Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Dec 1.
Published in final edited form as: FEMS Immunol Med Microbiol. 2010 Oct 6;60(3):208–250. doi: 10.1111/j.1574-695X.2010.00736.x

Characterizing the Effects of Inorganic Acid and Alkaline Shock on the Staphylococcus aureus Transcriptome and Messenger RNA Turnover

Kelsi L Anderson 1,†, Christelle M Roux 1,†, Matthew W Olson 2, Thanh T Luong 3, Chia Y Lee 3, Robert Olson 4,5, Paul M Dunman 1,6,*
PMCID: PMC2999002  NIHMSID: NIHMS236499  PMID: 21039920

Abstract

Staphylococcus aureus pathogenesis can be partially attributed to its ability to adapt to otherwise deleterious host-associated stresses. Here, Affymetrix GeneChips® were used to examine the S. aureus responses to inorganic acid and alkaline shock and to assess whether stress dependent changes in mRNA turnover are likely to facilitate the organism’s ability to tolerate pH challenge. Results indicate that S. aureus adapts to pH shock by eliciting responses expected of cells coping with pH alteration, including neutralizing cellular pH, DNA repair, amino acid biosynthesis and virulence factor expression. Further, the S. aureus response to alkaline conditions is strikingly similar to that of stringent response induced cells. Indeed, we show that alkaline shock stimulates accumulation of the stringent response activator (p)ppGpp. Results also revealed that pH shock significantly alters the mRNA properties of the cell. A comparison of the mRNA degradation properties of transcripts whose titers either increased or decreased in response to sudden pH change revealed that alterations in mRNA degradation may, in part, account for the changes in the mRNA levels of factors predicted to mediate pH tolerance. A set of small stable RNA molecules were induced in response to acid or alkaline shock conditions and may mediate adaptation to pH stress.

Keywords: Staphylococcus aureus, acid shock, alkaline shock, virulence, mRNA turnover

INTRODUCTION

Steady-state messenger RNA levels are a function of both transcript synthesis and degradation. Yet studies of prokaryotic mRNA regulation have historically attributed regulated changes in mRNA titers as occurring at the level of transcript synthesis alone. Recent studies have shown that this is likely to be an oversimplification. Like messenger RNA synthesis, mRNA degradation is a highly regulated process that affects transcript titers and, consequently, gene expression [reviewed in (Anderson and Dunman 2009)]. For instance, during cold-shock conditions Escherichia coli increases production of CspA: a protein which resolves low temperature mediated mRNA secondary structures that would otherwise impede mRNA translation (Goldstein et al. 1990; Jones et al. 1996; Jiang et al. 1997). Upon temperature downshift, increased cspA mRNA stability, as opposed to increased transcript synthesis, primarily accounts for the elevated levels of CspA production (Goldenberg et al. 1996; Fang et al. 1997; Fang et al. 1999). Regulated changes in mRNA turnover are also well recognized to affect Vibrio angustum and Klebsiella pneumoniae adaptation to nutrient and nitrogen stress, respectively [Reviewed in (Takayama and Kjelleberg 2000)].

Staphylococcus aureus is a Gram-positive pathogen that is capable of causing various types of infections which range in severity from skin and soft tissue infections to life-threatening pneumonia and endocarditis (Gordon and Lowy 2008). Due, in part, to the emergence of antibiotic resistance and strains that are capable of causing infection in otherwise-healthy individuals S. aureus is now estimated to be responsible for more U.S. deaths annually than HIV/AIDS (Klevens et al. 2007; Boucher and Corey 2008). The organism’s ability to cause disease can be largely attributed to the production of an expansive repertoire of cell surface- and extracellular-virulence factors (Novick 2003; Bronner et al. 2004), as well as its ability to maintain cellular homeostasis while enduring host-associated and other environmental challenges (Voyich et al. 2005). Understanding virulence factor regulatory networks and the mechanisms by which the organism copes with otherwise detrimental environmental conditions may provide novel strategies for the therapeutic intervention of staphylococcal infections.

Recent studies indicate that regulated changes in mRNA turnover promote the organism’s ability to adapt to certain stress conditions. For instance, we have shown that S. aureus globally alters its mRNA turnover properties in response to temperature shock and stringent response inducing conditions (Anderson et al. 2006). Further stress dependent changes in transcript degradation correlate to changes in protein production, supporting the hypothesis that the modulation of mRNA turnover plays an important role in mediating the organism’s ability to adapt to environmental stress (Anderson et al. 2006). Interestingly, the global modulation of mRNA turnover does not seem to be a component of adaptation to all stresses, as the RNA degradation properties of SOS induced cells mimics that of unstressed S. aureus (Anderson et al. 2006).

Many S. aureus environmental- and host-associated niches are in continual pH fluctuation due to natural (menstruation) or artificial (exposure to cleaning agents) occurrences. Thus, to colonize, survive and ultimately cause infection, S. aureus must successfully acclimate to transient alterations in pH. Indeed, S. aureus colonizing the external labia must adapt to brief exposures to vaginal secretions [pH 3.8 to 4.5;(Manka et al. 2002)]. Similarly, although classically considered an extracellular pathogen, the organism is capable of invading and temporarily surviving within the lysosomal compartment (pH 4.5 to 5.5) before escaping into the cytosol of nonphagocytic cells (Jarry and Cheung 2006). The organism is also likely to encounter elevated pH environmental conditions (pH 8.9) at sites of wound secretions and must adapt to persist and cause disease (Schneider et al. 2007). Consequently, S. aureus is likely to have evolved biological mechanisms to cope with acidic and/or alkaline conditions that contribute to the organism’s ability to cause disease.

Recent microarray studies revealed that S. aureus does indeed respond to pH stress in an orchestrated manner that is likely to augment the organism’s ability to adapt to alterations in pH. Weinrick and colleagues showed that during steady-state mildly acidic growth (pH 5.5) S. aureus induces expression of gene products that are ostensibly involved in intracellular pH maintenance (ure operon), osmoprotection (opuC operon), and both acid and osmoprotection (kdp operon) (Booth 1985; Sleator and Hill 2002; Weinrick et al. 2004). Moreover, that study revealed that steady-state mild acid growth redirects expression of many of the organism’s virulence factors, in part, by diminishing the growth phase-dependent expression properties of the virulence regulatory locus, sae (Weinrick et al. 2004). More recently, Bore and colleagues showed that sudden inorganic acid stress (20 min pH 4.5) induces S. aureus acid-defense systems, including the ure operon, as well as other biological processes, such as proton efflux and DNA repair; these systems are likely to facilitate adaptation by maintaining intracellular pH homeostasis and repairing acidification-associated damage. Like steady-state acid stress, sudden acid exposure was also shown to decrease sae expression, and the expression properties of several virulence factor transcripts (Bore et al. 2007). In comparison to acid-shock conditions, less is known about the organism’s ability to adapt to alkaline stress. However, it is clear that alkaline conditions modulate numerous S. aureus cellular processes including virulence factor production. Indeed, Regassa and colleagues found that alkaline growth conditions decrease RNAIII expression and virulence factor production (Regassa and Betley 1992). More recently, Pané-Farré and colleagues identified 122 RNA species, including members of the capsule biosynthesis operon, an Na+/H+ antiporter system and autolysin, to be upregulated in response to sudden alkaline shock conditions (Pane-Farre et al. 2006). That study also revealed that the induction of most (59%) of alkaline shock genes is likely to occur via activation of the alternative sigma factor, σB.

In the current work Affymetrix GeneChips® were used to further characterize the S. aureus acid-and alkaline-shock responses and distinguish whether the modulation of mRNA turnover is likely to contribute the organism’s ability to adapt to extreme pH. As previously reported, we found that sudden inorganic acid exposure results in a physiological state that is geared toward acid-neutralization, transport, and increasing the organism’s reducing power while simultaneously reducing purine and pyrimidine ribonucleotide biosynthesis and proton motive force, but we also found that the response includes more members of the organism’s virulon than previously recognized and also includes such virulence factors as clumping factor B and protein A (Bore et al. 2007). Our results revealed that alkaline shock conditions results in a cellular state that is likely to promote alkaline-neutralization, diminishing oxidative stress-induced DNA and protein lesions, and increased capsule production. Further, we demonstrated that capsule expression is σB independent and does not appear to directly result in a protective effect during cellular growth at elevated pH. We also found that the organsim’s alkaline shock response is strikingly similar to that of the stringent response, which is required for S. aureus survival within the host. Mass-spectrometry confirmed that alkaline-shock conditions induce accumulation of the stringent response inducing factor ppGpp. Furthermore, we show that both acid- and alkaline-shock conditions profoundly alter the mRNA turnover properties of S. aureus cells. A survey of the transcript degradation properties of mRNA species that are either increased or decreased in response to acid or alkaline shock conditions suggests that key components of these pH adaptation responses are post-transcriptionally regulated in a manner that involves modulating their mRNA turnover. Finally, we also observed that a set of small non-coding stable RNA molecules (SSRs) were also components of each stress response. Given the importance of SSR-like molecules in other organisms, it is likely that these RNA species play an important role(s) in acid- and alkaline-responsive functions

MATERIALS & METHODS

Bacterial strain

Staphylococcus aureus strain UAMS-1 is a well-characterized osteomyelitis clinical isolate (Gillaspy et al. 1995; Cassat et al. 2005). S. aureus strains CYL6194 and UAMS-1274 are isogenic capsule and sigma β deficient strains, respectively (Gillaspy et al. 1998; Anderson et al. 2006).

Oligonucleotides

Oligonucleotides used in this study for quantitative reverse transcription-mediated PCR (qRT-PCR) and reverse transcription-mediated PCR (RT-PCR) are listed in Table 1.

Table 1.

Oligonucleotides used in this study.

