA1804	putative transcriptional regulator
Signal transduction
sa_c3083s2636_a_at	2.4	2.5	2.5	phoP	SA1740	alkaline phosphatase synthesis transcriptional regulatory protein
sa_c8744s7687_a_at	14.7	15	15		SA1759	universal stress protein family
Posttranslational modification, protein turnover, chaperone
sa_c8485s7447_a_at	3.5	2.5	15		SA0872	OsmC/Ohr family protein
sa_c3196s2743_a_at	3.5	2.5	5		SA1771	OsmC/Ohr family protein
sa_c3603s3083_a_at	2.0	2.5	2.5		SA1897	putative protein export protein PrsA
Replication, recombination and repair
sa_c1731s9098_a_at	3.2	2.5	2.5	sbcC	SA1382	exonuclease
sa_c1727s1464_a_at	3.6	2.5	2.5	sbcD	SA1381	exonuclease
sa_c8354s7326_a_at	2.3	2.5	2.5	uvrA	SA0824	excinuclease ABC, A subunit
sa_c10548s11008cv_s_at	3.1	2.5	2.5	uvrB	SA0823	excinuclease ABC, B subunit
sa_c1804s1534_a_at	30.4	ND	2.5		SA1400	ImpB/MucB/SamB family protein
sa_c10309s10698_a_at	5.1	ND	15		N315-SA1196	conserved ImpB/MucB/SamB family protein
Cell wall and membrane biogenesis
sa_c2346s1974_a_at	13.0	ND	2.5	cap5A	SA0136	capsular polysaccharide biosynthesis
sa_c2399s1991_a_at	8.3	ND	2.5	cap5C	SA0138	capsular polysaccharide biosynthesis
sa_c2413s1997_a_at	5.2	ND	2.5	cap5D	SA0139	capsular polysaccharide biosynthesis
sa_c9546s8318_a_at	5.8	ND	5	cap5E	SA0140	capsular polysaccharide biosynthesis
sa_c2479s2056_a_at	4.4	ND	5	cap5F	SA0141	capsular polysaccharide biosynthesis
sa_c2516s2092_a_at	3.2	ND	15	cap5G	SA0142	UDP-N-acetylglucosamine 2-epimerase
sa_c1737s1469_a_at	2.6	ND	5	mscL	N315-SA1182	large-conductance mechanosensitive channel
sa_c8184s7162_a_at	2.0	2.5	2.5		SA0764	glycosyl transferase, group 2 family protein
sa_c9866s8605_at	2.7	2.5	2.5		SA1932	glycosyltransferase
sa_c6240s5417_a_at	2.1	2.5	2.5		SA2578	glycosyl transferase, group 2 family protein
sa_c6575s5743_a_at*	3.8	2.5	2.5		SA2668	LPXTG cell wall surface anchor family p
Virulence
sa_c7173s10144_at	7.3	2.5	2.5		SA0904	pathogenicity island protein
sa_c7177s10148_a_at*	8.0	ND	5		SA0905	pathogenicity island protein
Resistance
sa_c10584s11041_s_at	3.1	5	15		N315-SA1529	metallo-beta-lactamase superfamily protein
sa_c3138s9790_s_at	2.6	2.5	15		MSSA476-SAS1634	metallo-beta-lactamase superfamily protein
Phage
sa_c7182s10152cs_s_at	10.0	2.5	2.5		SA2014	phage terminase family protein
sa_c10465s10903_s_at	8.0	15	15		N315-SA1801	phage anti-repressor
Unknown function
sa_c939s733_a_at	4.2	ND	15		SA0089	antigen, 67 kDa
sa_c978s764_a_at	2.1	2.5	2.5		SA0092	hypothetical protein
sa_c6917s6037_a_at	2.8	ND	2.5		SA0299	hypothetical protein
sa_c7132s6241_a_at	18.2	ND	15		SA0436	hypothetical protein
sa_c7255s6315_a_at	5.0	2.5	15		SA0457	hypothetical protein
sa_c7313s9398_a_at	25.9	15	15		SA0480	hypothetical protein
sa_c7321s6366_a_at	2.4	2.5	2.5		SA0488	hypothetical protein
sa_c8424s7394_a_at	2.2	15	15		SA0851	hypothetical protein
sa_c8455s7417_a_at	3.1	2.5	2.5		SA0862	hypothetical protein
sa_c7760s6763_at*	19.9	15	15		SA0625	hypothetical protein
sa_c8473s7434_a_at	3.0	2.5	5		SA0868	hypothetical protein
sa_c10616s11070_s_at	2.1	2.5	2.5		SA0871	hypoyhetical protein
sa_c304s144_a_at	4.9	15	15		SA0985	putative surface protein
sa_c470s302_at	2.9	2.5	5		SA1026	hypothetical protein
sa_c485s314_at	281.2	ND	15		SA1033	hypothetical protein
sa_c1195s976_at	3.2	2.5	2.5		SA1225	hypothetical protein
sa_c1449s1223_a_at	2.3	15	15		SA1306	hypothetical protein
sa_c1705s1441_a_at	27.1	2.5	2.5		SA1375	hypothetical protein
sa_c2275s9666_s_at	2.7	ND	2.5		SA1532	hypothetical protein
sa_c2789s2357_a_at	5.0	2.5	5		SA1660	hypothetical protein
sa_c2805s2371_a_at	4.7	2.5	2.5		SA1663	hypothetical protein
sa_c2807s2375_a_at	6.3	ND	2.5		SA1664	hypothetical protein
sa_c2851s2417_x_at	3.7	15	5		SA1679	hypothetical protein
sa_c8524s7483_a_at	3.6	15	15		SA1680	hypothetical protein
sa_c2942s2505_a_at*	4.9	2.5	2.5		SA1705	hypothetical protein
sa_c3900s3368_at	17.8	2.5	2.5		SA1986	hypothetical protein
sa_c3910s3377_a_at	3.4	2.5	2.5		SA1988	hypothetical protein
sa_c10125s8848_a_at	16.4	stable	stable		SA1999	hypothetical protein
sa_c4341s3693_a_at	3.3	2.5	15		SA2076	hypothetical protein
sa_c4755s4067_a_at	25.6	ND	15		SA2197	putative surface protein
sa_c5458s4723_a_at	3.4	2.5	15		SA2365	hypothetical protein
sa_c5906s5139_a_at	4.1	2.5	2.5		SA2491	hypothetical protein
sa_c10236s10653_at	4.7	ND	2.5		SA2547	hypothetical protein
sa_c6206s5387_a_at*	21.1	ND	2.5		SA2571	hypothetical protein
sa_c6248s5424_a_at	2.2	ND	2.5		SA2580	hypothetical protein
sa_c6312s5485_a_at	3.2	2.5	2.5		SA2601	hypothetical protein
sa_c6316s5489_a_at	3.2	2.5	2.5		SA2602	hypothetical protein
sa_c4115s3465_a_at	3.5	2.5	2.5		SA2603	hypothetical protein
sa_c6325s5493_a_at	4.5	2.5	2.5		SA2605	hypothetical protein
sa_c6390s5558_at	6.8	ND	2.5		SA2621	hypothetical protein
sa_c298s136_a_at	4.2	ND	5		SA2681	hypothetical protein
sa_c9913s10456_a_at	3.1	ND	15		N315-SA1793	hypothetical protein
sa_c4070s9942_a_at	10.0	15	15		N315-SA1799	hypothetical protein
sa_c10141s10553_s_at	5.9	15	15		N315-SA1803	hypothetical protein
sa_c5869s10025_at	2.8	ND	15		N315-SA2259	hypothetical protein
sa_c4075s9947_at	5.4	ND	15		MW2-MW1930	hypothetical protein
sa_c2404s9766cs_s_at	7.7	2.5	15		N315-SAS064	hypothetical protein

^*Functional category and GeneChip^® qualifier indicated.

^†S. aureus strain COL locus unless otherwise indicated.

Consistent with previous reports, we also determined that alkaline shock conditions induced expression of eight putative virulence factor genes, which included members of the capsule biosynthesis operon (cap5A-cap5G; 3.2 to 13-fold) (Pane-Farre et al. 2006). As shown in Figure 3A., immunoblotting confirmed that capsule production was indeed increased in response to alkaline stress conditions. More specifically, in comparison to mock-treatment (pH 7.4) conditions and acid shock which resulted in a moderate increase in capsule production, alkaline conditions resulted in a more pronounced increase in capsule production. This suggested that capsule production is an alkaline-shock specific response, as opposed to an extreme pH response. Moreover, capsule might directly contribute to S. aureus survival during alkali conditions. However, no growth differences were observed between wild type or isogenic capsule-mutant cells following short term (30 min) or steady-state exposure to acidic (pH 4.0) or alkaline (pH 10.0) conditions (Figure 2B). Thus, while alkaline-shock up-regulates capsule production, it is not likely that doing so directly affects the organism’s pH tolerance. As shown in Figure 3B and 3C., reverse transcription mediated PCR measurements of the first gene of the capsule biosynthesis operon, capA, revealed that alkaline-shock up-regulation of capsule occurs in aσ^B-independent manner, which is inconsistent with the observations of Pané-Farré and colleagues (Pane-Farre et al. 2006). Given that Pané-Farré convincingly demonstrated that alkaline conditions elicit a σ^B response, and the sigma factor has been shown to effectively regulate capsule production in S. aureus strains COL, Newman and GP268 (Bischoff et al. 2004), the σ^B-independence observed here may be a strain dependent phenomenon. Regardless, these results indicate that other stress responsive factors affect S. aureus capsule production.

Figure 3. Capsule Expression.

Panel A shows an immunoblot for capsule detection formed by S. aureus strain UAMS-1 following growth at pH 7.4 (Mock) or induction of the alkaline-shock (pH 10), or acid-shock (pH 4) response. The dilution factor of starting cell-lysate suspensions is shown. Reverse-transcription mediated PCR results of various amounts (0–25 ng) of RNA isolated from wild type (Panel B) or isogenic ΔsigB (Panel C) cells grown at pH 7.4 or following alkaline-shock induction.

Taken together, alkaline-shock conditions appear to elicit a cellular response that is geared toward maintaining cellular pH homeostasis, eliminating oxidative damage moieties/repairing DNA lesions, and increasing cellular amino acid pools through import and biosynthesis pathways while simultaneously decreasing essential biological processes such as nucleic acid and protein synthesis. The finding that members of the protein synthesis machinery are decreased, but components of amino acid biosynthesis pathways and oligopeptide permease systems are upregulated in response to alkaline conditions is reminiscent of the organism’s stringent response (Anderson et al. 2006). The stringent response is an important bacterial system that allows for cellular adaptation to nutrient limiting conditions and is essential for S. aureus survival (Gentry et al. 2000).

Alkaline-Shock elevates the S. aureus stringent response alarmone ppGpp

The key mediator of the S. aureus stringent response is the “alarmone” ppGpp which increases during nutrient limiting conditions (Crosse et al. 2000). ppGpp accumulation redirects RNA polymerase transcript synthesis to members of the organism’s stringent response, resulting in the down-regulation of translation machinery and up-regulation of amino acid biosynthesis and transport systems. Based on the high degree of overlap between stringent response and alkaline responsive genes (71% similarity), we predicted that alkaline shock conditions elicit the S. aureus stringent response. To directly test that possibility, mass-spectroscopy was used to measure the ppGpp levels of S. aureus cells grown at neutral pH and stringent response-, alkaline shock- and acid shock- inducing conditions. As expected, while ppGpp levels were undetectable in cells grown at neutral pH, induction of the organism’s stringent response resulted in a significant increase of ppGpp levels (Table 6). Induction of the alkaline-shock response resulted in guanosine tetraphosphate levels that were comparable to stringent response induced cells, suggesting that the alkaline-shock response inducing conditions activate the organism’s stringent response. Conversely, ppGpp levels of acid-shocked cells were below levels of detection for the system, indicating that the change in guanosine tetraphosphate levels of alkaline shocked cells is not an extreme pH-stress response.

Table 6.

ppGpp Measurements.

Growth Condition	ppGpp AUC h/z at 601.9*,†	Calculated ppGpp (nM)†
pH 7.4	ND	ND
Stringent	12,630 (± 1,704)	53 (± 7)
pH 4.0	ND	ND
pH 10.0	9,128 (± 2,578)	38 (± 11)

^*Area Under the Curve (AUC) at 601.9 corresponding to the peak value of commercially available ppGpp.

^†Not Detectable (ND); Standard Deviation is indicated in parathesesis.

Global effects of pH stresses on mRNA stability

Recent studies have revealed that many S. aureus stress response-dependent alterations in transcript abundances can, in part, be attributed to alterations in RNA stability, as opposed (or in addition) to alterations in transcript synthesis. Thus, we set out to determine whether acid- or alkaline-shock conditions alter the mRNA turnover properties of S. aureus transcript species whose titers either increase or decrease in response to each stress. Such a finding would indicate that components of the extreme pH responses are post-transcriptionally regulated in a manner that involves the modulation of their mRNA degradation.

A comparison of the mRNA turnover properties of mock treated (pH 7.2) and pH-shocked cells revealed that their mRNA degradation properties differed. As shown in Figure 4, while most mock treated transcript species were rapidly degraded, induction of either the acid- or alkaline-shock response stabilized many mRNA species. More specifically, consistent with previous observations, it was found that during exponential growth at pH 7.4 most (83.9%) transcripts were rapidly degraded (half-lives of ≤ 2.5 min), 15% had intermediate half-lives (> 2.5 min but ≤ 30 min), and 1 % were stable (half lives > 30 min) (Anderson et al. 2006; Roberts et al. 2006). Conversely, during acid- or alkaline- shock conditions only 63.6% and 50.3% mRNA species had a half-life of ≤ 2.5 min, respectively. In comparison to growth at pH 7.4, exposure to acidic and alkaline conditions resulted in an increase in the number of transcripts exhibiting an intermediate half-life (38.6% and 24.1%, respectively). Interestingly, 10.5% of acidic-shocked bacterial transcripts were found to be stable, whereas 1.1% alkaline shock induced transcripts were stable.

Figure 4. mRNA Turnover Properties of Acid- or Alkaline-Shocked Exponential Phase S. aureus.

Graphed are the total numbers of S. aureus exponential phase mRNA species (% RNA molecules) exhibiting a half-life of less than 2.5 min (black bar), 2.5–5.0 min (dark-grey), 5.0–15.0 min (white), 15.0–30.0 min (hashed), or greater than 30 min (light-grey) during growth at pH 7.4 or following alkaline-shock (pH 10.0) or acid-shock (pH 4.0) induction.