Name Oligonucleotide sequence (5′-3′)
asp23-F TGTATCTGTTGAAGTTGGTGAAAAA
asp23-R TCTTTTTGAGTCATTACATCGTCAA

capA-F CCTCAGTTTATGGCGCAAGAGGTTC
capA-R GTGCGACTTTAACTGCTGTACCGTC

kdpD-F TTGAAGTATACCGCTTTGACTATCC
kdpD-R TTGATTAATTTGGTATCCAGCATTT

ureB-F GAAATGGCATATGGAAAACATTTAG
ureB-R TTTCAGTACCGTTATCTCCGAATAC

Growth Conditions

To assess the S. aureus response to acid or alkaline shock conditions, overnight cultures of UAMS-1 cells were inoculated 1:100 into fresh Brain Heart Infusion (BHI) broth and grown to early-exponential phase with aeration (250 RPM) at 37°C. Alkaline and acid shock responses were induced by adjusting/maintaining the pH of the culture medium to pH 10 with 1N NaOH or pH 4 with 1N HCl, respectively. For bacterial survival assays, a 50 μl of aliquot of cells was collected at 30 min and at every hour for a total of 6 hr after stress induction. Cells were serially diluted in 0.8% NaCl, plated on BHI plates, incubated overnight at 37°C and the number of viable colony forming units were enumerated and presented as Log10 cfu ml−1. For microarray studies, stress responses were induced for 30 min at which point 20 ml of cells were removed and mixed with an equal volume of ice-cold acetone:ethanol (1:1) solution and stored at −80°C until RNA isolation. To assess the mRNA turnover properties of alkaline and acid shocked cells, Rifampicin (Sigma, St. Louis, MO; 200 μg ml−1) was immediately added to the culture to arrest transcription and twenty-one ml of cells were removed at 0, 2.5, 5, 15, and 30 min post-transcriptional arrest. Twenty milliliters of each post-transcriptional arrest aliquot were added to an equal volume of ice-cold acetone:ethanol (1:1) solution and stored overnight at −80°C until RNA isolation; the remaining 1 ml of each aliquot was diluted in BHI and plated on to both BHI (10−7) and BHI containing Rifampicin (10−1) agar plates. Plates were incubated overnight at 37°C then colony forming units (cfu) were enumerated to assure that cellular proliferation was arrested and to monitor for Rifampicin resistance, as previously described (Anderson et al. 2006; Roberts et al. 2006). If Rifampicin resistant colonies were detected, the experiment was discarded and repeated. In total, at least two independent biological replicates corresponding to each pH condition (neutral, low or high pH) and post-transcriptional arrest time point were used for RNA isolation and GeneChip® analysis, as described below.

RNA purification

RNA was isolated and prepared for GeneChip® analysis as previously described (Beenken et al. 2004; Bischoff et al. 2004; Weinrick et al. 2004; Anderson et al. 2006; Roberts et al. 2006). Briefly, aliquots of acetone:ethanol cell suspensions equaling 1 × 109 cfu were pelleted by centrifugation at 3000 RPM for 10 min at 4°C. Cell pellets were washed twice then resuspended in 500 μl TE buffer (10mM Tris, 1mM EDTA, pH 7.6). Suspensions were then transferred to BIO101 lysing matrix B tubes (MP Biomedical; Pasadena, CA) and mechanically disrupted in a FastPrep120 shaker (MP Biomedical). Cell debris was collected by centrifugation at 4°C for 15 min, whereas supernatants were used for RNA isolation using the Qiagen RNeasy® Mini Kits, following manufacturer’s recommendations (Valencia, CA). RNA concentrations were determined spectrophotometrically (OD260 1.0 = 40 μg ml−1) and the RNA integrity of ribosomal RNA was evaluated on 1.2% agarose-0.66 M formaldehyde denaturing gels. RNA used for quantitative real time-PCR or reverse-transcriptase mediated PCR was subsequently treated with 10 units RNase-free DNase I (Amersham BioSciences; Piscataway, NJ) at 37°C for 30 min and repurified using Qiagen RNeasy® Mini Kits according to the manufacturer’s instructions for RNA clean-up.

RNA labeling and GeneChip® analysis

Ten micrograms of total bacterial RNA from each sample was labeled and hybridized to a S. aureus GeneChip® following the manufacturer’s recommendations for antisense prokaryotic arrays (Affymetrix; Santa Clara, CA). Briefly, exogenous Eukaryotic Poly-A RNA (Affymetrix) was added to each RNA sample and reverse transcribed. Resulting cDNA was purified using Qiagen PCR Clean-up kits, fragmented with DNase I (Amersham BioSciences) and 3′ end-labeled with biotin using the Enzo Bioarray Terminal Labeling Kit (Enzo Life Sciences; Farmingdale, NY). A total of 1.5 μg of labeled material was hybridized to an Affymetrix S. aureus GeneChip® then washed, stained, and scanned as previously described (Dunman et al. 2001; Beenken et al. 2004). Commercially available GeneChips® were used in this study representing > 3,300 S. aureus open reading frames (ORF) and >4,800 intergenic regions from strains N315, Mu50, NCTC 8325, and COL (Affymetrix). GeneChip® signal intensity values for each ORF and intergenic region at each replicate time point (n ≥ 2) were averaged and then either normalized to control poly(A) RNA signals for half life determinations, as previously described (Anderson et al. 2006; Roberts et al. 2006) or normalized to total GeneChip® signal values to investigate the acid- or alkaline-shock regulon, as previously described (Beenken et al. 2004; Bischoff et al. 2004; Anderson et al. 2006; Roberts et al. 2006) using GeneSpring 7.2 software (Agilent Technologies; Redwood City, CA). A comparison of T0 signal intensity values to corresponding mock treated cells (pH 7.2) allowed identification of RNA transcripts that significantly increased or decreased ≥ 2-fold in response to acid- or alkaline-challenge (T-test p=0.05). The half-life of each transcript was calculated as the time point at which the T0 signal decreased by a factor of 2, as previously described (Bernstein et al. 2002; Anderson et al. 2006; Roberts et al. 2006). All corresponding GeneChip data files have been archived in MIAME-compliant format in the NCBI Gene Expression Omnibus repository (GSE22233).

qRT-PCR and RT-PCR

For qRT-PCR reactions, 25 ng of RNA was reverse transcribed, amplified, and measured using a LightCycler® RNA Master SYBR Green I kit following the manufacturer’s recommendations (Roche Applied Science). As an internal control, 0.5 pg of RNA was used to quantify the amount of 16S rRNA in each sample. Transcript concentrations were calculated using LightCycler® software and LightCycler® Control Cytokine RNA titration kit as a standard (Roche Applied Science). Concentration values were then normalized to 16S rRNA abundance. For RT-PCR reactions, between 0.75 and 25 ng (as indicated in text) of RNA were reverse transcribed and PCR amplified using the AccessQuick™ RT-PCR Kits, according to the manufacturer’s recommendations (Promega, Madison, WI). Amplified products were electophoresed in a 2.0% agarose gel and visualized by ethidium bromide staining.

Detection of capsular polysaccharide

Overnight cultures of UAMS-1 cells were inoculated 1:100 into fresh BHI broth and grown to early-exponential phase with aeration at 37°C. Alkaline and acid shock responses were induced, as described above. Forty-five ml of mock-treated or stress-induced cells were pelleted by centrifugation at 1600 × g for 10 min. Capsule was isolated and quantified as described previously (Luong et al. 2002; Luong et al. 2003), with modifications. Briefly, each pellet was resuspended in Phosphate Buffered Saline (PBS) to an OD660 of 5.0. Two hundred and fifty microliters of this suspension was pelleted and resuspensed in 50μl PBS to concentrate. Cell suspensions were subsequently treated with Lysostaphin (5 μg for 30 min at 37°C), DNase I (1 unit for 30 min at 37°C), and Proteinase K (5 ug for 30 min at 50°C; repeated twice). Proteinase K was inactivated by heat treatment at 75°C for 15 min, pelleted by centrifugation, and 45 μl supernatant was used for immunoblotting. Capsule production was quantitated by immuno-dot-blotting with rabbit anti-CP8 serum for 1 hr, followed by washing with PBS containing 0.1% Tween 20 and incubation with horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin antiserum for 1 hr. The membrane was developed with a chemiluminescent substrate.

Liquid chromatography-mass spectrometry (LCMS) of ppGpp

ppGpp was purchased from TriLink BioTechnologies (San Diego CA) and used as a standard to measure cellular ppGpp levels, as previously described (Geiger et al. 2010) but with the following modifications. One hundred milliliters of exponential phase cells were used to induce either the stringent response (Anderson et al. 2006), acid shock response, alkaline shock response, or were mock treated (pH 7.4) for 30 min. Total bacterial RNA was isolated from 10 ml aliquot of each condition and subjected to RT-PCR to ensure that each stress response was induced. Fifty milliliters of cell lysates from each condition (stringent, acid, alkaline or mock) correlating to 1.0 to 5.0 × 107 cfu ml−1 were resuspended in 500 μl of 5 mM NH4-acetate. Twenty microliters of each sample lysate was subjected to LCMS analysis using a Phenomenex JupiterTM C5 column (50 × 2 mm) coupled to an Agilent 1100 series LC system and an Agilent MSD instrument using a 15–65% gradient of 5 mM OAA (stationary phase) and 5 mM OAA + 80% acetonitrile (mobile phase). ppGpp levels of samples were monitored by mass spectrometry at a 599–605 h/z which correlates with the profile of purified ppGpp (601.9 h/z). Quantitation of peak values at 601.9 h/z was accomplished by standard curve analysis where the area under the curve (AUC) for commerically available ppGpp was determined by linear regression analysis providing a value of 250 AUC units × nM−1. Measured ppGpp levels were then normalized to cfu of the starting sample. A total of three biological replicates of mock and each stress response induced cells were assessed; resulting ppGpp measurements were averaged.

RESULTS

Acid shock response

We set out to compare the mRNA turnover properties of exponential phase S. aureus during growth during homeostatic pH (pH 7.4) and inorganic acid-shock conditions to determine whether changes in mRNA stability contribute to changes in the transcript titers of mRNA species believed to play a role in S. aureus acid-shock adaptation. To do so, a combination of cell viability and quantitative reverse transcription mediated PCR assays were initially used to identify conditions that were suitable to study the acid-shock response in S. aureus strain UAMS-1. Accordingly, the culture medium of exponential phase cells was adjusted to pH 2.0 or 4.0 for 30 min and colony forming units were enumerated to determine whether pH lowering conditions affected cell viability. Adjusting the culture medium to pH 2.0 proved to be lethal, whereas pH 4 did not appreciably affect S. aureus cell viability during these assay conditions (data not shown). Quantitative real time-polymerase chain reaction (qRT-PCR) results revealed that the mRNA titers of two known S. aureus acid shock responsive genes, kdpD and ureB, were induced 2.0- and 37.5-fold, respectively, following 30 min exposure to pH 4.0, indicating that these experimental conditions elicit the organism’s acid-shock response (data not shown). Using Affymetrix GeneChips® the transcriptional response of mock-treated and acid-challenged cells were compared to further establish that these conditions were appropriate to study the S. aureus acid-shock response.

An analysis of genes that exhibited ≥ 2-fold change in expression between experimental conditions revealed that adjusting the pH to 4.0 for 30 min produced a response expected of acid-shocked S. aureus (Figure 1A; Table 2). A total of fifty-eight genes were significantly induced (≥ 2-fold; P = 0.05) in response to the acid-shock conditions used in this study (Table 2). Of these, twenty-five mRNA species (43%) were previously identified acid-shock inducible genes and included factors proposed to be involved in acid-neutralization, transport, and increasing the organism’s reducing power (Bore et al. 2007). Among this list were the urease genes ureA and ureB, which were upregulated 13.4- and 11.6-fold, respectively, in response to low pH growth conditions and are thought to promote acid neutralization. Other components of the urease operon (ureC, ureD, and ureF) were also up-regulated but were not considered to be significantly differentially expressed. Four previously identified acid-shock inducible transport proteins (SACOL2347, SACOL0086, SACOL2356, and SACOL2357) were also determined to be up-regulated between 3.9- and 27.7-fold in the current study. Likewise, members of the energy production machinery were up-regulated SACOL2534 (2.7-fold), SACOL0409 (3.1-fold), SACOL0874 (2.2-fold), SACOL0162 (3.8-fold), SACOL0410 (4.2-fold) and SACOL2594 (2.8-fold), presumably allowing for increased reducing power. Moreover, genes involved in converting acetate to ethanol alsD (SACOL2198; 9.7-fold) and alsS (SACOL2199; 15.8-fold), which would ostensibly raise the intracellular pH, were induced in response to acid stress. Likewise, acetoin reductase (SACOL0111), which catalyzes production of the neutral product 2,3-butanediol from acetoin and would promote a rise in pH was induced (7-fold). The majority of genes that were found to be up-regulated in the current study, but not previously defined as members of the acid-shock response represent hypothetical open reading frames (18 in total; Table 2).

Figure 1. Transcriptional Response to Acid- or Alkaline-shock conditions.

Figure 1

Shown are the number of genes predicted to participate in the indicated biological process (X-axis) that exhibit increased (Red; Induced) or decreased (Blue; Repressed) transcript titers in response to acid-shock (Panel A) or alkaline-shock conditions (Panel B).

Table 2.

Genes up-regulated in acid-shocked cells.

Category and qualifier Fold induction mRNA half-life (min)
Gene Locus† Description
pH 7.2 pH 4
Amino acid transport and metabolism
 sa_c4765s4076_a_at 15.8 ND 30 budB SA2199 acetolactate synthase
 sa_c5023s4322_at* 13.4 15 30 ureA SA2280 urease subunit gamma
 sa_c5029s4326_a_at* 11.6 15 30 ureB SA2281 urease subunit beta
 sa_c839s639_a_at 3.9 2.5 30 SA0085 M20/M25/M40 family peptidase
 sa_c5373s4646_a_at* 3.6 2.5 stable SA1915 amino acid ABC transporter
 sa_c3655s3137_a_at* 2.5 5 stable SA1916 amino acid ABC transporter, permease
Carbohydrate transport and metabolism
 sa_c5644s4894_a_at 14.7 2.5 stable gpm SA2415 phosphoglycerate mutase
 sa_c7036s9080_a_at 6.3 2.5 30 SA0408 glyoxalase family protein
 sa_c6058s5252_a_at 3.3 2.5 30 SA2533 glyoxalase family protein
 sa_c10529s9046_a_at 3.7 2.5 2.5 SA2590 glyoxalase family protein
Inorganic ion transport and metabolism
 sa_c6180s5357_a_at 6.8 ND 30 feoB SA2564 ferrous iron transport protein B
Energy production and conversion
 sa_c6062s5256_a_at 2.7 15 stable frp SA2534 NAD(P)H-flavin oxidoreductase
 sa_c9528s8308_a_at 7.0 5 30 SA0111 acetoin reductase
 sa_c10345s9018_a_at 3.8 ND 5 SA0162 formate dehydrogenase
 sa_c7041s6150_a_at 3.1 2.5 30 SA0409 hypothetical protein
 sa_c7043s6153_a_at 4.2 ND 30 SA0410 FMN reductase-related protein
 sa_c8493s7455_a_at 2.2 2.5 2.5 SA0874 nitroreductase family protein
 sa_c6293s5471_a_at 2.8 2.5 30 SA2594 short chain dehydrogenase
Secondary metabolites biosynthesis, transport and catabolism
 sa_c4757s4072_at 9.7 ND stable budA1 SA2198 alpha-acetolactate decarboxylase
Transport
 sa_c875s677_a_at 3.9 2.5 stable SA0086 putative drug transporter
 sa_c5303s4583_a_at 18.9 ND stable SA2356 ABC transporter, ATP-binding protein
 sa_c5307s4587_at 27.7 ND stable SA2357 ABC transporter, permease protein
 sa_c5640s9379_a_at 7.6 ND 2.5 N315-SA2203 hypothetical protein
Transcription
 sa_c4939s4249_a_at 2.6 2.5 2.5 sarV SA2258 staphylococcal accessory regulator V
 sa_c3732s3210_a_at 2.5 2.5 30 vraR SA1942 DNA-binding response regulator
 sa_c441s275_a_at* 3.7 5 30 SA2593 transcriptional regulator, TetR family
 sa_c6285s5463_a_at* 3.1 2.5 2.5 SA2591 hypothetical protein
Translation
 sa_c8966s7880_a_at 5.3 2.5 30 SA0815 ribosomal subunit interface protein
Posttranslational modification
 sa_c278s123_a_at 3.6 2.5 30 clpB SA0979 ATP-dependent Clp protease, ATP-binding subunit
Cell wall and membrane biogenesis
 sa_c1825s9344_a_at 10.0 2.5 30 SA0119 cell wall surface anchor family protein
 sa_c6575s5743_a_at* 5.3 2.5 2.5 SA2668 LPXTG cell wall surface anchor family
Cell division
 sa_c6135s5319_a_at 22.7 ND 2.5 SA2554 LrgA family protein
Resistance
 sa_c342s182_a_at 6.0 2.5 2.5 SA2347 EmrB/QacA family drug resistance transporter
Virulence
 sa_c7169s10140_a_at 7.5 2.5 2.5 SA0901 pathogenicity island protein
 sa_c10151s10571_a_at 2.6 2.5 30 SA0902 pathogenicity island protein
 sa_c10150s10567_a_at 2.8 2.5 30 SA0903 pathogenicity island protein
 sa_c7177s10148_a_at 3.1 ND 2.5 SA0905 pathogenicity island protein
Phage
 sa_c7182s10152cs_s_at* 2.6 2.5 30 SA2014 phage terminase family protein
Unkown function
 sa_c2968s2524_a_at 3.3 ND 2.5 SA0156 hypothetical protein
 sa_c3224s2774_a_at 7.8 2.5 2.5 SA0161 hypothetical protein
 sa_c6700s5841_a_at 2.1 2.5 2.5 SA0259 hypothetical protein
 sa_c7203s6269_a_at 6.5 ND 2.5 SA0445 hypothetical protein
 sa_c7760s6763_at* 23.5 15 30 SA0625 hypothetical protein
 sa_c8897s7814_a_at 6.5 ND 2.5 SA0692 hypothetical protein
 sa_c629s448_at 3.9 2.5 30 SA1071 hypothetical protein
 sa_c1960s1685_a_at 9.8 2.5 2.5 SA1438 hypothetical protein
 sa_c2144s1843_a_at 2.3 2.5 2.5 SA1491 hypothetical protein
 sa_c2942s2505_a_at* 10.6 2.5 2.5 SA1705 hypothetical protein
 sa_c9309s8152_at 6.0 2.5 2.5 SA2315 hypothetical protein
 sa_c6182s5363_at 38.1 ND 2.5 SA2565 FeoA domain-containing protein
 sa_c6206s5387_a_at* 126.3 ND 2.5 SA2571 hypothetical protein
 sa_c6289s5467_a_at 5.7 ND 2.5 SA2592 hypothetical protein
 sa_c259s100_a_at 2.6 2.5 30 SA2596 hypothetical protein
 sa_c6345s5512_a_at 2.6 15 stable SA2609 hypothetical protein
 sa_c6499s10083_at 3.1 ND 15 SA2649 conserved hypothetical protein
 sa_c6147s5329_at 3.0 ND 30 N315-SA2331 hypothetical protein
 sa_c6176s10079cs_s_at 5.4 ND 2.5 N315-SAS088 hypothetical protein
 sa_c2938s2500_at 4.9 2.5 2.5 MW1600 hypothetical protein
*

Functional category and GeneChip® qualifier indicated.