A comparison of the mRNA turnover properties of transcripts whose titers either increased or decreased in response to sudden pH changes, revealed that pH-dependent alterations in mRNA degradation may, in part, account for the changes in their mRNA levels. For instance, 43 % and 16 % of the transcripts that were found to be up-regulated in response to acid- or alkaline-shock, respectively, exhibited a corresponding increase in mRNA stability during that stress condition, in comparison to mock treatment (Figure 5; Tables 2–4). This suggests that alterations in mRNA turnover, as opposed (or in addition) to alterations in transcript synthesis, may directly affect pH stress-dependent changes in their transcript titers. This phenomenon may be more expansive than observed here, as 31 % and 44 % of the pH 4 and pH 10 induced transcripts were not measurable during growth at pH 7.4, as a consequence their mRNA turnover properties could not be compared. Thus, while the transcript titers of these mRNA species increase in response to stress, their increase could be attributable to alterations in mRNA synthesis and/or reduced mRNA turnover.

Figure 5. Comparison of the mRNA Degradation Properties of Acid- or Alkaline-Shock Regulated mRNA Species.

Graphed are comparisons of the half-life measurements of mRNA species whose transcript titers increase in response to acid-shock (Panel A) or alkaline-shock (Panel B) conditions. The mRNA turnover properties of these transcripts is shown for unstressed or the indicated stress. Panels C and D show comparisons of the half-life measurements of transcripts that decrease in titer in response to acid- or alkaline- shock conditions, respectively.

A more detailed analysis of the mRNA turnover properties of transcripts that increase in titer in response to extreme pH revealed that most acid- or alkaline-shock inducible transcripts exhibit a half life of less than 2.5 min during growth at pH 7.4. Conversely, when induced in response to acidic conditions, many exhibit half-lives between 15 and 30 min or are stable (≥ 30 min; Figure 5A). Indeed, the average half-life of all acid-shock inducible transcripts is 4.3 min (± 4.2) during growth at neutral pH but is 17.7 min (± 13.6) during growth at pH 4.0; the latter excludes consideration of 8 “stable” transcripts (half life > 30 min). A similar, yet less pronounced trend was observed for alkaline inducible transcripts, which exhibited an average half life of 4.8 min (± 4.7) and 6.5 min (± 5.3) during growth at pH 7.2 and pH 10.0, respectively (Figure 5B).

Many of the mRNA species that were found to both increase in titer and stability in response to acid- or alkaline-shock conditions have been previously suggested to play an important role in adaptation to pH alterations. For instance, it was found that transcripts involved in maintaining the pH of the cell (ureA and ureB), transport (SACOL0086) and augmenting the reducing power of the cell (SACOL0111, SACOL0409, SACOL2534, and SACOL2594) were all stabilized during acid-shock conditions. Among the transcripts whose titers and stability increased in response to alkaline shock were members of the Mnh Na⁺/H⁺ antiporter system (mnhD-mnhG), antimicrobial resistance, oxidative damage protection (katA, SACOL0872, and SACOL1771), and numerous hypothetical genes (Table 3). This suggests that alterations in mRNA turnover, as opposed (or in addition) to alterations in transcript synthesis, may directly affect pH stress-dependent changes in their transcript titers and, consequently, facilitate S. aureus’ ability to adapt to extreme decreases or increases in pH.

Taken together, these data suggest that the mRNA turnover properties of acid- and alkaline-shocked cells differ from that of unstressed S. aureus. Further, changes in the mRNA levels of many differentially regulated genes could be attributable to their regulation at the post-transcriptional level in a manner that involves stress-dependent regulated changes in mRNA turnover. This suggests that modulating RNA turnover may be an important component of S. aureus’ ability to cope with acidic and alkaline conditions.

Stable RNA species and ribonucleases

As an entrée towards identifying factors that might contribute to acid- and/or alkaline-shock mediated mRNA stabilization, we considered that the two most likely scenarios that could account for these phenotypes are: 1) each stress condition induces/activates cellular RNA stabilizing moieties and/or 2) each condition represses ribonuclease (RNase) production/function.

Small non-coding RNAs (sRNAs) are a recently recognized class of regulatory molecules that affect the mRNA turnover properties of target transcripts of other bacterial species. The S. aureus virulence factor accessory regulator, RNAIII, is a sRNA-like molecule binds to and consequently stabilizes a subset of target transcripts (i.e. hla) suggesting that sRNAs exist within the organism (Morfeldt et al. 1995). Indeed, several recent reports have documented the existence of sRNA-like or bona fide sRNA molecules in S. aureus (Pichon and Felden 2005; Abu-Qatouseh et al. 2010; Beaume et al. 2010; Bohn et al. 2010). Moreover, we have previously shown that S. aureus produces a set of small extremely stable RNA molecules that lack an obvious open reading frame in a growth phase or stress responsive manner and found that at least two of these molecules regulate gene expression, presumably by altering the mRNA degradation properties of bound transcripts [(Anderson et al. 2006; Roberts et al. 2006) Miller and Dunman unpublished]. GeneChip^® analyses revealed that during acid-shock conditions S. aureus produces 5 small extremely stable RNA species (SSRs), which lack an obvious open reading frame and map to genomic intergenic regions (Supplemental Table 1). These molecules are either not produced or are unstable during exponential or stationary phase growth, cold-shock, heat-shock, stringent, SOS, alkaline-shock, and iron-, manganese-, and zinc-deficient conditions. Likewise, our results revealed that during alkaline-shock conditions the organism produces a single SSR, which is located within the S. aureus genome at least three times (Supplemental Table 1). Any one (or a combination thereof during acid-shock conditions) may behave as a sRNA molecule and contribute to the altered mRNA turnover properties of pH-stressed cells. In addition to the production of SSRs it was observed that at least 4 putative ribonucleases were down-regulated in response to acidic conditions (YhaM, RnpA, RNase HII, and XseB; Table 2); 6 potential ribonucleases were downregulated during alkaline-shock conditions (RNase III, SACOL0540, RNase HII, XseA/XseB, and SACOL0534; Table 4). The altered mRNA turnover properties of pH stressed cells could reflect the corresponding down-regulation of these ribonucleases, SSR production, or both.

DISCUSSION

The successfulness of S. aureus as a human pathogen can be, in part, attributed to its ability to adapt to host-associated environmental stresses, such as alterations in alkalinity. Indeed, we and others have recently shown that S. aureus has developed adaptive responses which are presumed to augment the organism’s ability to survive pH changes and play important roles in pathogenesis (Weinrick et al. 2004; Pane-Farre et al. 2006; Bore et al. 2007; Geiger et al. 2010). Nonetheless, the mechanisms that govern the organism’s changes in gene expression in response to acidic or alkaline conditions are poorly characterized. Recent studies indicate that stress-dependent alterations in mRNA turnover are likely to augment S. aureus adaptation to stringent, heat-shock, and cold-shock conditions, but not SOS inducing conditions (Anderson et al. 2006). Thus, the main goal of the current study was to assess whether the modulation of mRNA turnover is likely to facilitate S. aureus adaptation to transient alterations in pH.

GeneChip^® analyses indicate that the conditions used here elicit S. aureus cellular responses expected of acid- or alkaline-shocked cells. More specifically, we found that 30 min exposure to pH 4.0 adjusted medium affects the expression of noted genes of the organism’s acid-shock response, including: acid-neutralization processes and gene products that may increase its reducing power while simultaneously down-regulates macromolecular processes and systems that influx H⁺. Alkaline-shock conditions appear to elicit a cellular response that is geared toward maintaining cellular pH homeostatus, eliminating oxidative damage moieties/repairing DNA lesions.

One of the predominant outcomes of comparing the transcriptional profiles of acid- and alkaline-shocked cells is the observation that systems involved in maintaining intracellular pH homeostasis exhibit opposing expression properties in response to low and high pH stress. For instance, as previously described, acid-shock conditions increased transcript titers of the urease utilization system. During alkaline shock, the system was downregulated. Conversely, acid shock repressed Na⁺/H⁺ antiporters, whereas they were induced in response to alkaline conditions. Adaptation of S. aureus to each pH stress differed also in up-regulation of genes involved in amino acid metabolism. Alkaline-shock response conditions induced the transcript titers of gene products that are involved in branched amino acid biosynthesis, whereas acid-shock response conditions did not (the relevance of this observation is discussed below).

Both conditions also affected the expression properties of the organism’s virulon. Acid-shock resulted in a general down-regulation in the expression of the organism’s virulence factors. Among noted virulence factor regulatory genes that were down-regulated and could account for this phenomenon were the SaeRS-two component regulatory system, LytSR, ArlSR, and GdpS. Alkaline-shock resulted in the down-regulation of the major virulence factor regulator, RNAIII, as previously described (Regassa and Betley 1992). However, consistent with our previous observations for S. aureus strain UAMS-1, the reduction in RNAIII levels seemingly had minimal effect on the expression of the organism’s virulon (Cassat et al. 2006). Nonetheless, alkaline shock conditions resulted in a striking up-regulation in members of the capsule biosynthesis operon. This result is in agreement with the work of Pane-Farre, who also observed that alkaline-shock induced S. aureus strain COL capsule transcript titers (Pane-Farre et al. 2006). Given the importance of capsule biosynthesis in the organism’s ability to cause disease and the popularity of the molecule as a vaccine candidate we investigated this phenotype further. Immunoblotting confirmed that capsule production is indeed increased in response to alkaline shock conditions, implying that capsule may augment the organism’s ability to tolerate high pH. However, growth curve analyses indicated that this is not the case. We did not observe any growth advantage at high pH (i.e. alkali protective effects) for a capsule producing strain when compared an isogenic capsule deficient background. Further, real time PCR revealed that alkaline-mediated up-regulation of the capsule biosynthesis regulon is σ^B independent in S. aureus strain UAMS-1, which is in contrast to previous predictions and may reflect a strain background specific phenomenon (Pane-Farre et al. 2006).

Despite the aforementioned differences, we also observed considerable overlap between the two stress responses suggesting that, while the organism elicits specific processes to cope with low verses high pH stress, it also relies on a common set of biological processes to cope with extreme pH stress. More specifically, a number of genes were down-regulated in response to both pH stresses, particularly those involved in protein and nucleic acid synthesis, indicating that acid and alkaline shock conditions cause an overall decrease in cellular metabolism. In support of that possibility, extended growth during acid- or alkaline-shock conditions resulted in diminished cellular proliferation in comparison to S. aureus grown at neutral pH. This altered growth phenotype may provide the opportunity for the organism to repair and/or eliminate pH-mediated cellular damage. Similar phenotypes have been shown for other bacteria; acidic pH limits Campylobacter jejuni and Bacillus cereus growth, whereas alkaline pH has been reported to limit the growth of Desulfovibrio vulgaris and E. faecalis (Appelbe and Sedgley 2007; Stolyar et al. 2007; Mols and Abee 2008; Reid et al. 2008). Interestingly, diminished growth of E. faecalis during alkaline-pH stress correlates to induction of the organism’s stringent response (Abranches et al. 2009).

The stringent response was first characterized as a physiological condition that promotes Escherichia coli adaptation to nutrient limiting conditions via accumulation of intracellular pools of the “alarmones” pppGpp and ppGpp, which are collectively referred to as (p)ppGpp. (p)ppGpp, in turn, is thought to bind to E. coli RNA polymerase and redirect transcript synthesis. Only recently have corresponding studies been extended to other bacteria; this renewed interest has been accentuated, in part, by the realization that the stringent response plays an important role in bacterial virulence and antibiotic tolerance (Joseleau-Petit et al. 1994; Greenway and England 1999; Lemos et al. 2004; Gaynor et al. 2005; Kim et al. 2005; Pomares et al. 2008; Abranches et al. 2009). Those studies have also led to the realization that the stringent response is a more ubiquitous cellular stress response that allows bacteria to switch from a growth to a survival mode. Using DNA microarrays we found that induction of the S. aureus stringent response results in a physiological state that is similar to other bacteria and includes the down-regulation of translational processes and simultaneous up-regulation of genes whose products are believed to be involved in amino acid biosynthesis and transport as well as pathogenesis and antibiotic resistance (Anderson et al. 2006). Of direct relevance to the current work, many of these same transcriptional changes were observed to be shared by alkaline-shocked S. aureus. Indeed, there is a 71% transcriptional overlap between stringent and alkaline-shocked exponential phase S. aureus (Anderson et al. 2006). Moreover, we previously showed that stringent response induction results in regulated alterations in mRNA turnover that are similar to the mRNA degradation properties described here for alkaline-shocked cells (Anderson et al. 2006). Based on these similarities we predicted that alkaline-shock conditions elicit the S. aureus stringent response (Boes et al. 2008; Abranches et al. 2009). Our results indicate that this is the case; the stringent response alarmone ppGpp was observed to accumulate within alkaline shocked cells. Conversely, acid-shock responses do not result in ppGpp accumulation. Taken together these results indicate that S. aureus adapts to alkaline shock conditions by eliciting the stringent response. It remains to be seen which of the three putative S. aureus ppGpp synthases, RelP, RelQ, or the essential factor RSH, mediate this phenomenon (Geiger et al. 2010).

Collectively, these results both confirm the work of others and extend our understanding of the organism’s transcriptional responses to extreme pH, particularly in regards to alkaline-shock conditions. Moreover, our data indicate that the conditions used here are appropriate to study the S. aureus acid- and alkaline-shock responses in more detail. Accordingly, we assessed whether the organism alters its mRNA turnover properties in response to pH stress and whether these changes are likely to contribute to its ability to cope with alterations in pH. While mRNA degradation appears to be a rapid process within exponential phase S. aureus grown at pH 7.4, induction of either the acid- or alkaline-shock response resulted in the stabilization of many messenger RNA species. Further, a comparison of the mRNA degradation properties of transcript species that are increased in response to either acid- or alkaline-shock revealed that regulated changes in their decay may, in part, account for their elevated levels. Indeed, 43 % and 16 % of the transcripts that were found to be up-regulated in response to acid- or alkaline-shock, respectively, exhibited a corresponding increase in mRNA stability during that stress condition, in comparison to mock treated cells. Thus, alterations in the mRNA degradation properties of these transcript species are likely to contribute to their elevated levels within the cell during acid and alkaline-shock conditions. This mechanism may provide an efficient means for the organism to increase protein production of factors that contribute to pH adaptation without having to expend energy needed for de novo transcript synthesis.

Among the mRNA species whose changes in mRNA titers could be attributable to alterations in mRNA turnover were several factors that have been well-characterized to contribute to pH adaptation. For instance, the urease system has been shown to facilitate bacterial tolerance to acidic conditions (Ferrero et al. 1992; Bhagat and Virdi 2009; Hu et al. 2009). Our results revealed that the transcript levels for members of the urease system increased in response to acid-shock and that these increases could be due, in part, to stabilization of urease transcripts at low pH. Likewise, acetoin production (alsSD) is believed to promote cellular pH homeostasis and bacterial tolerance to acidic conditions (Hornbaek et al. 2004; Kinsinger et al. 2005; Schilling et al. 2007; Wilks et al. 2009). The current study found that alsSD transcripts levels are increased in response to acid-shock and that this increase correlates to mRNA stabilization during acid-stress. Taken together, these results imply that the modulation of mRNA turnover affects the transcript titers, and presumably protein production, of genes that are likely to mediate S. aureus adaptation to acid-shock conditions. Similarly, regulated changes in mRNA degradation are likely to contribute to the staphylococcal response to alkaline-shock. Indeed, it is well recognized that Na⁺/H⁺ antiporters play an essential and predominant role in bacterial adaptation to alkaline conditions (Reviewed in (Padan et al. 2005)). Our results revealed that S. aureus adapt to alkaline shock conditions by increasing the transcript titers of the Mnh Na⁺/H⁺ system and that these transcripts are stabilized during high pH stress. While our data indicate that S. aureus alters its mRNA turnover in response to extreme pH stress and that this, in turn, affects the transcript titers of messenger RNA species that are believed to augment the organism’s ability to cope with alterations in pH, it remains to be seen what molecular components govern these changes in RNA degradation.

Non-coding RNAs (sRNAs) are a recently recognized class of regulatory molecules that, when produced, mediate bacterial virulence factor production and stress adaptation. Base-pairing and altering the mRNA turnover properties of target transcripts is one mechanism by which sRNAs regulate biological processes. In that regard, while S. aureus RNAIII contains the open reading frame for δ-hemolysin and, as such, does not meet the strictest definition of a non-coding RNA the molecule has been shown to bind target transcripts and regulate their mRNA turnover properties. Thus, RNAIII can be considered a sRNA like molecule and raises the possibility that the organism is capable of producing other sRNAs. Indeed, recent reports have documented that S. aureus produces at least two sRNA molecules and while their regulatory effects remain to be determined- many others have ostensibly been identified (Pichon and Felden 2005; Abu-Qatouseh et al. 2010; Beaume et al. 2010; Bohn et al. 2010). Accordingly, we and others have found that S. aureus produces a set of extremely stable RNAs that lack an obvious open reading frame in a growth and/or stress dependent manner (Pichon and Felden 2005; Anderson et al. 2006; Roberts et al. 2006). Further, it has been found that at least two of these molecules regulate gene expression (Miller and Dunman, unpublished). A survey of the transcripts that are produced in response to acid- or alkaline-shock conditions indicates that the organism produces 9 stable RNA species that do not contain an open reading frame in response to pH stress. It is intriguing to consider that these molecules may behave as sRNAs and regulate biological processes that contribute to S. aureus pH adaptation. It was also observed that several putative ribonucleases were down-regulated in response to each pH stress condition. Thus, the altered mRNA turnover properties of acid- and alkaline-shocked S. aureus may be a function of any one (or a combination) of these possible ribonucleases, sRNA like molecules or both. Studies are currently underway to define the molecular components that modulate pH stress dependent changes in mRNA turnover, as small molecules that affect their activity would be expected to limit the organism’s ability to adapt to pH stress and could be considered for therapeutic development.

Supplementary Material

Supp Table S1. Supplementary Table 1.

S. aureus sRNA-like molecules that are produced in response to acid-or alkaline-shock conditions.

Table 5.

Genes down-regulated in response to alkaline pH.