†

S. aureus strain COL locus unless otherwise indicated.

Acid-shock conditions decreased the transcript titers of 438 mRNA species (Table 2), 173 of which (39.5 %) were previously determined to be down-regulated in response to sudden acid shock (Bore et al. 2007). Most decreased gene products are predicted to be involved in nucleotide biosynthesis, amino acid metabolism, and translation (Figure 1A; Table 2), suggesting that gross alterations in cell metabolism contribute to the organism’s adaptation to low pH conditions, as previously reported (Bore et al. 2007). Nonetheless, we also considered the possibility that although 30 min exposure to pH 4.0 does not result in an immediate loss of S. aureus viability (data not shown), the observed decrease in the transcript titers of genes belonging to essential biological processes may reflect a change in cellular metabolism that precedes bacterial death. Meaning, the mass down regulation of these essential processes could be an experimental artifact corresponding to S. aureus undergoing the early stages of death as opposed to eliciting a response that promotes the organism’s adaptation to acidic conditions. To distinguish between these possibilities, S. aureus cell viability measurements were extended over a course of 6 hr in medium maintained at pH 7.4 or pH 4.0. As shown in Figure 2A, while S. aureus growth increased approximately 100-fold at neutral pH, viable cell numbers remained constant during extended growth at pH 4.0. These data indicate that the aforementioned down-regulation of translation machinery, nucleotide biosynthesis and amino acid metabolism factors contributes to cellular adaptation to low pH, as opposed to reflecting the inception of cell death. Similar to Bore and colleagues, we also observed that gene transcripts involved in proton motive force (F0F1ATPase; 8 genes) were reduced between 2.5 to 4.2-fold (Bore et al. 2007). It was also found that the transcript abundance of Na+/H+ antiporter coding genes mnhDEFG were decreased between 2.9 to 4-fold in response to acid shock, which is expected to aid in raising the intracellular pH as proton import would be reduced.

Figure 2. Growth Characteristics of S. aureus in Neutral, Acidic and Alkaline Medium.

Figure 2

Plotted are the numbers of viable colony forming units (CFUs) per milliliter of exponential phase S. aureus following growth for 6 hours after adjusting the medium to pH of 7.4 (diamonds), pH 4.0 (squares) or pH 10.0 (circles). Panel A shows growth properties of wild type S. aureus UAMS-1 cells. Panel B shows growth properties of isogenic capsule mutant cells. Standard deviation is indicated.

Sudden acid-shock affected the expression of more putative virulence factors than previously appreciated; presumably, this reflects differences in genomic content of the strains investigated. More specifically, while the pathogenicity island gene SACOL0902 is a recognized acid-shock inducible factor, our work revealed that adjacent genes (SACOL0901 and SACOL0903) were also induced 7.9- and 2.8-fold, respectively, in response to low pH (Bore et al. 2007). The putative virulence factor, SACOL2668 (containing the LPXTG motif), was also found to be up-regulated in the present study. Fifteen virulence factors were determined to exhibit lower transcript titers in response to acid-shock conditions, including seven known members of the acid-shock response: phospholipase C (hlb, 2.4-fold), immunodominant antigen A (isaA, 2.9-fold), fibronectin-binding protein A (fnbA, 11.4-fold), staphyloxanthin biosynthesis protein (SACOL2291, 13.4-fold and SACOL2581, 3.8-fold), IgG-binding protein SBI (SACOL2418; 18.3-fold), and fibrinogen binding-related protein (SACOL1164, 7.4-fold) (Bore et al. 2007). Our study also revealed five additional well-characterized virulence factors to be down-regulated in response to acid-shock conditions: chemotaxis-inhibiting protein CHIPS (chp, 10.3-fold), clumping factor B (clfB, 8.1-fold), fibrinogen-binding protein (efb; 6.3-fold), staphylokinase precursor (sak, 4.7-fold) and protein A (spa, 2.3-fold). Consistent with previous reports, we observed that the two-component signal transduction system SaeRS (saeR, 4.5-fold and saeS, 3-fold), which controls expression of many virulence factors, was decreased in response to acid stress (Weinrick et al. 2004; Bore et al. 2007). However, we also observed that three previously unrecognized acid-responsive virulence factor regulators were also down-regulated: LytSR (lytS, 4.4-fold and lytR, 6.8-fold), ArlSR (arlS, 2.9-fold), and GdpS (SACOL0809; 4-fold) (Bronner et al. 2004; Shang et al. 2009).

Collectively, these results verify that the conditions used effectively induce the S. aureus acid-shock response and extend previous reports suggesting that response induction results in a physiological state that is recalcitrant to acidification; the organism up-regulates acid-neutralization processes and gene products that may increase its reducing power while simultaneously reducing macromolecular processes and systems that influx H+.

Alkaline Shock Response

To define conditions appropriate for characterizing the S. aureus alkaline shock response we used a combination of cell viability and quantitative RT-PCR approaches to assess the organism’s tolerance of alkali stress and to determine whether these conditions induced expression of the known sigma B regulated alkaline-shock gene, alkaline shock protein 23 [asp23; (Kuroda et al. 1995)]. The organism’s tolerance of alkaline conditions was measured by adjusting the pH of exponential-phase S. aureus UAMS-1 cells to 8.0, 9.0, or 10.0 for 30 min and monitoring cell viability. None of these conditions affected S. aureus’ ability to survive brief exposure to high pH (data not shown). Quantitative RT-PCR was performed to compare the transcript titers of asp23 at elevated pH to that of mock treated cells (pH 7.2). While adjusting the pH to 8.0 or 9.0 did not appreciably affect asp23 expression, 30 min exposure to pH 10.0 induced asp23 transcript titers (2.8-fold; data not shown), suggesting that these conditions were appropriate for studying the organism’s alkaline-shock response. Accordingly, the pH of exponential phase UAMS-1 cells was adjusted to pH 10.0 for 30 min and transcript titers of alkaline-shocked S. aureus were compared to mock treated cells by GeneChip® analysis. As shown in Figure 1B., transient exposure of exponential phase S. aureus to alkaline conditions (pH 10.0 for 30 min) resulted in a striking reduction in messenger RNA titers constituting roughly a third of the organism’s transcriptome. A survey of the 773 alkaline-shock decreased transcripts (Figure 1B, Table 4) indicated that the major functional categories of genes are predicted to be involved in nucleotide biosynthesis, amino acid metabolism, and translation. These same systems were found to be lowered during acid-shock conditions, suggesting that gross alterations in cell metabolism are a generalized response to extreme pH stress. To ensure that diminished expression of these essential biological processes is a function of cellular adaptation to high pH, as opposed to a bacterial cell death phenotype, the cell viability of cultures exposed to prolonged elevated pH was monitored (pH 10.0 for 6 hr). As shown in Figure 2A, as was the case for growth at low pH, viable cell numbers remained constant during extended growth at pH 10.0, suggesting that the aforementioned down-regulation of translation machinery, nucleotide biosynthesis and amino acid metabolism factors contributes to cellular adaptation, as opposed to being an artifact of the initiation of cell death.

Table 4.

Genes down-regulated in acid-shocked cells.

Category and qualifier* Fold reduction mRNA half-life (min)
Gene Locus† Description
pH 7.2 pH 4
Amino acid transport and metabolism
 sa_c2759s2334_a_at* 4.5 2.5 30 aroE SA1652 shikimate 5-dehydrogenase
 sa_c9420s8234_a_at* 3.7 2.5 2.5 betA SA2627 choline dehydrogenase
 sa_c3567s9159_a_at 4.6 2.5 ND brnQ1 SA0171 branched-chain amino acid transport system II carrier protein
 sa_c1974s1697_a_at 5.9 2.5 2.5 brnQ3 SA1443 branched-chain amino acid transport system II carrier protein
 sa_c1159s942_a_at 7.3 2.5 ND carA SA1214 carbamoyl-phosphate synthase, small subunit
 sa_c1165s946_a_at 8.5 5 30 carB SA1215 carbamoyl-phosphate synthase, large subunit
 sa_c7368s9209_a_at* 4.3 2.5 2.5 cysM SA0502 cysteine synthase/cystathionine beta-synthase family protein
 sa_c5246s4544_a_at* 7.2 2.5 15 gltS SA2340 sodium:glutamate symporter
 sa_c1139s920_a_at* 6.5 2.5 2.5 IspA SA1208 lipoprotein signal peptidase
 sa_c10721s11169cv_s_at* 7.8 2.5 2.5 metB N315-SA0419 cystathionine gamma-synthase
 sa_c7100s6210_a_at 3.0 2.5 30 metE SA0428 homocysteine methyltransferase
 sa_c3445s9086_a_at* 8.3 2.5 15 metK SA1837 S-adenosylmethionine synthetase
 sa_c6092s5283_a_at* 2.7 2.5 2.5 sdaAB SA2545 L-serine dehydratase, beta subunit
 sa_c3834s3303_a_at 4.2 15 2.5 sspB SA1970 cysteine protease precursor
 sa_c7372s10188cs_s_at 5.2 2.5 15 SA0503 trans-sulfuration enzyme family
 sa_c7431s6453_a_at* 4.4 2.5 2.5 SA0519 acetyltransferase
 sa_c8536s7494_a_at 3.5 5 30 SA0916 cysteine desulfurase
 sa_c574s400_a_at 2.3 2.5 2.5 SA1058 aminotransferase, class I
 sa_c5349s4625_a_at* 11.7 2.5 2.5 SA1108 spermidine/putrescine ABC transporter, ATP-binding protein
 sa_c9028s7925_a_at* 6.8 2.5 2.5 SA1109 spermidine/putrescine ABC transporter, permease protein
 sa_c795s596_a_at* 9.9 2.5 2.5 SA1110 spermidine/putrescine ABC transporter, permease protein
 sa_c803s604_a_at* 11.4 2.5 2.5 SA1111 spermidine/putrescine transporter
 sa_c1215s998_a_at* 4.9 2.5 30 SA1231 protein phosphatase
 sa_c10578s11035_s_at* 4.1 2.5 stable SA1232 protein kinase
 sa_c1431s1205_a_at 4.4 2.5 30 SA1298 M16 family peptidase
 sa_c1675s1413_a_at 5.0 2.5 2.5 SA1367 amino acid permease
 sa_c1778s9167_a_at 4.4 2.5 30 SA1392 sodium:alanine symporter family
 sa_c1934s1655_a_at 2.5 2.5 30 SA1433 M20/M25/M40 family peptidase
 sa_c10579s11036cv_s_at 5.5 2.5 2.5 SA1454 Hypothetical protein
 sa_c2910s2472_a_at* 5.0 2.5 2.5 SA1698 hypothetical protein
 sa_c3178s2725_a_at* 3.2 2.5 ND SA1765 aminotransferase, class V
 sa_c4460s3803_a_at* 5.8 2.5 15 SA2109 modification methylase
 sa_c5126s4423_a_at* 7.3 2.5 15 SA2309 amino acid permease
 sa_c5638s4893_a_at 6.6 2.5 30 SA2412 amino acid ABC transporter,
 sa_c5835s5075_a_at 3.8 2.5 ND SA2472 peptide ABC transporter
 sa_c5837s5079_a_at 2.2 2.5 2.5 SA2473 peptide ABC transporter
 sa_c9357s8184_a_at 2.5 2.5 ND SA2474 peptide ABC transporter
 sa_c5847s5088_a_at 2.4 2.5 ND SA2476 peptide ABC transporter
 sa_c6082s5268_a_at 5.3 2.5 2.5 SA2541 acetyltransferase
 sa_c6378s5547_a_at 2.1 2.5 ND SA2619 amino acid permease
Carbohydrate transport and metabolism
 sa_c6411s5581_a_at 3.9 2.5 30 bglA SA0251 6-phospho-beta-glucosidase
 sa_c8986s7896_a_at 2.9 15 stable gapA SA0838 glyceraldehyde 3-phosphate dehydrogenase
 sa_c7032s9332_a_at* 5.4 2.5 stable glpT SA0407 glycerol-3-phosphate transporter
 sa_c9250s8097_a_at 2.2 2.5 stable pflB SA0204 formate acetyltransferase
 sa_c8390s7366_a_at 3.0 15 30 pgk SA0839 phosphoglycerate kinase
 sa_c853s654_a_at 10.4 2.5 15 pyc SA1123 pyruvate carboxylase
 sa_c8397s7370_a_at* 2.7 15 stable tpiA SA0840 triosephosphate isomerase
 sa_c3742s3217_a_at* 6.7 5 stable SA0175 PTS system, IIABC components
 sa_c6381s5549_a_at 2.2 2.5 ND SA0250 PTS system, IIA component
 sa_c7422s6445_a_at* 5.0 2.5 2.5 SA0517 alpha-amylase family protein
 sa_c3212s2761_a_at* 5.2 2.5 stable SA1775 PTS system, IIBC components
 sa_c3661s3140_a_at 6.2 2.5 2.5 SA1917 PTS system, IIC component
 sa_c4910s4214_a_at 6.1 15 2.5 SA2246 putative sugar transporter
 sa_c5504s9245_a_at* 4.0 2.5 2.5 SA2376 putative PTS system, sucrose-specific IIBC components
 sa_c6096s5287_a_at* 3.0 2.5 30 SA2546 putative perfringolysin O regulator
 sa_c6123s5305_a_at* 6.1 2.5 2.5 SA2552 PTS system, IIABC components
Inorganic ion transport and metabolism
 sa_c7931s6914_a_at* 3.5 2.5 ND mnhD SA0682 putative Na+/H+ antiporter
 sa_c8887s7802_a_at* 3.6 2.5 2.5 mnhE SA0684 putative Na+/H+ antiporter
 sa_c7937s6924_at* 2.9 2.5 ND mnhF SA0685 putative Na+/H+ antiporter
 sa_c7941s6928_a_at* 4.0 2.5 ND mnhG SA0686 putative Na+/H+ antiporter
 sa_c4989s4292_a_at* 2.0 2.5 30 modC SA2270 molybdenum ABC transporter
 sa_c1739s1473_a_at 3.0 2.5 2.5 mscL SA1383 mechanosensitive channel protein
 sa_c5070s4366_a_at 5.4 2.5 ND nhaC SA2292 Na+/H+ antiporter
 sa_c904s700_a_at 25.1 2.5 2.5 SA0088 Na/Pi cotransporter family
 sa_c7236s6302_a_at 4.7 2.5 stable SA0454 sodium:dicarboxylate symporter
 sa_c7333s6374_a_at* 2.6 15 2.5 SA0491 putative cobalamin synthesis
 sa_c7365s6401_a_at 3.5 2.5 2.5 SA0501 sodium-dependent transporter
 sa_c7475s6499_a_at* 3.5 2.5 15 SA0531 tetrapyrrole methylase family
 sa_c7871s6863_a_at* 7.2 2.5 stable SA0665 putative iron compound ABC transporter
 sa_c8909s7826_a_at* 6.0 2.5 15 SA0722 phosphate transporter family
 sa_c8633s7584_a_at 3.1 2.5 15 SA0946 Na+/H+ antiporter family protein
 sa_c9037s7935_a_at 8.0 2.5 2.5 SA1096 TrkA potassium uptake family
 sa_c3767s3239_at 6.1 2.5 stable SA1952 ferritins family protein
 sa_c5013s4315_a_at 2.2 2.5 2.5 SA2277 iron compound ABC transporter
 sa_c5160s4458_a_at* 7.1 2.5 2.5 SA2319 Na+/H+ antiporter family
 sa_c5522s4780_a_at* 5.9 2.5 15 SA2382 proton/sodium-glutamate symport
 sa_c5534s4791_a_at* 5.8 2.5 ND SA2386 nitrite extrusion protein
 sa_c5739s4980_a_at 3.9 2.5 2.5 SA2442 putative Na+/H+ antiporter
 sa_c10690s11140_s_at* 2.7 2.5 30 SA2718 anion transporter family protein
Lipid transport and metabolism
 sa_c9605s8367_a_at* 6.6 2.5 15 cdsA SA1280 phosphatidate cytidylyltransferase
 sa_c1260s1035_a_at* 5.4 2.5 30 fabD SA1244 malonyl CoA-acyl transacylase
 sa_c318s157_a_at* 2.7 2.5 30 fabF SA0988 acyl-carrier-protein synthase II
 sa_c4695s4014_a_at 5.8 2.5 2.5 SA0207 hypothetical protein
 sa_c6975s6099_a_at 6.3 2.5 2.5 SA0317 lipase precursor
 sa_c10609s11066_s_at 3.3 2.5 ND SA0390 lipase precursor
 sa_c1242s1022_a_at* 4.3 2.5 15 SA1240 DAK2 domain protein
Nucleotide transport and metabolism
 sa_c4816s4124_at* 2.8 15 stable adk SA2218 adenylate kinase
 sa_c2883s2448_at* 3.5 2.5 15 apt SA1690 adenine phosphoribosyltransferase
 sa_c9216s8076_a_at* 6.3 2.5 30 guaB SA0460 inosine-5-monophosphate dehydrogenase
 sa_c1697s1432_a_at* 5.5 2.5 stable guaC SA1371 guanosine 5′-monophosphate oxidoreductase
 sa_c7543s6563_at* 6.2 2.5 2.5 hpt SA0554 hypoxanthine phosphoribosyltransferase
 sa_c8803s7743_a_at* 8.0 2.5 2.5 nupC SA0566 nucleoside permease NupC