Category and qualifier*	Fold reduction	mRNA half-life (min)		Gene	Locus†	Description
		pH 7.2	pH 10
Amino acid transport and metabolism
sa_c6513s5681_a_at	4.3	2.5	2.5	arcC	SA2654	carbamate kinase
sa_c6521s5689_a_at	2.4	2.5	ND	arcD	SA2655	arginine/ornithine antiporter
sa_c2196s1895_a_at	2.9	2.5	5	aroA	SA1504	3-phosphoshikimate 1-carboxyvinyltransferase
sa_c2199s1902_a_at	4.4	2.5	5	aroB	SA1505	3-dehydroquinate synthase
sa_c2759s2334_a_at*	4.5	2.5	2.5	aroE	SA1652	shikimate 5-dehydrogenase
sa_c9420s8234_a_at*	3.4	2.5	ND	betA	SA2627	choline dehydrogenase
sa_c7587s6607_a_at	2.3	2.5	2.5	cysE	SA0575	serine acetyltransferase
sa_c7368s9209_a_at*	7.8	2.5	2.5	cysM	SA0502	cysteine synthase/cystathionine beta-synthase family protein
sa_c5246s4544_a_at*	8.4	2.5	5	gltS	SA2340	sodium:glutamate symporter
sa_c4081s3441_a_at	2.1	2.5	ND	ggt	SA0188	gamma-glutamyltranspeptidase
sa_c1139s920_a_at*	11.8	2.5	2.5	IspA	SA1208	lipoprotein signal peptidase
sa_c3744s3222_a_at	2.6	2.5	2.5	map	SA1946	methionine aminopeptidase,
sa_c10721s11169cv_s_at	9.0	2.5	2.5	metB	N315-SA0419	cystathionine gamma-synthase
sa_c3445s9086_a_at*	30.3	2.5	2.5	metK	SA1837	S-adenosylmethionine synthetase
sa_c7740s6743_a_at	3.3	2.5	2.5	proP	SA0620	osmoprotectant proline transporter
sa_c8210s7190_a_at	8.0	2.5	ND	pabA	SA0773	para-aminobenzoate synthase, glutamine amidotransferase, component II
sa_c6360s5530_a_at	2.4	2.5	2.5	panC	SA2614	pantoate--beta-alanine ligase
sa_c6355s5526_a_at	2.6	2.5	2.5	panD	SA2613	aspartate alpha-decarboxylase
sa_c3866s3337_a_at	5.7	2.5	ND	pheA	SA1977	prephenate dehydratase
sa_c6088s5276_a_at	3.8	2.5	5	sdaAA	SA2544	L-serine dehydratase, iron-sulfur-dependent, α
sa_c6092s5283_a_at*	6.5	2.5	ND	sdaAB	SA2545	L-serine dehydratase, iron-sulfur-dependent, β
sa_c8697s7646_a_at	7.7	2.5	2.5	spsA	SA0968	signal peptidase IA, inactive
sa_c5023s4322_at**	2.6	15	ND	ureA	SA2280	urease, γ
sa_c5029s4326_a_at**	3.9	15	ND	ureB	SA2281	urease, β
sa_c5031s4330_a_at	6.2	15	ND	ureC	SA2282	urease, α
sa_c9293s8136_a_at	4.3	2.5	ND	ureD	SA2286	urease accessory protein
sa_c5035s4334_at	5.4	5	ND	ureE	SA2283	urease accessory protein
sa_c5039s4340_a_at	5.2	15	ND	ureF	SA2284	urease accessory protein
sa_c5043s4344_a_at	3.6	2.5	2.5	ureG	SA2285	urease accessory protein
sa_c3997s3420_a_at	3.8	2.5	ND		SA0184	peptide ABC transporter
sa_c6776s5917_a_at	2.1	2.5	2.5		SA0262	choloylglycine hydrolase family
sa_c7372s10188cs_s_at*	7.3	2.5	2.5		SA0503	trans-sulfuration enzyme family
sa_c7431s6453_a_at*	3.5	2.5	2.5		SA0519	acetyltransferase, GNAT family
sa_c7445s6465_a_at	2.8	2.5	ND		SA0523	Orn/Lys/Arg decarboxylase
sa_c7688s6694_a_at	3.8	2.5	2.5		SA0606	HAD superfamily hydrolase
sa_c7879s6872_at	2.6	2.5	2.5		SA0667	HAD superfamily hydrolase
sa_c368s210_a_at	2.2	2.5	ND		SA1000	oligopeptide ABC transporter,
sa_c9067s7955_a_at	2.9	2.5	5		SA1036	putative protease
sa_c10308s8994_a_at	2.5	2.5	2.5		SA1051	isochorismate synthase family
sa_c5349s4625_a_at*	28.6	2.5	ND		SA1108	spermidine/putrescine ABC transporter
sa_c9028s7925_a_at*	15.0	2.5	ND		SA1109	spermidine/putrescine ABC transporter
sa_c795s596_a_at*	17.0	2.5	5		SA1110	spermidine/putrescine ABC transporter
sa_c803s604_a_at*	7.9	2.5	2.5		SA1111	spermidine/putrescine ABC transporter
sa_c1215s998_a_at*	6.8	2.5	2.5		SA1231	protein phosphatase 2C domain-containing protein
sa_c10578s11035_s_at*	6.3	2.5	2.5		SA1232	protein kinase
sa_c1368s1139_a_at	4.5	2.5	2.5		SA1281	putative membrane-associated zinc metalloprotease
sa_c1852s1575_a_at	2.7	2.5	2.5		SA1412	hydrolase-related protein
sa_c1866s1587_a_at	5.6	2.5	ND		SA1414	peptide ABC transporter
sa_c1870s1592_a_at	4.9	2.5	ND		SA1415	peptide ABC transporter
sa_c1872s1598_a_at	7.6	2.5	ND		SA1416	putative peptide ABC transporter
sa_c1876s1602_a_at	6.9	2.5	ND		SA1417	peptide ABC transporter
sa_c2551s9779_a_at	2.1	2.5	2.5		SA1588	proline dipeptidase
sa_c9627s8384_a_at	4.3	2.5	2.5		SA1654	HAD superfamily hydrolase
sa_c9565s8328_a_at	3.4	2.5	2.5		SA1667	peptidase, U32 family
sa_c9562s8324_a_at	5.0	2.5	2.5		SA1668	peptidase, U32 family
sa_c2817s2385_a_at	6.2	2.5	2.5		SA1669	O-methyltransferase family protein
sa_c9532s8312_a_at	3.1	2.5	2.5		SA1677	aminotransferase, class V
sa_c2910s2472_a_at*	3.9	2.5	2.5		SA1698	hypothetical protein
sa_c3042s9391_a_at	2.9	2.5	2.5		SA1728	amino acid permease
sa_c3178s2725_a_at*	3.1	2.5	ND		SA1765	aminotransferase, class V
sa_c5373s4646_a_at*	2.6	2.5	ND		SA1915	amino acid ABC transporter
sa_c3655s3137_a_at	3.3	5	ND		SA1916	amino acid ABC transporter,
sa_c3759s3231_a_at	3.3	2.5	2.5		SA1950	putative cobyric acid synthase
sa_c3810s3279_a_at	2.9	2.5	ND		SA1963	high affinity proline permease
sa_c4189s3541_a_at	4.9	2.5	2.5		SA2038	O-sialoglycoprotein endopeptidase
sa_c4197s3549_at	7.3	2.5	2.5		SA2039	putative ribosomal-protein-alanine acetyltransferase
sa_c9831s8573_a_at	4.2	2.5	2.5		SA2107	phosphotyrosine phosphatase
sa_c4460s3803_a_at*	3.6	2.5	2.5		SA2109	modification methylase
sa_c5126s4423_a_at*	4.2	2.5	2.5		SA2309	amino acid permease
sa_c5389s4662_a_at	3.6	2.5	ND		SA2410	amino acid ABC transporter
sa_c5638s4893_a_at*	13.9	2.5	2.5		SA2412	amino acid ABC transporter
sa_c8215s7194_a_at	4.1	2.5	2.5		SACOL0774	putative para-aminobenzoate synthase, component I, authentic frameshift
Carbohydrate transport and metabolism
sa_c8171s9308_a_at	24.0	2.5	2.5	fruA	N315-SA0655	fructose specific permease
sa_c8169s7149_a_at	15.4	2.5	2.5	fruK	SA0758	1-phosphofructokinase
sa_c5217s4516_a_at	4.2	2.5	2.5	galM	SA2332	aldose 1- epimerase
sa_c7032s9332_a_at*	15.9	2.5	ND	glpT	SA0407	glycerol-3-phosphate transporter
sa_c5987s5189_a_at	2.9	2.5	ND	gntP	SA2514	gluconate transporter
sa_c5995s5196_a_at	4.6	2.5	ND	gntK	SA2515	gluconokinase
sa_c6202s5382_a_at	3.2	2.5	15	lacA	SA2570	galactoside O-acetyltransferase
sa_c10479s10921_s_at	4.0	2.5	2.5	manA1	SA2135	mannose-6-phosphate isomerase
sa_c6557s5724_a_at	5.9	2.5	ND	manA2	SA2664	mannose-6-phosphate isomerase
sa_c8176s7154_a_at	2.5	2.5	2.5	nagA	SA0761	N-acetylglucosamine-6-phosphate deacetylase
sa_c6517s5684_a_at	2.2	2.5	5	rbsK	SA0253	ribokinase
sa_c9971s8667_a_at	2.5	2.5	2.5	rpe	SA1235	ribulose-phosphate 3-epimerase
sa_c8397s7370_a_at*	2.1	15	15	tpiA	SA0840	triosephosphate isomerase
sa_c3742s3217_a_at*	20.9	5	5		SA0175	PTS system, IIABC components
sa_c6561s5728_a_at	3.2	2.5	ND		SA0254	ribose transport protein
sa_c9189s8052_a_at	3.1	2.5	ND		SA0315	putative N-acetylmannosamine-6-P epimerase
sa_c7012s6133_a_at	3.8	2.5	ND		SA0402	PTS system, IIA component
sa_c7422s6445_a_at*	7.7	2.5	ND		SA0517	alpha-amylase family protein
sa_c8584s7543_at	3.0	2.5	2.5		SA0931	hydrolase, haloacid dehalogenase
sa_c1132s914_a_at	2.7	2.5	2.5		SA1207	glyoxalase family protein
sa_c3212s2761_a_at*	10.3	2.5	ND		SA1775	PTS system, IIBC components
sa_c4153s3505_a_at	2.2	2.5	2.5		SA2028	putative fructokinase
sa_c4572s3904_a_at	4.3	2.5	ND		SA2146	PTS system, mannitol-specific IIBC components
sa_c5504s9245_a_at*	5.1	2.5	5		SA2376	putative PTS system, sucrose-specific IIBC components
sa_c6096s5287_a_at*	9.3	2.5	ND		SA2546	putative perfringolysin O regulator protein
sa_c6555s5722_a_at	3.7	2.5	ND		SA2663	PTS system, fructose-specific IIABC components
Inorganic ion transport and metabolism
sa_c5254s4551_a_at	2.4	2.5	2.5	corA	SA2342	putative magnesium and cobalt transport protein
sa_c418s255_a_at	3.8	2.5	2.5	mgtE	SA1013	magnesium transporter
sa_c8659s7606_a_at	2.1	2.5	2.5	mnhA	SA0955	Na+/H+ antiporter
sa_c9129s7998_a_at	2.2	2.5	5	mnhC	SA0953	Na+/H+ antiporter
sa_c9132s8002_a_at	4.6	5	15	mnhE	SA0951	Na+/H+ antiporter
sa_c8649s7599_a_at	3.4	5	5	mnhF	SA0950	Na+/H+ antiporter
sa_c8645s7595_a_at	4.1	2.5	15	mnhG	SA0949	Na+/H+ antiporter
sa_c4995s10003_a_at	10.8	5	ND	modA	SA2272	molybdenum ABC transporter
sa_c4991s4295_a_at	7.9	2.5	5	modB	SA2271	molybdenum ABC transporter,
sa_c4989s4292_a_at*	10.2	2.5	ND	modC	SA2270	molybdenum ABC transporter
sa_c1230s1008_at	3.5	5	ND	sirA	SA0099	iron compound ABC transporter
sa_c1172s953_a_at	2.0	2.5	ND	sirB	SA0098	iron compound ABC transporter
sa_c7236s6302_a_at*	11.5	2.5	ND		SA0454	sodium:dicarboxylate symporter
sa_c7333s6374_a_at*	2.4	15	ND		SA0491	putative cobalamin synthesis
sa_c7475s6499_a_at*	6.0	2.5	2.5		SA0531	tetrapyrrole methylase family
sa_c7871s6863_a_at*	4.1	2.5	2.5		SA0665	putative iron compound ABC transporter
sa_c7875s6868_a_at	4.2	2.5	ND		SA0666	iron compound ABC transporter
sa_c7989s6976_at	2.2	2.5	2.5		SA0705	iron compound ABC transporter
sa_c7993s6980_at	2.6	2.5	5		SA0706	iron compound ABC transporter
sa_c8909s7826_a_at*	2.2	2.5	2.5		SA0722	phosphate transporter family protein
sa_c8284s7261_a_at	2.2	15	ND		SA0799	transferrin receptor
sa_c700s509_a_at	5.1	2.5	ND		SA1084	cobalt transport family protein
sa_c704s512_a_at	4.3	2.5	2.5		SA1085	ABC transporter
sa_c815s618cs_s_at	12.0	2.5	2.5		SA1114	Mn2+/Fe2+ transporter,
sa_c3862s3332_at	4.8	2.5	2.5		SA1976	nitric-oxide synthase
sa_c4536s3879_a_at	4.4	2.5	15		SA2138	cation efflux family protein
sa_c4778s4087_a_at	3.0	2.5	2.5		SA2209	cobalt transport family protein
sa_c5160s4458_a_at*	12.5	2.5	2.5		SA2319	Na+/H+ antiporter family
sa_c5500s4763_a_at	5.8	2.5	2.5		SA2375	CorA family
sa_c5522s4780_a_at*	5.1	2.5	2.5		SA2382	proton/sodium-glutamate symporter
sa_c5534s4791_a_at*	7.6	2.5	ND		SA2386	nitrite extrusion protein
sa_c10691s11141cv_s_at	5.3	2.5	2.5		SA2718	anion transporter family protein
sa_c422s9317_a_at	4.0	2.5	5		SA1014	putative Na+/H+ antiporter
Lipid transport and metabolism
sa_c3108s2661_a_at	2.7	2.5	2.5	accA	SA1747	acetyl-CoA carboxylase carboxyltransferase α
sa_c2541s2121_a_at	6.8	2.5	2.5	accB	SA1572	acetyl-CoA carboxylase, biotin carboxyl carrier protein
sa_c2537s2117_a_at	5.5	2.5	2.5	accC	SA1571	acetyl-CoA carboxylase biotin carboxylase subunit
sa_c3110s2665_a_at	4.1	2.5	2.5	accD	SA1748	acetyl-CoA carboxylase β
sa_c1264s1041_at	3.0	15	30	acpP	SA1247	acyl carrier protein
sa_c9605s8367_a_at*	12.1	2.5	2.5	cdsA	SA1280	phosphatidate cytidylyltransferase
sa_c1624s9141_a_at	2.7	2.5	5	cls1	SA1351	cardiolipin synthetase
sa_c4357s3707_at	2.7	2.5	2.5	cls2	SA2079	cardiolipin synthetase
sa_c1260s1035_a_at*	12.0	2.5	2.5	fabD	SA1244	malonyl CoA-acyl carrier protein transacylase
sa_c318s157_a_at*	5.5	2.5	2.5	fabF	SA0988	3-oxoacyl-(acyl-carrier-protein) synthase II
sa_c9967s8662_at	6.4	2.5	5	fabG1	SA1245	3-oxoacyl-reductase, acyl-carrier
sa_c312s155_a_at	20.3	2.5	2.5	fabH	SA0987	3-oxoacyl-(acyl-carrier-protein) synthase III
sa_c7805s6807_a_at	2.2	2.5	2.5	mvk	SA0636	mevalonate kinase
sa_c1256s1031_a_at	7.9	2.5	2.5	plsX	SA1243	putative glycerol-3-phosphate acyltransferase
sa_c7092s6204_a_at	5.8	2.5	2.5		SA0426	acetyl-CoA acetyltransferase
sa_c8003s6987_a_at	4.5	2.5	ND		SA0708	DAK2 domain protein