 sa_c7261s6323_a_at 14.4 2.5 30 pbuX SA0459 xanthine permease
 sa_c9157s8026_a_at* 3.6 2.5 30 prsA SA0544 ribose-phosphate pyrophosphokinase
 sa_c65s61_a_at* 10.2 2.5 2.5 purA SA0018 adenylosuccinate synthetase
 sa_c660s471_at 4.0 2.5 ND purC SA1075 phosphoribosylaminoimidazole-succinocarboxamide synthase
 sa_c652s462_a_at 3.0 2.5 ND purE SA1073 phosphoribosylaminoimidazole carboxylase, catalytic subunit
 sa_c678s484_a_at 3.3 2.5 ND purF SA1079 amidophosphoribosyltransferase
 sa_c658s466_a_at 3.8 2.5 2.5 purK SA1074 phosphoribosylaminoimidazole carboxylase, ATPase subunit
 sa_c674s480_a_at 2.8 2.5 ND purL SA1078 phosphoribosylformylglycinamidine synthase II
 sa_c680s488_a_at 3.5 2.5 ND purM SA1080 phosphoribosylformylglycinamidine cyclo-ligase
 sa_c686s494_a_at 4.2 2.5 2.5 purN SA1081 phosphoribosylglycinamide formyltransferase
 sa_c9991s8687_a_at 6.6 2.5 ND pyrB SA1212 aspartate carbamoyltransferase catalytic subunit
 sa_c1155s937_a_at* 9.7 2.5 30 pyrC SA1213 dihydroorotase
 sa_c6327s5497_a_at* 11.7 2.5 2.5 pyrD SA2606 dihydroorotate dehydrogenase 2
 sa_c9989s8682_a_at 4.1 5 2.5 pyrE SA1217 orotate phosphoribosyltransferase
 sa_c1167s950_a_at* 6.6 5 15 pyrF SA1216 orotidine 5-phosphate decarboxylase
 sa_c1147s928_a_at* 8.2 2.5 2.5 pyrR SA1210 pyrimidine regulatory protein PyR
 sa_c9220s8080_a_at 5.5 2.5 stable quaA SA0461 bifunctional GMP synthase/glutamine amidotransferase protein
 sa_c9829s8568_a_at* 5.2 2.5 2.5 tdk SA2111 thymidine kinase
 sa_c9569s8332_a_at* 3.7 2.5 30 udk SA1666 uridine kinase
 sa_c4446s3792_a_at* 2.5 15 2.5 upp SA2104 uracil phosphoribosyltransferase
 sa_c1151s932_a_at* 4.8 2.5 ND uraA SA1211 uracil permease
 sa_c7257s6317_a_at 13.7 2.5 15 xpt SA0458 xanthine phosphoribosyltransferase
 sa_c83s9423_s_at 4.6 2.5 stable SA0024 5-nucleotidase family protein
 sa_c6934s6055_a_at 3.1 15 stable SA0303 5′-nucleotidase/nucleotide metab
 sa_c7681s6690_a_at* 5.0 2.5 2.5 SA0604 deoxynucleoside kinase family
 sa_c7977s6963_a_at 7.6 2.5 2.5 SA0701 putative nucleoside permease
 sa_c3326s2869_a_at 4.7 2.5 2.5 SA1803 pseudouridine synthase family 1
 sa_c4896s4204_a_at* 4.7 2.5 2.5 15 SA2242 xanthine/uracil permease family
Energy production and conversion
 sa_c4418s3765_a_at* 3.2 15 30 atpA SA2097 F0F1 ATP synthase subunit beta
 sa_c4434s3779_a_at* 4.2 15 30 atpB SA2101 F0F1 ATP synthase subunit A
 sa_c9843s8585_at* 2.5 15 stable atpC SA2094 F0F1 ATP synthase subunit epsilon
 sa_c9839s8581_a_at* 3.0 15 stable atpD SA2095 F0F1 ATP synthase subunit β
 sa_c4430s3777_at* 3.3 15 stable atpE SA2100 F0F1 ATP synthase subunit C
 sa_c4426s3773_a_at* 3.5 15 30 atpF SA2099 F0F1 ATP synthase subunit B
 sa_c4414s3760_at* 3.3 15 stable atpG SA2096 F0F1 ATP synthase subunit γ
 sa_c4422s3769_a_at* 3.1 15 30 atpH SA2098 F0F1 ATP synthase subunit δ
 sa_c6417s5584_a_at* 2.9 2.5 30 betB SA2628 betaine aldehyde dehydrogenase
 sa_c736s544_a_at 22.7 2.5 15 cydA SA1094 cytochrome d ubiquinol oxidase, subunit I
 sa_c740s548_a_at 29.2 2.5 30 cydB SA1095 cytochrome d ubiquinol oxidase, subunit II
 sa_c5235s4535_a_at 2.7 2.5 30 ldh SA0222 L-lactate dehydrogenase
 sa_c5574s4827_a_at* 3.5 2.5 ND narG SA2395 respiratory nitrate reductase, α
 sa_c5570s4822_a_at* 2.8 2.5 ND narH SA2394 respiratory nitrate reductase, β
 sa_c5564s4818_a_at* 3.3 5 ND narJ SA2393 respiratory nitrate reductase, δ
 sa_c5584s4840_a_at 2.6 2.5 ND nirB SA2398 nitrite reductase [NAD(P)H], large subunit
 sa_c623s446_a_at* 3.3 30 stable qoxA SA1069 quinol oxidase, subunit I
 sa_c9054s7945_a_at* 3.1 30 stable qoxB SA1070 quinol oxidase, subunit II
 sa_c619s442_at* 2.6 15 stable qoxC SA1068 quinol oxidase, subunit III
 sa_c3158s2704_a_at 2.7 2.5 15 SA0160 hypothetical protein
 sa_c6985s6107_a_at* 4.3 2.5 2.5 SA0392 NADH-dependent flavin oxidoreductase
 sa_c8540s7497_at 3.2 5 stable SA0917 NifU domain-containing protein
 sa_c2220s1920_a_at* 4.7 2.5 30 SA1514 glycerol-3-phosphate dehydrogenase
 sa_c5074s4372_a_at 7.1 2.5 2.5 SA2293 NAD/NADP octopine/nopaline dehydrogenase family protein
Transport
 sa_c6427s5598_a_at 3.8 2.5 15 cudT SA2632 osmoprotectant transporter
 sa_c10649s11102cv_s_at 5.9 2.5 2.5 opuD1 SA1384 osmoprotectant transporter
 sa_c3118s2672_a_at* 2.1 2.5 2.5 SA0159 ABC transporter
 sa_c5333s4606_a_at 3.5 2.5 stable SA0264 ABC transporter
 sa_c5387s4658_a_at* 2.4 2.5 30 SA0422 ABC transporter
 sa_c5431s4700_a_at 2.8 2.5 30 SA0882 ABC transporter
 sa_c8512s7471_a_at 4.7 2.5 ND SA0883 ABC transporter
 sa_c8518s7475_a_at 2.8 2.5 30 SA0884 ABC transporter
 sa_c1908s1632_a_at* 7.3 2.5 30 SA1427 ABC transporter
 sa_c2626s2200_a_at* 3.9 2.5 2.5 SA1612 ABC transporter
 sa_c2630s2204_a_at 5.2 2.5 2.5 SA1613 ABC transporter
 sa_c5227s4529_a_at 5.6 2.5 2.5 SA2335 ABC transporter
 sa_c5608s4864_a_at 3.9 2.5 2.5 SA2403 ABC transporter
 sa_c5801s5043_a_at* 2.6 2.5 30 SA2460 putative drug transporter
 sa_c6017s5213_a_at* 4.4 2.5 15 SA2521 putative transporter
 sa_c5345s4618_a_at* 7.4 2.5 2.5 SA2525 ABC transporter
 sa_c6186s5364_a_at* 2.2 2.5 2.5 SA2566 putative MmpL efflux pump
 sa_c3043s2596_a_at* 2.1 2.5 ND SACOL0158 ABC transporter
Coenzyme transport and metabolism
 sa_c2753s2324_a_at* 3.2 2.5 30 nadD SA1650 nicotinate (nicotinamide) nucleotide adenylyltransferase
 sa_c3173s2721_a_at* 5.5 2.5 30 thiI SA1764 thiamine biosynthesis protein ThiI
 sa_c8256s7233_at* 3.3 2.5 stable SA0789 7-cyano-7-deazaguanine reductase
 sa_c2711s2285_a_at* 3.1 2.5 2.5 SA1640 coproporphyrinogen III oxidase
Transcription
 sa_c6194s5372_a_at* 6.8 2.5 15 lytR SA0246 response regulator
 sa_c1384s1156_a_at* 4.3 2.5 30 nusA SA1285 transcription elongation factor
 sa_c7637s6652_a_at* 2.8 15 stable ropC SA0589 RNA polymerase, β
 sa_c4796s4102_at* 2.7 15 stable rpoA SA2213 RNA polymerase, α
 sa_c7633s6648_a_at* 3.3 5 stable rpoB SA0588 RNA polymerase, β
 sa_c2650s2225_a_at* 3.5 2.5 15 rpoD SA1618 RNA polymerase sigma factor
 sa_c8190s7169_at 4.5 2.5 2.5 saeR SA0766 response regulator
 sa_c5056s4355_a_at 4.9 2.5 ND sarY SA2289 staphylococcal accessory regulator Y
 sa_c5529s4783_a_at 6.0 2.5 ND sarZ SA2384 staphylococcal accessory protein Z
 sa_c1214s994_a_at* 5.8 2.5 15 sun SA1229 Sun protein
 sa_c10502s10951cv_s_at* 2.8 2.5 2.5 tcaR SA2353 transcriptional regulator
 sa_c791s594_at* 8.1 2.5 stable SA1107 transcriptional regulator
 sa_c3623s3103_a_at* 8.7 2.5 2.5 SA1904 putative transcriptional regulator
 sa_c446s279_a_at* 4.6 2.5 2.5 SA2290 transcriptional regulator
 sa_c6509s5677_a_at* 3.3 2.5 30 SA2653 transcriptional regulator
Translation
 sa_c7865s6854_a_at* 3.6 2.5 15 argS SA0663 arginyl-tRNA synthetase
 sa_c9153s8021_a_at 3.5 2.5 30 cbf1 SA1898 3′-5′ exoribonuclease YhaM,
 sa_c1203s985_a_at* 4.7 2.5 2.5 def2 SA1227 polypeptide deformylase
 sa_c1207s989_a_at* 4.7 2.5 2.5 fmt SA1228 methionyl-tRNA formyltransferase
 sa_c1362s1136_a_at* 4.7 2.5 30 frr SA1278 ribosome recycling factor