sa_c8019s7004_a_at	5.2	2.5	2.5		SA0712	lipase/esterase
sa_c1242s1022_a_at*	3.6	2.5	2.5		SA1240	DAK2 domain protein
sa_c3216s2764_a_at	26.0	2.5	ND		SA1776	putative 1-acyl-sn-glycerol-3-phosphate acyltransferase
sa_c3830s3301_a_at	3.8	2.5	2.5		SA1967	geranylgeranylglyceryl phosphate synthase
sa_c10498s10949_s_at	2.8	2.5	ND		SA2278	acyl-CoA dehydrogenase-related
sa_c9318s8160_a_at	2.4	2.5	2.5		SA2345	putative esterase
sa_c6159s5341_a_at	4.1	2.5	2.5		SA2560	hydroxymethylglutaryl-CoA reductase
sa_c6163s5345_a_at	4.1	5	5		SA2561	hydroxymethylglutaryl-CoA synthase
sa_c6501s5670_a_at	2.6	2.5	2.5		SA2651	putative tributyrin esterase EstA
Nucleotide transport and metabolism
sa_c4816s4124_at*	3.6	15	15	adk	SA2218	adenylate kinase
sa_c2883s2448_at*	4.1	2.5	2.5	apt	SA1690	adenine phosphoribosyltransferase
sa_c1185s965_a_at	3.9	2.5	2.5	gmk	SA1221	guanylate kinase
sa_c9216s8076_a_at*	4.1	2.5	2.5	guaB	SA0460	inosine-5-monophosphate dehydrogenase
sa_c1697s1432_a_at*	19.0	2.5	5	guaC	SA1371	guanosine 5′-monophosphate oxidoreductase
sa_c7543s6563_at*	6.1	2.5	2.5	hpt	SA0554	hypoxanthine phosphoribosyltransferase
sa_c2771s2343_a_at	4.5	2.5	2.5	mtn	SA1655	5-methylthioadenosine/S-adenosylhomocysteine nucleosidase
sa_c8803s7743_a_at*	11.9	2.5	2.5	nupC	SA0566	nucleoside permease
sa_c9157s8026_a_at*	2.7	2.5	2.5	prsA	SA0544	ribose-phosphate pyrophosphokinas
sa_c65s61_a_at*	34.4	2.5	15	purA	SA0018	adenylosuccinate synthetase
sa_c10589s9063_a_at	2.8	2.5	2.5	purB	SA1969	adenylosuccinate lyase
sa_c9149s8019_a_at	4.9	2.5	2.5	purR	SA0539	pur operon repressor
sa_c1155s937_a_at*	8.2	2.5	ND	pyrC	SA1213	dihydroorotase
sa_c6327s5497_a_at*	7.6	2.5	2.5	pyrD	SA2606	dihydroorotate dehydrogenase 2
sa_c1167s950_a_at*	5.4	5	15	pyrF	SA1216	orotidine 5-phosphate decarboxylase
sa_c4482s3827_a_at	8.1	2.5	2.5	pyrG	SA2119	CTP synthase
sa_c9613s8375_a_at	2.8	2.5	2.5	pyrH	SA1277	uridylate kinase
sa_c1147s928_a_at*	13.2	2.5	2.5	pyrR	SA1210	pyrimidine regulatory protein
sa_c9829s8568_a_at*	3.9	2.5	2.5	tdk	SA2111	thymidine kinase
sa_c7447s6470_a_at	2.9	2.5	2.5	tmk	SA0524	thymidylate kinase
sa_c9569s8332_a_at*	3.5	2.5	2.5	udk	SA1666	uridine kinase
sa_c4446s3792_a_at*	2.1	2.5	15	upp	SA2104	uracil phosphoribosyltransferase
sa_c1151s932_a_at*	7.0	2.5	ND	uraA	SA1211	uracil permease
sa_c5453s4720_a_at	2.7	2.5	2.5		SA0225	inosine-uridine preferring nucleoside hydrolase
sa_c8842s7778_a_at	5.4	2.5	2.5		SA0603	deoxynucleoside kinase family
sa_c7681s6690_a_at*	17.1	2.5	ND		SA0604	deoxynucleoside kinase family
sa_c7687s9277_a_at	3.1	2.5	2.5		SACOL0605	cytidine/deoxycytidylate deaminase
sa_c9732s8478_a_at	6.1	2.5	ND		SA1509	nucleoside diphosphate kinase
sa_c2243s1939_a_at	4.6	2.5	5		SA1520	pyridine nucleotide-disulfide oxidoreductase
sa_c3024s2581_a_at	3.0	2.5	2.5		SA1724	MutT/nudix family protein
sa_c3186s2733_a_at	3.6	2.5	5		SA1768	GAF domain-containing protein
sa_c3455s2983_a_at	3.1	2.5	2.5		SA1841	MutT/nudix family protein
sa_c3597s3080_at	2.6	2.5	15		SA1894	HIT family protein
sa_c4896s4204_a_at*	7.1	2.5	2.5		SA2242	xanthine/uracil permease
sa_c5009s4311_a_at	2.0	2.5	ND		SA2276	inosine-uridine preferring nucleoside hydrolase
Energy production and conversion
sa_c3153s2701_a_at	2.0	2.5	2.5	ackA	SA1760	acetate kinase
sa_c4418s3765_a_at*	2.7	15	15	atpA	SA2097	F0F1 ATP synthase α
sa_c4434s3779_a_at*	3.5	15	15	atpB	SA2101	F0F1 ATP synthase subunit A
sa_c9843s8585_at*	2.9	15	15	atpC	SA2094	F0F1 ATP synthase ε
sa_c9839s8581_a_at*	2.4	15	15	atpD	SA2095	F0F1 ATP synthase β
sa_c4430s3777_at*	2.2	15	15	atpE	SA2100	F0F1 ATP synthase subunit C
sa_c4426s3773_a_at*	2.5	15	15	atpF	SA2099	F0F1 ATP synthase subunit B
sa_c4414s3760_at*	2.2	15	15	atpG	SA2096	F0F1 ATP synthase γ
sa_c4422s3769_a_at*	2.3	15	15	atpH	SA2098	F0F1 ATP synthase δ
sa_c6417s5584_a_at*	2.9	2.5	15	betB	SA2628	betaine aldehyde dehydrogenase
sa_c5252s4546_a_at	2.1	2.5	2.5	fni	SA2341	isopentenyl diphosphate isomerase
sa_c6467s5637_a_at	3.3	5	ND	gpxA2	SA2641	glutathione peroxidase
sa_c2505s2085_a_at	3.0	2.5	2.5	lpdA	SA1563	dihydrolipoamide dehydrogenase
sa_c9418s8233_a_at	2.6	5	5	mqo	SA2623	malate:quinone oxidoreductase
sa_c5574s4827_a_at*	11.9	2.5	ND	narG	SA2395	respiratory nitrate reductase α
sa_c5570s4822_a_at*	2.7	2.5	ND	narH	SA2394	respiratory nitrate reductase β
sa_c5564s4818_a_at*	2.8	5	ND	narJ	SA2393	respiratory nitrate reductase δ
sa_c3448s2976_a_at	2.9	15	ND	pckA	SA1838	phosphoenolpyruvate carboxykinase (ATP)
sa_c771s572_a_at	2.4	15	15	pdHA	SA1102	pyruvate dehydrogenase complex α
sa_c775s576_a_at	2.1	15	15	pdhB	SA1103	pyruvate dehydrogenase complex β
sa_c783s584_a_at	2.5	15	15	pdhD	SA1105	dihydrolipoamide dehydrogenase
sa_c623s446_a_at*	9.9	30	5	qoxA	SA1069	quinol oxidase, subunit I
sa_c9054s7945_a_at*	8.1	30	2.5	qoxB	SA1070	quinol oxidase, subunit II
sa_c619s442_at*	9.0	15	15	qoxC	SA1068	quinol oxidase, subunit III
sa_c615s436_at	12.3	15	15	qoxD	SA1067	quinol oxidase, subunit IV
sa_c969s761_a_at	3.3	2.5	2.5	sdhA	SA1159	succinate dehydrogenase flavoprotein subunit
sa_c10643s11097_s_at	3.2	2.5	5	sdhB	SA1160	succinate dehydrogenase iron-sulfur
sa_c965s755_at	4.5	2.5	5	sdhC	SA1158	succinate dehydrogenase, cytochrome b558 subunit
sa_c1326s1101_a_at	2.1	2.5	5	sucD	SA1263	succinyl-CoA synthase subunit α
sa_c4387s3735_a_at	2.5	2.5	ND		SA0197	Gfo/Idh/MocA family oxidoreductase
sa_c6021s5217_a_at	2.1	2.5	2.5		SA0241	alcohol dehydrogenase
sa_c6985s6107_a_at*	4.7	2.5	ND		SA0392	NADH-dependent flavin oxidoreductase, Oye family
sa_c8588s7547_a_at	2.2	2.5	5		SA0932	D-isomer specific 2-hydroxyacid dehydrogenase family protein
sa_c8625s7576_a_at	3.7	5	15		SA0944	putative NADH dehydrogenase
sa_c871s671_a_at	2.9	2.5	5		SA1130	putative glycerophosphoryl diester phosphodiesterase
sa_c2220s1920_a_at*	5.5	2.5	2.5		SA1514	glycerol-3-phosphate dehydrogenase, NAD-dependent
sa_c2448s2032_a_at	2.5	2.5	2.5		SA1545	short chain dehydrogenase/reductase family oxidoreductase
sa_c2493s2074_a_at	6.6	5	5		SA1560	2-oxoisovalerate dehydrogenase
sa_c2497s2076_a_at	8.5	5	2.5		SA1561	2-oxoisovalerate dehydrogenase
sa_c2501s2080_a_at	3.9	2.5	5		SA1562	2-oxoisovalerate dehydrogenase
sa_c3114s2669_a_at	4.5	2.5	2.5		SA1749	putative NADP-dependent malic
sa_c9227s8083_a_at	4.5	2.5	2.5		SA1914	putative iron-sulfur cluster-binding
sa_c5088s4384_a_at	2.1	5	15		SA2296	glycerate dehydrogenase
sa_c5092s4387_a_at	2.7	2.5	2.5		SA2297	hypothetical protein
sa_c5464s4730_a_at	4.2	2.5	2.5		SA2367	alcohol dehydrogenase
sa_c9395s8219_a_at	3.5	2.5	2.5		SA2569	1-pyrroline-5-carboxylate dehydrogenase
Transport
sa_c5292s9302_a_at	4.3	2.5	2.5	tcaB	SA2350	TcaB protein
sa_c3118s2672_a_at*	11.0	2.5	ND		SA0159	ABC transporter
sa_c4055s3432_a_at	3.3	2.5	ND		SA0187	RGD-containing lipoprotein
sa_c5387s4658_a_at*	4.1	2.5	5		SA0422	ABC transporter
sa_c1908s1632_a_at*	10.0	2.5	2.5		SA1427	ABC transporter
sa_c2626s2200_a_at*	5.1	2.5	2.5		SA1612	ABC transporter
sa_c3355s2890_a_at	12.0	2.5	ND		SA1809	putative drug transporter
sa_c5379s4651_a_at	4.7	2.5	5		SA1994	ABC transporter
sa_c3936s3405_a_at	4.0	2.5	5		SA1996	ABC transporter
sa_c4181s3535_a_at	2.4	2.5	2.5		SA2036	ABC transporter
sa_c4661s3981_a_at	2.4	2.5	ND		SA2170	putative ransporter
sa_c4937s4242_a_at	6.7	2.5	ND		SA2257	putative drug transporter
sa_c5801s5043_a_at*	5.8	2.5	2.5		SA2460	putative drug transporter
sa_c6017s5213_a_at*	4.8	2.5	2.5		SA2521	putative transporter
sa_c5345s4618_a_at*	2.3	2.5	5		SA2525	ABC transporter
sa_c6186s5364_a_at*	3.2	2.5	ND		SA2566	putative MmpL efflux pump
sa_c6475s5646_a_at	3.3	2.5	ND		SA2643	ABC transporter
sa_c5369s4644_a_at	2.6	2.5	ND		SA2644	ABC transporter
sa_c3043s2596_a_at*	3.3	2.5	ND		SACOL0158	ABC transporter
Coenzyme transport and metabolism
sa_c7555s6575_a_at	4.4	2.5	2.5	folB	SA0559	dihydroneopterin aldolase
sa_c2964s2521_a_at	9.4	2.5	2.5	folC	SA1709	folylpolyglutamate synthase/dihydrofolate synthase
sa_c7561s6578_a_at	6.7	2.5	2.5	folK	SA0560	hydroxymethyldihydropteridine pyrophosphokinase
sa_c9351s8180_a_at	2.4	2.5	2.5	hemB	SA1715	delta-aminolevulinic acid dehydratase
sa_c2992s2549_a_at	4.2	2.5	2.5	hemC	SA1717	porphobilinogen deaminase
sa_c2990s2545_a_at	3.1	2.5	2.5	hemD	SA1716	uroporphyrinogen-III synthase
sa_c3585s3067_a_at	2.8	2.5	2.5	hemE	SA1889	uroporphyrinogen decarboxylase
sa_c3577s3059_a_at	4.1	2.5	2.5	hemG	SA1887	protoporphyrinogen oxidase
sa_c3584s3063_a_at	2.8	2.5	2.5	hemH	SA1888	ferrochelatase
sa_c2984s2541_a_at	2.7	2.5	5	hemL	SA1714	glutamate-1-semialdehyde-2,1-aminomutase
sa_c2517s2095_a_at	5.9	2.5	2.5	ispA	SA1566	geranyltranstransferase
sa_c8772s7713_a_at	9.7	2.5	ND	kdtB	SA1134	lipopolysaccharide core biosynthesis protein
sa_c546s374_a_at	4.7	2.5	ND	menA	SA1049	1,4-dihydroxy-2-naphthoate octaprenyltransferase
sa_i2997d_x_at	2.0	2.5	2.5	menC	SA1843	putative o-succinylbenzoic acid (OSB) synthetase
sa_c552s378_a_at	2.5	2.5	2.5	menD	SA1052	2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylic acid synthase/2-oxoglutarate decarboxylase
sa_c4947s4252_a_at	3.1	2.5	2.5	moaA	SA2261	molybdenum cofactor biosynthesis
sa_c4977s4280_a_at	2.7	2.5	ND	moaB	SA2268	molybdenum cofactor biosynthesis
sa_c4955s4259_a_at	3.2	2.5	2.5	moaD	SA2263	molybdopterin converting factor
sa_c4959s4263_a_at	2.8	2.5	5	moaE	SA2264	molybdenum cofactor biosynthesis
sa_c4951s4255_a_at	2.9	2.5	2.5	mobA	SA2262	molybdopterin-guanine dinucleotide biosynthesis
sa_c4965s4269_a_at	2.4	2.5	5	mobB	SA2265	molybdopterin-guanine dinucleotide biosynthesis
sa_c4967s4271_a_at	3.1	2.5	2.5	moeA	SA2266	putative molybdopterin biosynthesis
sa_c2753s2324_a_at*	5.1	2.5	5	nadD	SA1650	nicotinate (nicotinamide) nucleotide adenylyltransferase
sa_c6363s5534_a_at	2.7	2.5	2.5	panB	SA2615	3-methyl-2-oxobutanoate hydroxymethyltransferase
sa_c6367s5538_a_at	4.6	2.5	5	panE	SA2616	2-dehydropantoate 2-reductase
sa_c3387s2918_a_at	6.6	2.5	2.5	ribBA	SA1818	riboflavin biosynthesis protein
sa_c3391s2919_a_at	7.1	2.5	ND	ribE	SA1819	riboflavin synthase, alpha subunit
sa_c1406s1179_a_at	2.7	2.5	2.5	ribF	SA1291	riboflavin biosynthesis protein
sa_c3173s2721_a_at*	19.7	2.5	2.5	thiI	SA1764	thiamine biosynthesis protein
sa_c7000s6122_a_at	3.5	2.5	5		SA0398	lipoate-protein ligase A family
sa_c8206s7186_a_at	6.7	2.5	2.5		SA0771	putative 6-pyruvoyl tetrahydrobiopterin synthase
sa_c8256s7233_at*	12.2	2.5	ND		SA0789	7-cyano-7-deazaguanine reductase
sa_c2206s1907_a_at	4.8	2.5	2.5		SA1510	polyprenyl synthetase
sa_c2210s1911_a_at	5.8	2.5	2.5		SA1511	ubiquinone/menaquinone biosynthesis methyltransferase
sa_c2711s2285_a_at*	6.8	2.5	2.5		SA1640	coproporphyrinogen III oxidase
sa_c9805s8544_a_at	8.4	2.5	5		SA2122	pantothenate kinase
Transcription
sa_c2166s1867_a_at	2.9	2.5	2.5	birA	SA1496	birA bifunctional protein
sa_c9676s8432_a_at	2.3	2.5	2.5	glk	SA1604	glucokinase