 sa_c8835s7770_a_at* 2.5 15 stable fusA SA0593 elongation factor G
 sa_c1346s1119_a_at 5.9 2.5 30 gid SA1268 tRNA (uracil-5-)-methyltransferase
 sa_c9653s8413_a_at 5.2 2.5 30 glyS SA1622 glycyl-tRNA synthetase
 sa_c4812s4120_at* 2.3 15 stable infA SA2217 translation initiation factor IF-1
 sa_c1394s1169_a_at* 3.5 2.5 30 infB SA1288 translation initiation factor IF-2
 sa_c3036s2591_a_at 4.4 2.5 2.5 infC SA1727 translation initiation factor IF-3
 sa_c1410s1184_a_at* 5.3 2.5 30 pnp SA1293 polynucleotide phosphorylase/polyadenylase
 sa_c4462s3807_at* 9.2 2.5 2.5 prfA SA2110 peptide chain release factor 1
 sa_c469s298_a_at 3.9 2.5 15 prfC SA1025 peptide chain release factor 3
 sa_c10084s8804_a_at* 3.7 5 30 queA SA1695 S-adenosylmethionine:tRNA ribosyltransferase-isomerase
 sa_c1316s1090_a_at* 3.8 2.5 2.5 rbgA SA1260 ribosomal biogenesis GTPase
 sa_c1294s1067_a_at* 5.3 2.5 2.5 rimM SA1255 16S rRNA processing protein
 sa_c6841s5976_a_at 3.9 2.5 2.5 rnpA SA2739 ribonuclease P protein
 sa_c7620s6631_a_at* 4.3 15 stable rplA SA0584 50S ribosomal protein L1
 sa_c9959s8654_a_at* 3.4 15 stable rplB SA2236 50S ribosomal protein L2
 sa_c4888s4195_a_at* 3.1 5 stable rplC SA2239 50S ribosomal protein L3
 sa_c4880s4187_at 4.0 5 30 rplD SA2238 50S ribosomal protein L4
 sa_c4848s4156_at* 2.8 15 stable rplE SA2227 50S ribosomal protein L5
 sa_c9951s8647_at* 2.8 15 stable rplF SA2224 50S ribosomal protein L6
 sa_c7621s6634_a_at* 3.1 5 stable rplJ SA0585 50S ribosomal protein L10
 sa_c8818s7755_a_at* 2.8 15 stable rplK SA0583 50S ribosomal protein 11
 sa_c7625s6638_at* 3.8 2.5 stable rplL SA0586 50S ribosomal protein L7/L12
 sa_c9943s8640_a_at* 2.7 2.5 30 rplM SA2207 50S ribosomal protein L13
 sa_c9955s8651_a_at* 2.8 15 stable rplN SA2229 50S ribosomal protein L14
 sa_c4824s4130_a_at* 2.7 15 stable rplO SA2220 50S ribosomal protein L15
 sa_c4864s4170_at* 2.7 15 stable rplP SA2232 50S ribosomal protein L16
 sa_c4792s4098_at* 2.3 15 stable rplQ SA2212 50S ribosomal protein L17
 sa_c4836s4142_at* 2.4 15 stable rplR SA2223 50S ribosomal protein L18
 sa_c1302s1077_a_at* 2.8 15 stable rplS SA1257 50S ribosomal protein L19
 sa_c3028s2585_at* 3.9 2.5 2.5 rplT SA1725 50S ribosomal protein L20
 sa_c2926s2487_at* 3.2 5 30 rplU SA1702 50S ribosomal protein L21
 sa_c4872s4181_at* 2.6 15 stable rplV SA2234 50S ribosomal protein L22
 sa_c10192s8875_a_at 3.7 5 30 rplW SA2237 50S ribosomal protein L23
 sa_c4852s4158_at* 2.4 15 stable rplX SA2228 50S ribosomal protein L24
 sa_c7511s6531_a_at* 2.6 15 stable rplY SA0545 50S ribosomal Protein L25
 sa_c2922s2484_a_at* 2.4 5 stable rpmA SA1700 50S ribosomal protein L27
 sa_c4860s4166_at* 2.7 15 stable rpmC SA2231 50S ribosomal protein L29
 sa_c4828s4134_at* 2.4 15 stable rpmD SA2221 50S ribosomal protein L30
 sa_c891s9388_a_at* 2.4 2.5 30 rpmF SA1137 50S ribosomal protein L32
 sa_c3032s2589_x_at* 3.3 5 2.5 rpmI SA1726 50S ribosomal protein L35
 sa_c9623s9171_a_at* 3.1 2.5 2.5 rpsB SA1274 30S ribosomal protein S2
 sa_c4868s4175_a_at* 3.5 15 stable rpsC SA2233 30S ribosomal protein S3
 sa_c3188s2737_a_at 3.9 2.5 30 rpsD SA1769 30S ribosomal protein S4
 sa_c4832s4138_at* 2.8 15 stable rpsE SA2222 30S ribosomal protein S5
 sa_c7136s6248_at* 2.9 15 30 rpsF SA0437 30S ribosomal protein S6
 sa_c8830s7766_a_at* 3.1 15 stable rpsG SA0592 30S ribosomal protein S7
 sa_c4840s4147_a_at* 2.7 15 stable rpsH SA2225 30S ribosomal protein S8
 sa_c4770s4080_a_at* 3.0 2.5 30 rpsI SA2206 30S ribosomal protein S9
 sa_c9963s8658_a_at* 3.0 5 stable rpsJ SA2240 30S ribosomal protein S10
 sa_c4800s4106_at* 3.1 15 stable rpsK SA2214 30S ribosomal protein S11
 sa_c7645s6658_a_at* 2.5 15 stable rpsL SA0591 30S ribosomal protein S12
 sa_c4804s4110_at* 2.4 15 stable rpsM SA2215 30S ribosomal protein S13
 sa_c4844s4152_at* 3.1 15 stable rpsN SA2226 30S ribosomal protein S14
 sa_c10032s8739_a_at* 3.0 5 stable rpsO SA1292 30S ribosomal protein S15
 sa_c1290s1065_at* 3.5 2.5 stable rpsP SA1254 30S ribosomal protein S16
 sa_c10191s8871_a_at* 2.2 15 stable rpsQ SA2230 30S ribosomal protein S17
 sa_c7144s6255_a_at* 4.1 5 stable rpsR SA0439 30S ribosomal protein S18
 sa_c4876s4184_at* 2.7 5 stable rpsS SA2235 30S ribosomal protein S19
 sa_c2719s2293_at* 2.0 15 stable rpsT SA1642 30S ribosomal protein S20
 sa_c9438s8253_a_at* 4.2 5 30 tgt SA1694 queuine tRNA-ribosyltransferase
 sa_c1300s1073_a_at* 5.6 2.5 stable trmD SA1256 tRNA -methyltransferase
 sa_c6837s5972_a_at* 5.1 2.5 15 trmE SA2738 tRNA modification GTPase
 sa_c9619s8379_a_at 3.9 2.5 30 tsf SA1276 translation elongation factor Ts
 sa_c8838s7774_a_at* 2.3 30 stable tuf SA0594 translation elongation factor Tu
 sa_c8748s7692_a_at* 7.4 2.5 30 tyrS SA1778 tyrosyl-tRNA synthetase
 sa_c10017s10482cv_s_at 3.4 2.5 2.5 SA0067 conserved hypothetical
 sa_c8822s7758_at 4.8 2.5 2.5 SA0587 hypothetical protein
 sa_c7641s6656_a_at* 3.0 15 2.5 SA0590 30S ribosomal protein L7
 sa_c1143s924_a_at* 5.5 2.5 30 SA1209 ribosomal large subunit pseudouridine synthase D
 sa_c1390s1164_a_at* 3.8 2.5 30 SA1287 30S ribosomal protein L7
 sa_c2640s2213_a_at 9.2 2.5 2.5 SA1615 ATP dependent DNA helicase
 sa_c2765s2337_a_at 4.5 2.5 15 SA1653 GTP-binding protein YqeH
 sa_c3647s3130_a_at* 3.1 2.5 2.5 SA1913 RNA methyltransferase
Posttranslational modification, protein turnover, chaperone
 sa_c855s656_a_at* 5.1 2.5 2.5 ctaA SA1124 cytochrome oxidase assembly protein
 sa_c859s660_a_at 10.3 2.5 2.5 ctaB SA1125 protoheme IX farnesyltransferase
 sa_c10672s11124_a_at 8.4 30 Stable N315-SA1775 putative conserved Clp protease
Replication, recombination and repair
 sa_c22s9176_a_at 2.4 2.5 stable gyrA SA0006 DNA gyrase, A subunit
 sa_c9918s10462_a_at 4.3 2.5 2.5 int N315-SA1810 integrase
 sa_c3689s3168_a_at 3.6 2.5 2.5 mutY SA1926 A/G-specific adenine glycosylase
 sa_c2636s2209_a_at 5.7 2.5 30 nfo SA1614 endonuclease IV
 sa_c8270s7248_a_at 6.6 2.5 30 nrdE SA0792 ribonucleotide-diphosphate reductase α
 sa_c8453s7413_a_at 5.8 15 stable nuc SA0860 thermonuclease precursor
 sa_c2914s2476_a_at* 4.6 2.5 30 obgE SA1699 GTPase ObgE
 sa_c1773s1505_a_at 4.9 2.5 30 parC SA1390 DNA topoisomerase IV, A subunit
 sa_c2887s2452_a_at* 3.3 2.5 2.5 recJ SA1691 single-stranded-DNA-specific exonuclease
 sa_c1320s1091_a_at* 3.8 2.5 ND rnhB SA1261 ribonuclease HII
 sa_c2908s2469_a_at* 4.0 2.5 2.5 ruvA SA1697 Holliday junction DNA helicase RuvA
 sa_c9430s8244_a_at* 2.9 2.5 30 ruvB SA1696 Holliday junction DNA helicase RuvB
 sa_c7140s6251_at* 2.5 15 stable ssb SA0438 single-stranded DNA-binding protein
 sa_c9288s8130_a_at 7.7 2.5 2.5 topA SA1267 DNA topoisomerase I
 sa_c2521s2102_a_at* 2.8 2.5 30 xseB SA1567 exodeoxyribonuclease VII, small subunit
 sa_c7463s6487_a_at 4.0 2.5 30 SA0528 DNA replication intiation control protein
 sa_c7541s6559_a_at* 5.2 2.5 2.5 SA0553 Hypothetical protein
 sa_c1344s1117_a_at* 4.1 2.5 2.5 SA1266 putative DNA processing protein