sa_c1490s1267_a_at	3.6	2.5	5	glpP	SA1317	glycerol uptake operon antiterminator regulatory protein
sa_c6194s5372_a_at*	3.5	2.5	2.5	lytR	SA0246	response regulator
sa_c8922s7839_a_at	5.0	2.5	2.5	norR	SA0746	transcriptional regulator, MarR family
sa_c1384s1156_a_at*	5.5	2.5	2.5	nusA	SA1285	transcription elongation factor
sa_c2529s2110_a_at	4.4	2.5	2.5	nusB	SA1569	transcription antitermination protein
sa_c7613s6627_at	2.7	2.5	2.5	nusG	SA0582	transcription antitermination protein
sa_c9825s8564_a_at	3.6	2.5	2.5	rho	SA2113	transcription termination factor
sa_c1268s1046_a_at	8.5	2.5	ND	rnc	SA1248	ribonuclease III
sa_c7637s6652_a_at*	2.5	15	15	ropC	SA0589	RNA polymerase β
sa_c4796s4102_at*	4.9	15	15	rpoA	SA2213	RNA polymerase α
sa_c7633s6648_a_at*	3.2	5	2.5	rpoB	SA0588	RNA polymerase β
sa_c2650s2225_a_at*	2.4	2.5	2.5	rpoD	SA1618	RNA polymerase sigma factor
sa_c9811s8552_a_at	3.6	2.5	2.5	rpoE	SA2120	RNA polymerase δ
sa_c1187s970_at	2.0	2.5	2.5	rpoZ	SA1222	RNA polymerase ο
sa_c9851s9296_a_at	2.7	2.5	2.5	rsbu	SA2057	sigma factor B regulator protein
sa_c1108s889_at	2.7	2.5	2.5	sarS	SA0096	staphylococcal accessory regulator
sa_c5056s4355_a_at*	7.7	2.5	ND	sarY	SA2289	staphylococcal accessory regulator
sa_c1214s994_a_at*	7.5	2.5	2.5	sun	SA1229	Sun protein
sa_c10502s10951cv_s_at	3.6	2.5	2.5	tcaR	SA2353	transcriptional regulator
sa_c3928s3395_a_at	2.2	2.5	ND		SA0179	phosphosugar-binding transcriptional regulator
sa_c7020s6143_a_at	2.9	2.5	ND		SA0404	transcriptional regulator
sa_c7120s6232_a_at	3.4	2.5	ND		SA0432	spoOJ protein
sa_c7424s6449_a_at	4.1	2.5	2.5		SA0518	GntR family transcriptional regulator
sa_c8164s7148_a_at	18.0	2.5	2.5		SA0757	DeoR family transcriptional regulator
sa_c8938s7854_at	12.2	2.5	ND		SA0772	exsB protein
sa_c791s594_at*	17.0	2.5	ND		SA1107	Cro/CI family transcriptional regulator
sa_c1250s1027_at	10.6	2.5	2.5		SA1242	fatty acid biosynthesis transcriptional regulator
sa_c9601s8362_a_at	2.2	2.5	2.5		SA1296	GntR family transcriptional regulator
sa_c9781s8524_a_at	6.1	2.5	2.5		SA1398	putative transcriptional regulator
sa_c3623s3103_a_at*	23.6	2.5	2.5		SA1904	putative transcriptional regulator
sa_c10590s9067_a_at	3.6	2.5	5		SA1997	GntR family transcriptional regulator
sa_c4177s3531_a_at	2.2	2.5	2.5		SA2035	redox-sensing transcriptional repressor
sa_c4577s3908_a_at	2.9	2.5	2.5		SA2147	BglG family transcriptional antiterminator
sa_c4931s4238_a_at	3.3	2.5	ND		SA2256	MarR family transcriptional regulator
sa_c446s279_a_at*	7.2	2.5	ND		SA2290	AraC family transcriptional regulator
sa_c5122s4419_at	4.0	2.5	2.5		SA2308	phosphosugar-binding transcriptional regulator, RpiR family
sa_c5187s4486_a_at	3.4	2.5	ND		SA2325	LysR family ranscriptional regulator
sa_c5496s4759_a_at	5.7	2.5	2.5		SA2374	TetR family transcriptional regulator
sa_c5510s4767_a_at	3.1	2.5	2.5		SA2378	AraC family transcriptional regulator
sa_c441s275_a_at**	3.3	5	ND		SA2593	TetR family transcriptional regulator,
sa_c6509s5677_a_at*	7.6	2.5	ND		SA2653	Crp/FNR family transcriptional regulator
sa_c1956s1681_a_at	9.1	2.5	ND		SA2731	CSD family cold shock protein
Translation
sa_c2837s2403_a_at	7.7	2.5	2.5	alaS	SA1673	alanyl-tRNA synthetase
sa_c7865s6854_a_at*	3.5	2.5	2.5	argS	SA0663	arginyl-tRNA synthetase
sa_c2160s1859_a_at	2.6	2.5	2.5	asnS	SA1494	asparaginyl-tRNA synthetase
sa_c1948s1673cv_x_at	2.7	2.5	5	cspA	N315-SA1234	major cold shock protein
sa_c10576s9058_a_at	3.0	2.5	2.5	def	SA1100	peptide deformylase
sa_c1203s985_a_at*	6.0	2.5	2.5	def2	SA1227	polypeptide deformylase
sa_c1207s989_a_at*	5.7	2.5	2.5	fmt	SA1228	methionyl-tRNA formyltransferase
sa_c1362s1136_a_at*	2.8	2.5	5	frr	SA1278	ribosome recycling factor
sa_c8835s7770_a_at*	2.9	15	15	fusA	SA0593	elongation factor G
sa_c3802s3271_a_at	3.5	5	5	gatB	SA1960	aspartyl/glutamyl-tRNA amidotransferase subunit B
sa_c9878s8614_a_at	5.5	5	5	gatC	SA1962	aspartyl/glutamyl-tRNA amidotransferase subunit C
sa_c7583s6603_a_at	6.9	2.5	2.5	gltX	SA0574	glutamyl-tRNA synthetase
sa_c1128s910_a_at	11.2	2.5	2.5	ileS	SA1206	isoleucyl-tRNA synthetase
sa_c4812s4120_at*	3.7	15	15	infA	SA2217	translation initiation factor IF-1
sa_c1394s1169_a_at*	5.3	2.5	5	infB	SA1288	translation initiation factor IF-2
sa_c2715s2289_a_at	4.9	2.5	2.5	lepA	SA1641	GTP-binding protein
sa_c3349s2883_a_at	8.9	2.5	2.5	leuS	SA1808	leucyl-tRNA synthetase
sa_c7567s6587_a_at	4.5	2.5	2.5	lysS	SA0562	lysyl-tRNA synthetase
sa_c7479s6503_a_at	2.9	2.5	2.5	metS	SA0533	methionyl-tRNA synthetase
sa_c1466s1245_a_at	4.6	2.5	2.5	miaB	SA1312	tRNA-i(6)A37 modification enzyme
sa_c8764s7707_a_at	4.1	2.5	2.5	pheS	SA1148	phenylalanyl-tRNA synthetase α
sa_c933s729_a_at	4.1	2.5	2.5	pheT	SA1149	phenylalanyl-tRNA synthetase β
sa_c1410s1184_a_at*	4.5	2.5	2.5	pnp	SA1293	polynucleotide phosphorylase
sa_c4462s3807_at*	6.2	2.5	2.5	prfA	SA2110	peptide chain release factor 1
sa_c8340s7313_at	3.4	2.5	2.5	prfB	SA0818	peptide chain release factor 2
sa_c10084s8804_a_at	5.4	5	5	queA	SA1695	S-adenosylmethionine:tRNA ribosyltransferase-isomerase
sa_c1398s1173_at	3.4	2.5	2.5	rbfA	SA1289	ribosome-binding factor A
sa_c1316s1090_a_at*	3.8	2.5	2.5	rbgA	SA1260	ribosomal biogenesis GTPase
sa_c1294s1067_a_at*	11.1	2.5	5	rimM	SA1255	16S rRNA processing protein
sa_c2422s2004_a_at	3.8	2.5	2.5	rluB	SA1536	ribosomal large subunit pseudouridine synthase B
sa_c7620s6631_a_at*	6.5	15	15	rplA	SA0584	50S ribosomal protein L1
sa_c9959s8654_a_at*	5.8	15	15	rplB	SA2236	50S ribosomal protein L2
sa_c4888s4195_a_at*	4.8	5	5	rplC	SA2239	50S ribosomal protein L3
sa_c4848s4156_at*	4.9	15	15	rplE	SA2227	50S ribosomal protein L5
sa_c9951s8647_at*	5.3	15	15	rplF	SA2224	50S ribosomal protein L6
sa_c7621s6634_a_at*	4.6	5	5	rplJ	SA0585	50S ribosomal protein L10
sa_c8818s7755_a_at*	2.9	15	15	rplK	SA0583	50S ribosomal protein L11
sa_c7625s6638_at*	10.8	2.5	15	rplL	SA0586	50S ribosomal protein L7/L12
sa_c9943s8640_a_at*	3.5	2.5	2.5	rplM	SA2207	50S ribosomal protein L13
sa_c9955s8651_a_at*	5.0	15	15	rplN	SA2229	50S ribosomal protein L14
sa_c4824s4130_a_at*	3.9	15	15	rplO	SA2220	50S ribosomal protein L15
sa_c4864s4170_at*	4.4	15	15	rplP	SA2232	50S ribosomal protein L16
sa_c4792s4098_at*	5.5	15	15	rplQ	SA2212	50S ribosomal protein L17
sa_c4836s4142_at*	4.2	15	15	rplR	SA2223	50S ribosomal protein L18
sa_c1302s1077_a_at*	7.2	15	15	rplS	SA1257	50S ribosomal protein L19
sa_c3028s2585_at*	19.5	2.5	2.5	rplT	SA1725	50S ribosomal protein L20
sa_c2926s2487_at*	4.4	5	15	rplU	SA1702	50S ribosomal protein L21
sa_c4872s4181_at*	3.7	15	15	rplV	SA2234	50S ribosomal protein L22
sa_c4852s4158_at*	4.1	15	15	rplX	SA2228	50S ribosomal protein L24
sa_c7511s6531_a_at*	5.9	15	5	rplY	SA0545	50S ribosomal Protein L25
sa_c2922s2484_a_at*	3.8	5	15	rpmA	SA1700	50S ribosomal protein L27
sa_c4860s4166_at*	5.1	15	15	rpmC	SA2231	50Sribosomal protein L29
sa_c4828s4134_at*	3.7	15	15	rpmD	SA2221	50Sribosomal protein L30
sa_c4466s3812_a_at	2.5	5	15	rpmE	SA2112	50S ribosomal protein L31
sa_c891s9388_a_at*	4.2	2.5	5	rpmF	SA1137	50S ribosomal protein L32
sa_c10253s8932_a_at	2.7	2.5	2.5	rpmH	SA2740	50S ribosomal protein L34
sa_c3032s2589_at*	16.1	2.5	5	rpmI	SA1726	50S ribosomal protein L35
sa_c4808s4116_at	2.3	15	15	rpmJ	SA2216	50S ribosomal protein L36
sa_c10332s10718_s_at	4.1	2.5	2.5	rpsB	SA1274	30S ribosomal protein S2
sa_c4868s4175_a_at*	5.1	15	15	rpsC	SA2233	30S ribosomal protein S3
sa_c4832s4138_at*	4.2	15	15	rpsE	SA2222	30S ribosomal protein S5
sa_c7136s6248_at*	6.7	15	5	rpsF	SA0437	30S ribosomal protein S6
sa_c8830s7766_a_at*	4.5	15	15	rpsG	SA0592	30S ribosomal protein S7
sa_c4840s4147_a_at*	5.9	15	15	rpsH	SA2225	30S ribosomal protein S8
sa_c4770s4080_a_at*	6.5	2.5	2.5	rpsI	SA2206	30S ribosomal protein S9
sa_c9963s8658_a_at*	4.7	5	15	rpsJ	SA2240	30S ribosomal protein S10
sa_c4800s4106_at*	5.5	15	15	rpsK	SA2214	30S ribosomal protein S11
sa_c7645s6658_a_at*	3.6	15	15	rpsL	SA0591	30S ribosomal protein S12
sa_c4804s4110_at*	3.6	15	15	rpsM	SA2215	30S ribosomal protein S13
sa_c4844s4152_at*	6.3	15	15	rpsN	SA2226	30S ribosomal protein S14
sa_c10032s8739_a_at	4.6	5	2.5	rpsO	SA1292	30S ribosomal protein S15
sa_c1290s1065_at*	5.5	2.5	5	rpsP	SA1254	30S ribosomal protein S16
sa_c10191s8871_a_at	3.9	15	15	rpsQ	SA2230	30S ribosomal protein S17
sa_c7144s6255_a_at*	11.5	5	15	rpsR	SA0439	30S ribosomal protein S18
sa_c4876s4184_at*	5.9	5	15	rpsS	SA2235	30S ribosomal protein S19
sa_c2719s2293_at*	2.1	15	15	rpsT	SA1642	30S ribosomal protein S20
sa_c35s30_a_at	13.8	2.5	5	serS	SA0009	seryl-tRNA synthetase
sa_c9438s8253_a_at*	4.7	5	5	tgt	SA1694	queuine tRNA-ribosyltransferase
sa_c8734s7676_a_at	11.2	2.5	5	thrS	SA1729	threonyl-tRNA synthetase
sa_c1300s1073_a_at*	10.9	2.5	5	trmD	SA1256	tRNA (guanine-N1)-methyltransferase
sa_c6837s5972_a_at*	3.8	2.5	2.5	trmE	SA2738	tRNA modification GTPase TrmE
sa_c376s218_a_at	4.4	2.5	5	trpS	SA1001	tryptophanyl-tRNA synthetase
sa_c4774s4084_a_at	4.6	2.5	5	truA	SA2208	tRNA pseudouridine synthase A
sa_c1404s1177_a_at	2.9	2.5	2.5	truB	SA1290	tRNA pseudouridine 55 synthase
sa_c8838s7774_a_at*	2.1	30	15	tuf	SA0594	translation elongation factor Tu
sa_c9619s8379_a_at	2.2	2.5	5	tsf	SA1276	translation elongation factor Ts
sa_c8748s7692_a_at*	10.9	2.5	2.5	tyrS	SA1778	tyrosyl-tRNA synthetase
sa_c2972s2529_a_at	11.7	2.5	2.5	valS	SA1710	valyl-tRNA synthetase
sa_c7499s6519_a_at	3.2	2.5	2.5		SA0540	putative endoribonuclease L-PSP
sa_c7535s6554_a_at	2.2	2.5	2.5		SA0552	hypothetical protein
sa_c7597s6610_a_at	2.5	2.5	5		SA0578	RNA methyltransferase,
sa_c7641s6656_a_at*	3.9	15	15		SA0590	30S ribosomal protein L7 Ae-like
sa_c8103s7087_a_at	2.7	2.5	2.5		SA0739	acetyltransferase, family
sa_c414s251_a_at	3.6	2.5	2.5		SA1012	ribosomal large subunit pseudouridine synthase D
sa_c9033s7929_a_at	3.0	2.5	2.5		SA1098	metallo-beta-lactamase family protein
sa_c929s726_at	3.2	2.5	2.5		SA1147	RNA methyltransferase,
sa_c1143s924_a_at*	10.3	2.5	2.5		SA1209	ribosomal large subunit pseudouridine synthase D
sa_c1390s1164_a_at*	6.1	2.5	2.5		SA1287	30S ribosomal protein L7 AE
sa_c2454s2037_a_at	4.5	2.5	2.5		SA1548	AtsA/ElaC family protein
sa_c3306s2847_a_at	3.6	2.5	2.5		SA1798	tRNA (guanine-N(7)-)-methyltransferase
sa_c3631s3112_a_at	3.9	2.5	2.5		SA1907	ribosomal large subunit pseudouridine synthase D
sa_c3647s3130_a_at*	5.5	2.5	2.5		SA1913	RNA methyltransferase,
sa_c3790s3262_a_at	4.2	2.5	5		SA1957	RNA methyltransferase,
Posttranslational modification, protein turnover, chaperone
sa_c3012s2568_a_at	3.1	2.5	2.5	clpX	SA1721	ATP-dependent protease
sa_c855s656_a_at*	5.9	2.5	2.5	ctaA	SA1124	cytochrome oxidase assembly
sa_c2996s2553_a_at	6.6	2.5	2.5	hemX	SA1718	hemX protein
sa_c3016s2573_a_at	2.4	5	5	tig	SA1722	trigger factor
sa_c9167s8035_a_at	4.6	2.5	2.5		SA0556	chaperonin, 33 kDa
sa_c8202s7182_a_at	4.0	2.5	2.5		SA0770	radical activating enzyme family
Replication, recombination and repair
sa_c2162s1863_a_at	3.0	2.5	2.5	dinG	SA1495	DNA polymerase III ε
sa_c2656s2229_a_at	3.2	2.5	2.5	dnaG	SA1619	DNA primase
sa_c8736s7680_a_at	3.4	2.5	2.5	dnaI	SA1731	primosomal protein
sa_c7435s6457_a_at	2.6	2.5	2.5	dnaX	SA0520	DNA polymerase III γτ
sa_c1478s1255_a_at	3.1	2.5	2.5	hexA	SA1315	DNA mismatch repair protein
sa_c1488s1263_a_at	4.5	2.5	2.5	hexB	SA1316	DNA mismatch repair protein
sa_c7309s6364_a_at	3.3	2.5	2.5	hsdM2	SA1862	type I restriction-modification
sa_c10158s10584_at	2.5	2.5	2.5	int	N315-SA1835	hypothetical protein
sa_c3824s3292_a_at	3.3	2.5	5	ligA	SA1965	DNA ligase, NAD-dependent
sa_c2914s2476_a_at*	3.8	2.5	2.5	obgE	SA1699	GTPase
sa_c1768s1502_a_at	2.3	2.5	2.5	parE	SA1389	DNA topoisomerase IV subunit B
sa_c3826s3296_a_at	2.4	2.5	2.5	pcrA	SA1966	ATP-dependent DNA helicase
sa_c1376s1149_a_at	2.6	2.5	2.5	polC	SA1283	DNA polymerase III
sa_c7575s6595_a_at	2.9	2.5	2.5	radA	SA0572	DNA repair protein
sa_c2887s2452_a_at*	2.9	2.5	2.5	recJ	SA1691	single-stranded-DNA-specific exonuclease
sa_c2509s2087_a_at	2.6	2.5	2.5	recN	SA1564	DNA repair protein
sa_c7441s6461_a_at	2.3	2.5	5	recR	SA0522	recombination protein
sa_c2134s1838_at	4.6	2.5	2.5	recU	SA1489	Holliday junction-specific endonuclease
sa_c8711s7654_a_at	2.9	2.5	2.5	rexA	SA0971	exonuclease
sa_c1320s1091_a_at*	4.5	2.5	ND	rnhB	SA1261	ribonuclease HII
sa_c2908s2469_a_at*	5.0	2.5	2.5	ruvA	SA1697	Holliday junction DNA helicase
sa_c9430s8244_a_at*	4.1	2.5	2.5	ruvB	SA1696	Holliday junction DNA helicase
sa_c2429s2013_at	2.4	2.5	2.5	scpA	SA1538	segregation and condensation protein A
sa_c2426s2008_a_at	2.5	2.5	2.5	scpB	SA1537	segregation and condensation protein B
sa_c7140s6251_at*	4.5	15	15	ssb	SA0438	single-stranded DNA-binding protein
sa_c7768s6771_a_at	6.1	2.5	2.5	ung	SA0627	uracil-DNA glycosylase
sa_c2525s2106_a_at	8.2	2.5	2.5	xseA	SA1568	exodeoxyribonuclease VII, large subunit
sa_c2521s2102_a_at*	8.7	2.5	2.5	xseB	SA1567	exodeoxyribonuclease VII, small subunit
sa_c7458s6479_a_at	5.0	2.5	2.5		SA0526	putative DNA polymerase III δ′
sa_c9145s8014_a_at	3.0	2.5	2.5		SA0534	deoxyribonuclease, TatD family
sa_c7541s6559_a_at*	6.9	2.5	2.5		SA0553	hypothetical protein
sa_c953s746_a_at	3.0	2.5	2.5		SA1153	hypothetical protein
sa_c959s748_a_at	2.3	2.5	2.5		SA1154	recombination and DNA strand exchange inhibitor protein
sa_c1344s1117_a_at*	6.2	2.5	ND		SA1266	putative DNA processing protein DprA
sa_c1522s1300_a_at	3.7	2.5	2.5		SA1326	putative GTP-binding protein
sa_c1643s1381_at*	6.3	2.5	ND		SA1357	thermonuclease
sa_c2640s2213_a_at	11.4	2.5	2.5		SA1615	ATP dependent DNA helicase
sa_c2726s2297_a_at	3.6	2.5	2.5		SA1643	DNA polymerase III δ
sa_c2861s2424_a_at	4.0	2.5	2.5		SA1682	recombination factor protein RarA
sa_c2977s2534_a_at	2.3	2.5	2.5		SA1711	DNA-3-methyladenine glycosylase
sa_c3053s2604_a_at*	4.0	2.5	2.5		SA1732	replication initiation and membrane attachment protein
sa_c3611s3091_at	2.5	2.5	2.5		SA1900	DNA repair exonuclease
sa_c4309s3661_a_at	7.6	2.5	2.5		SA2072	ATP dependent DNA helicase
sa_c5962s10062cv_s_at	2.4	2.5	2.5		SA2499	putative helicase
sa_c1542s9612_at	3.1	2.5	ND		SACOL1573	integrase/recombinase
Signal transduction
sa_c6155s5336_a_at*	2.2	2.5	2.5	lytS	SA0245	sensor histidine kinase
sa_c831s632_a_at*	12.7	2.5	2.5	typA	SA1118	GTP-binding protein
sa_c69s68_a_at	2.0	2.5	2.5	yycG	SA0020	sensory box histidine kinase
sa_c4488s3831_a_at	2.8	2.5	2.5		SA0201	DNA-binding response regulator
sa_c4513s3855_a_at	2.5	2.5	2.5		SA0202	sensor histidine
sa_c8316s7293_a_at*	8.4	2.5	2.5		SA0809	GGDEF domain-containing protein
sa_c9202s8059_a_at	2.3	2.5	2.5		SA1906	putative sensor histidine kinase
sa_c5315s4596_a_at	2.5	2.5	ND		SA2358	DNA-binding response regulator
sa_c6481s5649_a_at	2.1	2.5	2.5		SA2645	putative sensor histidine kinase
sa_c6483s5653_a_at	3.8	2.5	5		SA2646	DNA-binding response regulator
Cell wall and membrane biogenesis
sa_c4317s3671_at	2.1	2.5	2.5	ddl	SA2074	D-alanylalanine synthetase
sa_c1100s881_a_at	4.7	2.5	5	divlB	SA1197	cell division protein
sa_c8601s7554_a_at	5.4	2.5	2.5	dltA	SA0935	D-alanine--D-alanyl protein ligase
sa_c6835s5969_a_at*	3.5	2.5	2.5	gidB	SA2736	glucose-inhibited division protein B
sa_c1848s1571_a_at	3.4	2.5	2.5	femA	SA1410	femA protein
sa_c5976s5182_a_at*	4.6	2.5	2.5	galU	SA2508	UTP-glucose-1-phosphate uridylyltransferase
sa_c2934s2498_a_at	2.5	2.5	2.5	mreC	SA1704	rod shape-determining protein
sa_c10310s8999_a_at*	5.8	2.5	ND	murAA	SA2092	UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1
sa_c8293s7271_a_at	4.1	2.5	2.5	murB	SA0801	UDP-N-acetylenolpyruvoylglucosamine reductase
sa_c459s9094_a_at	3.6	2.5	2.5	murE	SA1023	UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase
sa_c4313s3667_a_at	2.0	2.5	2.5	murF	SA2073	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
sa_c10005s8699_a_at	5.4	2.5	2.5	pbp1	SA1194	penicillin-binding protein 1
sa_c2140s1839_a_at	3.9	2.5	2.5	pbp2	SA1490	penicillin-binding protein 2
sa_c8117s7099_a_at	4.8	2.5	5	uppP	SA0743	undecaprenyl pyrophosphate phosphatase
sa_c9611s8371_a_at*	5.2	2.5	2.5	uppS	SA1279	undecaprenyl diphosphate synthase
sa_c1750s1485_a_at	2.7	2.5	ND		SA0117	polysaccharide extrusion protein
sa_c10723s11171cv_s_at	8.6	2.5	2.5		SA0507	LysM domain protein
sa_c7959s6944_a_at	2.1	2.5	2.5		SA0694	teichoic acids export protein
sa_c8942s7857_a_at	2.4	2.5	2.5		SA0778	sulfatase family protein
sa_c8964s7875_a_at	4.5	2.5	2.5		SA0810	glycosyl transferase
sa_c8344s7317_a_at	4.8	2.5	5		SA0820	LysM domain protein
sa_c524s9582cv_s_at	14.4	2.5	ND		SA1043	glycosyl transferase, group 1 family protein
sa_c2175s1875_a_at	2.4	2.5	2.5		SA1498	glycosyl transferase, group 1 family protein
sa_c10078s8796_a_at	7.4	2.5	2.5		SA1687	N-acetylmuramoyl-L-alanine amidase
sa_c2930s2494_a_at	3.9	2.5	2.5		SA1703	putative rod shape-determining protein MreD
sa_c3330s2873_at*	4.1	2.5	2.5		SA1804	polysaccharide biosynthesis protein
sa_c8776s7720_a_at*	6.2	2.5	2.5		SA1825	N-acetylmuramoyl-L-alanine amidase
sa_c3764s3235_a_at	3.8	2.5	2.5		SA1951	Mur ligase family protein
sa_c5094s4391_a_at*	11.7	2.5	2.5		SA2298	N-acetylmuramoyl-L-alanine amidase
Cell cycle control
sa_c9724s8471_a_at*	5.0	2.5	2.5	engA	SA1515	GTP-binding protein
sa_c3004s2562_a_at	3.4	2.5	2.5	engB	SA1720	GTPase
sa_c1104s883_a_at*	2.3	5	2.5	ftsA	SA1198	cell division protein
sa_c7547s6567_a_at	2.2	2.5	2.5	ftsH	SA0555	putative cell division protein
sa_c9453s8264_a_at*	3.0	2.5	2.5	gidA	SA2737	tRNA uridine 5-carboxymethylaminomethyl modification enzyme
sa_c847s650_a_at	4.7	2.5	2.5		SA1122	cell cycle protein FtsW
sa_c1124s904_a_at	4.4	2.5	2.5		SA1205	putative cell-division initiation protein
sa_c1274s1050_a_at	7.2	2.5	2.5		SA1250	putative chromosome segregation SMC protein
sa_c1423s1196_a_at	2.5	2.5	2.5		SA1295	FtsK/SpoIIIE family protein
Intracellular trafficking and secretion
sa_c1288s1061_a_at	4.3	2.5	2.5	ffh	SA1253	signal recognition particle protein
sa_c7609s6622_a_at	2.6	2.5	2.5	secE	SA0581	preprotein translocase
sa_c9947s8643_a_at*	3.6	15	15	secY	SA2219	preprotein translocase
sa_c6603s5771_a_at	3.2	2.5	ND	secY	SA2675	preprotein translocase
sa_c10080s8800_at*	7.9	5	15	yajC	SA1693	preprotein translocase
sa_c10265s8943_a_at	4.1	2.5	2.5		SA0418	mttA/Hcf106 family protein
sa_c2899s2464_a_at*	5.9	2.5	2.5		SA1692	bifunctional preprotein translocase
Virulence
sa_c3966s9857_a_at*	7.2	5	ND	chp	N315-SA1755	chemotaxis-inhibiting protein
sa_c4761s9994_a_at	8.3	15	ND	coa	N315-SA0222	staphylocoagulase precursor
sa_c4144s3498_a_at	4.1	2.5	5	hld	SA2022	delta-hemolysin
sa_c3556s9823_at	3.2	2.5	ND	sen	N315-SA1643	enterotoxin SeN
sa_c1082s9604_a_at*	2.2	15	15	spa	SA0095	protein A precursor
sa_c9481s10390_x_at	5.5	2.5	ND	yent1	N315-SA1645	enterotoxin
sa_c3561s9828_a_at*	4.6	2.5	ND	yent2	N315-SA1644	enterotoxin
sa_c7024s6147_a_at	6.7	2.5	ND		SA0405	MATE efflux family protein
sa_c2775s9782_at*	3.6	2.5	ND		SA1657	putative enterotoxin type A
sa_c5066s4362_a_at*	39.3	2.5	5		SA2291	staphyloxanthin biosynthesis
sa_c5082s4380_a_at*	37.0	2.5	ND		SA2295	taphyloxanthin biosynthesis
sa_c6250s5428_a_at*	4.6	2.5	ND		SA2581	staphyloxanthin biosynthesis
Resistance
sa_c5721s4964_a_at*	4.0	2.5	2.5	bcr	SA2437	bicyclomycin resistance protein
sa_c1968s1693_a_at	2.9	2.5	ND		SA0122	putative tetracycline resistance protein
sa_c342s182_a_at	11.0	2.5	ND		SA2347	EmrB/QacA family drug resistance transporter
sa_c346s186_a_at	2.4	2.5	ND		SA2413	EmrB/QacA family drug resistance transporter
Unknown function
sa_c3818s3290_a_at	2.2	2.5	5	camS	SA1964	hypothetical protein
sa_c1116s897_a_at	2.3	2.5	2.5	ylmF	SA1202	hypothetical protein
sa_c10327s9007_a_at	6.0	2.5	5	ylmG	SA1203	hypothetical protein
sa_c1122s901_a_at	4.5	2.5	2.5	ylmH	SA1204	YlmH protein
sa_c77s76_a_at	3.2	2.5	2.5	yycI	SA0022	hypothetical protein
sa_c25s24_a_at	6.9	2.5	ND		SA0007	hypothetical protein
sa_c9259s8103_a_at	4.1	2.5	ND		SA0255	hypothetical protein
sa_c7047s6159_a_at	4.7	2.5	ND		SA0411	hypothetical protein
sa_c7070s6181_a_at	3.3	2.5	ND		SA0419	hypothetical protein
sa_c7078s6191_a_at	3.2	2.5	ND		SA0421	hypothetical protein
sa_c7088s6200_a_at*	6.6	2.5	ND		SA0425	hypothetical protein
sa_c9086s7967cs_a_at	9.9	2.5	2.5		SA0450	hypothetical protein
sa_c7579s6599_a_at	5.8	2.5	2.5		SA0573	hypothetical protein
sa_c7714s6714_a_at	2.0	2.5	2.5		SA0613	hypothetical protein
sa_c7752s6755_at	2.4	2.5	ND		SA0623	hypothetical protein
sa_c7774s6775_a_at	4.4	2.5	2.5		SA0628	hypothetical protein
sa_c7776s6779_a_at	3.3	2.5	5		SA0629	hypothetical protein
sa_c7859s6850_at	3.5	2.5	2.5		SA0662	hypothetical protein
sa_c7985s6972_at	2.4	2.5	2.5		SA0703	hypothetical protein
sa_c8013s6998_a_at	26.8	2.5	2.5		SA0711	hypothetical protein
sa_c8905s7823_a_at*	2.5	2.5	2.5		SA0721	hypothetical protein
sa_c8079s7064_a_at	2.4	2.5	5		SA0734	hypothetical protein
sa_c8131s7116_a_at	2.1	2.5	2.5		SA0749	hypothetical protein
sa_c8147s7131_a_at	2.6	2.5	2.5		SA0752	hypothetical protein
sa_c8151s7135_at	2.2	2.5	ND		SA0753	hypothetical protein
sa_c8928s7841_a_at*	4.0	2.5	ND		SA0755	hypothetical protein
sa_c8200s7177_a_at	3.8	2.5	2.5		SA0769	hypothetical protein
sa_c8226s7201_a_at	4.6	2.5	2.5		SA0776	hypothetical protein
sa_c8228s7205_a_at*	4.1	2.5	2.5		SA0777	hypothetical protein
sa_c8262s7237_a_at*	4.4	2.5	ND		SA0790	hypothetical protein
sa_c8288s7265_a_at	4.1	2.5	2.5		SA0800	hypothetical protein
sa_c8296s7275_a_at*	8.4	2.5	ND		SA0802	hypothetical protein
sa_c8312s7292_a_at	4.5	2.5	2.5		SA0807	hypothetical protein
sa_c8958s7869_a_at	5.0	2.5	2.5		SA0808	hypothetical protein
sa_c8324s10230_a_at	4.2	2.5	2.5		SA0812	hypothetical protein
sa_c8360s7335_a_at	2.6	2.5	2.5		SA0827	hypothetical protein
sa_c8365s7337_a_at	3.1	2.5	2.5		SA0828	hypothetical protein
sa_c8463s7426_a_at*	6.5	2.5	ND		SA0864	hypothetical protein
sa_c8581s7540_a_at	3.0	2.5	2.5		SA0930	hypothetical protein
sa_c8595s7551_at	4.1	2.5	2.5		SA0934	hypothetical protein
sa_c8086s7067_a_at	2.3	2.5	2.5		SA0939	hypothetical protein
sa_c8693s7642_a_at	3.9	2.5	2.5		SA0967	hypothetical protein
sa_c429s262_a_at*	5.6	2.5	2.5		SA1017	hypothetical protein
sa_c439s269_a_at	3.8	2.5	2.5		SA1019	hypothetical protein
sa_c453s285_a_at	2.4	2.5	2.5		SA1021	hypothetical protein
sa_c463s294_a_at	7.6	2.5	2.5		SA1024	hypothetical protein
sa_c493s322_at	3.6	2.5	5		SA1035	hypothetical protein
sa_c517s346_a_at*	2.4	15	15		SA1041	hypothetical protein
sa_c521s9580_a_at	6.1	2.5	ND		SA1042	hypothetical protein
sa_c525s350_at*	4.6	2.5	5		SA1044	hypothetical protein
sa_c10307s8990_a_at	2.2	2.5	2.5		SA1050	hypothetical protein
sa_c9045s7941_a_at	3.7	2.5	ND		SA1086	hypothetical protein
sa_c712s522_a_at	2.0	2.5	2.5		SA1088	hypothetical protein
sa_c732s540_a_at	2.4	2.5	ND		SA1093	hypothetical protein
sa_c744s9414_a_at	2.8	2.5	2.5		SA1099	hypothetical protein
sa_c787s588_a_at	6.7	5	ND		SA1106	hypothetical protein
sa_c807s608_a_at*	3.0	2.5	2.5		SA1112	hypothetical protein
sa_c863s665_at*	5.7	2.5	5		SA1126	hypothetical protein
sa_c879s682_a_at	6.6	2.5	ND		SA1131	hypothetical protein
sa_c8780s7721_a_at*	13.0	2.5	ND		SA1132	hypothetical protein
sa_c883s684_a_at	7.3	2.5	2.5		SA1133	hypothetical protein
sa_c8768s7712_at	3.7	2.5	5		SA1136	hypothetical protein
sa_c945s9288_a_at	2.7	2.5	2.5		SA1151	hypothetical protein
sa_c949s742_at	6.2	2.5	2.5		SA1152	hypothetical protein
sa_c9975s8671_a_at*	8.4	2.5	2.5		SA1230	hypothetical protein
sa_c1226s1006_a_at	2.9	2.5	2.5		SA1236	hypothetical protein
sa_c1238s1018_a_at	3.9	2.5	2.5		SA1239	hypothetical protein
sa_c1378s1153_a_at	5.1	2.5	2.5		SA1284	hypothetical protein
sa_c10333s9011_a_at	7.2	2.5	5		SA1286	hypothetical protein
sa_c1453s1230_a_at*	4.3	2.5	2.5		SA1307	hypothetical protein
sa_c1470s1249_a_at	3.4	2.5	2.5		SA1313	hypothetical protein
sa_c1526s1304_a_at	3.1	2.5	2.5		SA1327	hypothetical protein
sa_c1699s1436_a_at*	4.0	2.5	2.5		SA1373	hypothetical protein
sa_c1711s1447_a_at*	4.7	5	5		SA1378	hypothetical protein
sa_c1723s1460_a_at	2.2	2.5	2.5		SA1380	hypothetical protein
sa_c1762s1498_a_at*	4.9	2.5	2.5		SA1388	hypothetical protein
sa_c1785s1516_a_at	3.0	2.5	2.5		SA1394	hypothetical protein
sa_c2050s1762_a_at	3.6	2.5	2.5		SA1464	hypothetical protein
sa_c2054s1766_a_at	3.0	2.5	2.5		SA1465	hypothetical protein
sa_c2058s1770_at	2.1	2.5	2.5		SA1466	hypothetical protein
sa_c2063s1774_a_at	3.4	2.5	2.5		SA1467	hypothetical protein
sa_c2066s1777_a_at*	36.6	2.5	ND		SA1468	hypothetical protein
sa_c2109s1814_a_at*	29.3	2.5	ND		SA1481	hypothetical protein
sa_c2120s1823_a_at*	13.1	2.5	2.5		SA1483	hypothetical protein
sa_c9740s8486_a_at	2.7	2.5	2.5		SA1485	hypothetical protein
sa_c2182s1883_a_at	3.1	2.5	ND		SA1501	hypothetical protein
sa_c9728s8474_a_at	3.6	2.5	2.5		SA1512	hypothetical protein
sa_c2489s2070_at	3.3	15	2.5		SA1558	hypothetical protein
sa_c2533s2114_at	4.6	2.5	2.5		SA1570	hypothetical protein
sa_c10583s11040_a_at	2.3	2.5	ND		SA1585	hypothetical protein
sa_c2611s2187_a_at	2.3	2.5	2.5		SA1605	hypothetical protein
sa_c10360s10752_s_at	2.3	2.5	2.5		SA1606	rhomboid family protein unknown function
sa_c2693s2265_a_at*	3.7	2.5	2.5		SA1633	hypothetical protein
sa_c2695s2269_a_at*	4.5	2.5	5		SA1634	hypothetical protein
sa_c2745s2315_a_at*	6.3	2.5	2.5		SA1647	hypothetical protein
sa_c9631s8387_a_at*	2.7	2.5	2.5		SA1648	hypothetical protein
sa_c2757s2330_a_at*	4.9	2.5	2.5		SA1651	hypothetical protein
sa_c9407s9231_a_at*	6.0	5	15		SA1701	hypothetical protein
sa_c2946s2510_a_at	3.4	2.5	ND		SA1706	hypothetical protein
sa_c2982s2536_a_at	3.5	2.5	5		SA1712	putative abrB protein
sa_c3020s2577_a_at	3.2	2.5	2.5		SA1723	hypothetical protein
sa_c3160s2708_a_at	3.7	5	5		SA1761	hypothetical protein
sa_c3170s2715_a_at*	12.3	2.5	ND		SA1763	hypothetical protein
sa_c3282s2825_a_at	3.0	2.5	2.5		SA1792	hypothetical protein
sa_c3286s2830_a_at	5.3	2.5	2.5		SA1793	hypothetical protein
sa_c3336s9800_a_at*	3.8	2.5	ND		SA1805	hypothetical protein
sa_c3357s2894_a_at	5.2	2.5	2.5		SA1810	hypothetical protein
sa_c10093s8829_at	3.0	2.5	2.5		SA1826	hypothetical protein
sa_c3441s2971_a_at*	2.7	2.5	2.5		SA1836	hypothetical protein
sa_c3481s3008_a_at*	3.2	2.5	5		SA1847	hypothetical protein
sa_c3485s3012_a_at	4.9	2.5	ND		SA1848	hypothetical protein
sa_c3491s9181_a_at*	5.5	2.5	ND		SA1850	hypothetical protein
sa_c3576s3055_a_at	3.4	2.5	2.5		SA1885	hypothetical protein
sa_c10110s8831_at	4.3	2.5	2.5		SA1890	hypothetical protein
sa_c3607s3087_a_at	2.0	2.5	2.5		SA1899	hypothetical protein
sa_c3681s3162_a_at	4.7	2.5	2.5		SA1923	hypothetical protein
sa_c3696s3175_a_at	2.2	2.5	2.5		SA1928	hypothetical protein
sa_c10117s8839_a_at	2.7	2.5	2.5		SA1934	hypothetical protein
sa_c3709s9185_a_at	5.9	2.5	2.5		SA1935	hypothetical protein
sa_c3750s3226_a_at	2.5	2.5	ND		SA1947	hypothetical protein
sa_c3786s3258_a_at	3.2	2.5	2.5		SA1956	hypothetical protein
sa_c3842s3311_at	2.2	2.5	5		SA1972	hypothetical protein
sa_c3846s3316_at	2.9	2.5	2.5		SA1973	hypothetical protein
sa_c3912s3381_at	3.1	2.5	2.5		SA1989	hypothetical protein
sa_c3916s3383_a_at	3.1	2.5	2.5		SA1990	hypothetical protein
sa_c3920s3388_at	4.9	2.5	2.5		SA1991	hypothetical protein
sa_c3924s3392_a_at*	3.6	2.5	5		SA1993	hypothetical protein
sa_c3932s3401_a_at*	5.4	2.5	5		SA1995	hypothetical protein
sa_c4171s3522_a_at*	14.8	2.5	ND		SA2033	hypothetical protein
sa_c4173s3526_a_at*	29.0	2.5	ND		SA2034	hypothetical protein
sa_c4203s3553_a_at	6.5	2.5	2.5		SA2040	hypothetical protein
sa_c4205s3557_a_at	3.1	2.5	2.5		SA2041	hypothetical protein
sa_c4285s3637_a_at	2.9	2.5	2.5		SA2063	hypothetical protein
sa_c4289s3643_a_at	2.3	2.5	ND		SA2064	hypothetical protein
sa_c4345s3694_at	3.2	2.5	5		SA2077	hypothetical protein
sa_c4361s3711_a_at	3.1	2.5	2.5		SA2080	hypothetical protein
sa_c4438s3783_a_at*	2.6	15	15		SA2102	hypothetical protein
sa_c4456s3801_a_at	6.2	2.5	2.5		SA2108	hypothetical protein
sa_c4480s3823_a_at	4.7	2.5	2.5		SA2118	hypothetical protein
sa_c4519s3864_a_at	2.6	2.5	2.5		SA2133	hypothetical protein
sa_c10171s8867_at	8.2	2.5	2.5		SA2134	hypothetical protein
sa_c10176s10598_s_at	4.8	2.5	5		SA2140	hypothetical protein
sa_c4593s3925_a_at*	2.2	2.5	2.5		SA2152	hypothetical protein
sa_c4635s3957_a_at	11.9	2.5	2.5		SA2164	hypothetical protein
sa_c10197s8880_a_at	7.0	2.5	ND		SA2250	hypothetical protein
sa_c4919s4228_a_at*	4.8	2.5	ND		SA2251	hypothetical protein
sa_c5005s4307_a_at*	4.4	2.5	ND		SA2275	BioY family protein
sa_i4391u_x_at	8.2	2.5	ND		SA2299	hypothetical protein
sa_c5114s4412_a_at	17.7	2.5	ND		SA2306	hypothetical protein
sa_c5138s4434_a_at	2.6	2.5	2.5		SA2312	hypothetical protein
sa_c5199s4501_a_at*	18.6	2.5	ND		SA2328	hypothetical protein
sa_c5211s4512_at	4.2	2.5	ND		SA2331	hypothetical protein
sa_c5219s4518_at	4.8	2.5	2.5		SA2333	hypothetical protein
sa_c5223s4525_a_at*	2.0	2.5	2.5		SA2334	hypothetical protein
sa_c5266s4564_a_at	2.2	2.5	2.5		SA2346	hypothetical protein
sa_c5274s4572_a_at	7.0	2.5	ND		SA2348	hypothetical protein
sa_c5480s4745_at	2.7	2.5	15		SA2371	hypothetical protein
sa_c5492s4755_a_at*	3.9	2.5	ND		SA2373	hypothetical protein
sa_c9334s8169_a_at*	5.1	2.5	2.5		SA2383	hypothetical protein
sa_c5606s4859_a_at*	2.1	2.5	ND		SA2402	hypothetical protein
sa_c5620s4877_a_at	3.2	2.5	2.5		SA2407	putative lipoprotein
sa_c5624s4878_a_at	5.7	2.5	2.5		SA2408	putative lipoprotein
sa_c5727s4967_a_at	6.0	2.5	ND		SA2438	hypothetical protein
sa_c5745s4988_a_at	9.6	2.5	ND		SA2443	hypothetical protein
sa_c5788s5026_a_at	2.0	2.5	2.5		SA2456	hypothetical protein
sa_c10518s10967_s_at	2.3	2.5	2.5		SA2520	hypothetical protein
sa_c9378s8205_a_at	2.2	2.5	2.5		SA2522	DedA family protein
sa_c6038s5239_a_at*	4.6	2.5	ND		SA2528	hypothetical protein
sa_c6151s5333_a_at*	6.2	2.5	ND		SA2557	hypothetical protein
sa_c10530s10985_s_at	2.4	2.5	ND		SA2599	hypothetical protein
sa_c6333s5501_a_at	4.9	2.5	2.5		SA2607	hypothetical protein
sa_c6424s5594_a_at	2.7	2.5	2.5		SA2630	hypothetical protein
sa_c6565s5735_a_at	2.8	2.5	2.5		SA2665	putative phage infection protein
sa_c6764s5905_a_at	3.7	2.5	2.5		SA2713	hypothetical protein
sa_c6815s10098_at*	2.3	2.5	ND		SA2728	hypothetical protein
sa_c6825s5958_a_at	2.4	2.5	ND		SA2733	hypothetical protein
sa_c9448s8258_a_at*	2.1	2.5	ND		SA2734	hypothetical protein
sa_c7843s6835_a_at	2.4	2.5	2.5		N315-SA0559	hypothetical protein
sa_c8143s7126_at	2.1	2.5	ND		N315-SA0647	hypothetical protein
sa_c8222s10227_at*	6.6	2.5	ND		N315-SA0671	hypothetical protein
sa_c9400s10363_at*	3.4	2.5	ND		N315-SA0692	hypothetical protein
sa_c9750s10427_at	3.6	2.5	ND		N315-SA1015	hypothetical protein
sa_c3428s2956_a_at	3.5	2.5	ND		N315-SA1600	hypothetical protein
sa_i9856dr_x_at	3.8	2.5	ND		N315-SA1753	hypothetical protein
sa_c3962s9856_a_at*	2.2	15	5		N315-SA1754	hypothetical protein
sa_c9895s10439_a_at	4.5	30	ND		N315-SA1759	hypothetical protein
sa_c3973s9865_a_at*	3.9	stable	ND		N315-SA1760	hypothetical protein
sa_c3979s9871_at*	5.2	stable	ND		N315-SA1762	hypothetical protein
sa_c9897s10440_s_at*	9.1	15	ND		N315SA1765	hypothetical protein
sa_c3992s9884_a_at*	6.8	15	ND		N315SA1766	hypothetical protein
sa_c3995s9886_a_at*	7.2	30	15		N315-SA1767	hypothetical protein
sa_c4003s9891_a_at*	3.9	30	ND		N315-SA1768	hypothetical protein
sa_c4005s9893_a_at*	9.4	30	ND		N315-SA1769	hypothetical protein
sa_c4009s9897_a_at*	5.8	2.5	2.5		N315-SA1770	hypothetical protein
sa_c4010s9899_at*	8.7	15	15		N315-SA1771	hypothetical protein
sa_c4012s9901_a_at*	8.5	15	15		N315-SA1772	hypothetical protein
sa_c4014s9903_a_at*	9.5	30	15		N315-SA1773	hypothetical protein
sa_c10670s11122_a_at	8.4	30	15		N315-SA1774	hypothetical protein
sa_c4020s9905_at*	5.9	15	ND		N315-SA1776	hypothetical protein
sa_c10134s10547_a_at	6.1	2.5	ND		N315-SA1777	hypothetical protein
sa_c8467s10245_s_at	2.1	2.5	ND		N315-SAS018	hypothetical protein
sa_c3959s9853_a_at	10.0	2.5	2.5		N315-SAS058	hypothetical protein
sa_c3047s2600_a_at	4.2	2.5	2.5		SA1730	hypothetical protein
sa_c3984s9875_at*	7.4	30	ND		SAR2047	hypothetical protein
sa_c10668s11120_a_at	8.2	30	ND		SAR2051	hypothetical protein
sa_c4001s9889_a_at*	6.8	30	15		SAR2053	hypothetical protein
sa_c3987s9878_at*	7.0	15	15		SAV1953	phi PVL ORF 20 and 21 homolog
sa_c7393s6421_a_at	2.2	2.5	2.5		SACOL0510	hypothetical protein
sa_c9380s9405_a_at*	3.1	2.5	ND		SACOL2526	hypothetical protein

^*Functional category and GeneChip^® qualifier indicated.

^†S. aureus strain COL locus unless otherwise indicated.

Abbreviations

SSRs

Small stable RNAs

S. aureus

Staphylococcus aureus