 sa_c1643s1381_at* 3.4 2.5 2.5 SA1357 thermonuclease
 sa_c3053s2604_a_at* 2.4 2.5 30 SA1732 replication initiation and membrane attachment protein
Signal transduction
 sa_c1996s1713_a_at 2.9 2.5 15 arlS SA1450 sensor histidine kinase
 sa_c6155s5336_a_at* 4.4 2.5 2.5 lytS SA0245 sensor histidine kinase
 sa_c8186s7165_a_at 3.0 2.5 30 saeS SA0765 sensor histidine kinase
 sa_c831s632_a_at* 4.8 2.5 15 typA SA1118 GTP-binding protein
 sa_c8316s7293_a_at* 4.0 2.5 2.5 SA0809 GGDEF domain-containing protein
Cell wall and membrane biogenesis
 sa_c10639s11094_s_at 4.4 2.5 30 atl SA1062 bifunctional autolysin
 sa_c2727s2300_a_at 2.3 2.5 stable cap5M SA0148 capsular polysaccharide
 sa_c2767s2340_a_at 2.6 2.5 stable cap5N SA0149 capsular polysaccharide
 sa_c5976s5182_a_at* 3.6 2.5 2.5 galU SA2508 UTP-glucose-1-phosphate
 sa_c6835s5969_a_at* 4.7 2.5 stable gidB SA2736 glucose-inhibited division protein
 sa_c10310s8999_a_at* 3.3 2.5 ND murAA SA2092 UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1
 sa_c6119s5300_a_at 2.4 15 stable scdA SA0244 cell wall biosynthesis protein
 sa_c9611s8371_a_at* 4.8 2.5 2.5 uppS SA1279 undecaprenyl diphosphate synthase
 sa_c10723s11171cv_s_at* 10.5 2.5 2.5 SA0507 LysM domain protein
 sa_c8045s7032_at 8.3 2.5 15 SA0723 LysM domain-containing protein
 sa_c3330s2873_at* 5.9 2.5 2.5 SA1804 polysaccharide biosynthesis protein
 sa_c8776s7720_a_at* 5.6 2.5 2.5 SA1825 N-acetylmuramoyl-L-alanine amidase
 sa_c5094s4391_a_at* 6.0 2.5 2.5 SA2298 N-acetylmuramoyl-L-alanine amidase
 sa_c4394s3743_a_at 2.6 2.5 2.5 SA2088 putative sceD protein
Cell division
 sa_c9724s8471_a_at* 3.6 2.5 15 engA SA1515 GTP-binding protein
 sa_c1104s883_a_at* 2.9 5 30 ftsA SA1198 cell division protein
 sa_c9453s8264_a_at* 4.6 2.5 30 gidA SA2737 tRNA uridine 5-carboxymethylaminomethyl modification enzyme
Intracellular trafficking and secretion
 sa_c9947s8643_a_at* 2.4 15 stable secY SA2219 preprotein translocase
 sa_c10080s8800_at* 3.1 5 stable yajC SA1693 preprotein translocase
 sa_c2899s2464_a_at* 7.1 2.5 15 SA1692 preprotein translocase
Virulence
 sa_c3966s9857_a_at 10.3 5 ND chp N315-SA1755 chemotaxis-inhibiting protein
 sa_c6506s5675_a_at 8.1 2.5 2.5 clfB SA2652 clumping factor B
 sa_c1007s793_a_at 6.3 5 ND efb SA1168 fibrinogen-binding protein
 sa_c5980s5185_a_at 11.4 2.5 stable fnbA SA2511 fibronectin-binding protein A
 sa_c4094s3450_a_at 2.4 2.5 2.5 hlb SA2003 phospholipase C
 sa_c6259s5439_a_at 12.9 2.5 stable isaA SA2584 immunodominant antigen A
 sa_c3972s9863_a_at 4.7 30 ND sak N315-SA1758 staphylokinase precursor
 sa_c1082s9604cv_s_at* 2.3 30 stable spa SA0095 protein A
 sa_c3561s9828_a_at* 2.9 2.5 ND yent2 SA1644 enterotoxin
 sa_c995s782_a_at 7.4 2.5 stable SA1164 fibrinogen binding-related protein
 sa_c2775s9782_at* 2.3 2.5 2.5 SA1657 putative enterotoxin type A
 sa_c5066s4362_a_at* 13.4 2.5 stable SA2291 staphyloxanthin biosynthesis
 sa_c5082s4380_a_at* 14.9 2.5 2.5 SA2295 staphyloxanthin biosynthesis
 sa_c5652s4904_a_at 18.3 2.5 2.5 SA2418 IgG-binding protein
 sa_c6250s5428_a_at* 3.8 2.5 stable SA2581 staphyloxanthin biosynthesis
Resistance
 sa_c5721s4964_a_at* 4.9 2.5 2.5 bcr SA2437 bicyclomycin resistance protein
 sa_c8155s7139_a_at 3.2 5 15 norA SA0754 multi drug resistance protein
 sa_c6618s5778_a_at 4.1 2.5 ND pls SA0050 methicillin-resistance surface protein
Unknown function
 sa_c8661s7610_a_at 5.3 2.5 2.5 kapB SA0956 hypothetical protein
 sa_c8544s7501_a_at 2.7 5 30 sufB SA0918 putative FeS assembly protein
 sa_c692s500_a_at 2.5 2.5 2.5 SA0077 hypothetical protein
 sa_c3008s2564_a_at 2.9 15 2.5 SA0157 hypothetical protein
 sa_c9241s8090_a_at 14.5 2.5 2.5 SA0199 hypothetical protein
 sa_c6847s5978_a_at 6.9 2.5 30 SA0265 hypothetical protein
 sa_c6849s5983_a_at 8.1 2.5 ND SA0266 hypothetical protein
 sa_c6853s5989_a_at 9.8 15 2.5 SA0267 hypothetical protein
 sa_c6861s5997_a_at 4.4 2.5 2.5 SA0272 hypothetical protein
 sa_c6867s6000_a_at 2.5 2.5 stable SA0273 hypothetical protein
 sa_c10505s9038_a_at 2.5 2.5 ND SA0274 hypothetical protein
 sa_c6869s6002_a_at 2.7 2.5 2.5 SA0275 hypothetical protein
 sa_c6883s6013_x_at 2.1 2.5 2.5 SA0285 hypothetical protein
 sa_c7088s6200_a_at* 4.1 2.5 2.5 SA0425 hypothetical protein
 sa_c7833s10214_at 5.0 2.5 ND SA0653 hypothetical protein
 sa_c7835s10216_x_at 4.2 2.5 2.5 SA0654 hypothetical protein
 sa_c8905s7823_a_at* 6.5 2.5 2.5 SA0721 hypothetical protein
 sa_c8928s7841_a_at* 4.5 2.5 2.5 SA0755 hypothetical protein
 sa_c8934s7849_a_at 7.5 2.5 2.5 SA0767 hypothetical protein
 sa_c8196s7173_a_at 12.2 2.5 stable SA0768 hypothetical protein
 sa_c8228s7205_a_at* 3.6 2.5 30 SA0777 hypothetical protein
 sa_c8262s7237_a_at* 2.1 2.5 30 SA0790 membrane domain protein
 sa_c8296s7275_a_at* 5.9 2.5 ND SA0802 hypothetical protein
 sa_c8324s10230_a_at* 4.2 2.5 2.5 SA0812 degV family protein
 sa_c8463s7426_a_at* 5.9 2.5 2.5 SA0864 hypothetical protein
 sa_c8528s7487_a_at 17.3 2.5 2.5 SA0913 hypothetical protein
 sa_c8637s7585_a_at 2.5 2.5 2.5 SA0947 hypothetical protein
 sa_c275s119_a_at 2.8 2.5 ND SA0978 hypothetical protein
 sa_c429s262_a_at* 10.1 2.5 2.5 SA1017 hypothetical protein
 sa_c470s302_at 3.5 2.5 15 SA1026 hypothetical protein
 sa_c517s346_a_at* 6.8 15 stable SA1041 hypothetical protein
 sa_c525s350_at* 14.2 2.5 2.5 SA1044 hypothetical protein
 sa_c807s608_a_at* 4.3 2.5 2.5 SA1112 hypothetical protein
 sa_c863s665_at* 9.2 2.5 15 SA1126 hypothetical protein
 sa_c8780s7721_a_at* 5.8 2.5 2.5 SA1132 hypothetical protein
 sa_c9975s8671_a_at* 8.1 2.5 15 SA1230 hypothetical protein
 sa_c10333s9011_a_at* 3.8 2.5 30 SA1286 hypothetical protein
 sa_c1453s1230_a_at* 3.3 2.5 2.5 SA1307 hypothetical protein
 sa_c1699s1436_a_at* 3.3 2.5 2.5 SA1373 hypothetical protein
 sa_c1711s1447_a_at* 2.1 5 stable SA1378 hypothetical protein
 sa_c1762s1498_a_at* 5.9 2.5 30 SA1388 hypothetical protein
 sa_c2066s1777_a_at* 9.1 2.5 2.5 SA1468 hypothetical protein
 sa_c2109s1814_a_at* 23.2 2.5 ND SA1481 hypothetical protein
 sa_c2120s1823_a_at* 7.8 2.5 2.5 SA1483 hypothetical protein
 sa_c2481s2059_at 2.8 2.5 2.5 SA1556 hypothetical protein
 sa_c10583s11040_a_at* 2.2 2.5 ND SA1585 hypothetical protein
 sa_c2644s2217_a_at 5.0 2.5 30 SA1616 hypothetical protein
 sa_c2647s2221_a_at 7.5 2.5 30 SA1617 hypothetical protein
 sa_c2693s2265_a_at* 4.1 2.5 30 SA1633 hypothetical protein
 sa_c2695s2269_a_at* 3.0 2.5 2.5 SA1634 hypothetical protein
 sa_c2745s2315_a_at* 4.5 2.5 30 SA1647 hypothetical protein
 sa_c9631s8387_a_at* 3.3 2.5 30 SA1648 hypothetical protein
 sa_c2747s2320_a_at 3.1 2.5 30 SA1649 hypothetical protein
 sa_c2757s2330_a_at* 3.3 2.5 2.5 SA1651 hypothetical protein
 sa_c9407s9231_a_at* 2.6 5 stable SA1701 hypothetical protein
 sa_c3170s2715_a_at* 3.4 2.5 2.5 SA1763 hypothetical protein
 sa_c10660s11112cv_s_at* 2.3 2.5 ND SA1805 hypothetical protein
 sa_c3441s2971_a_at* 2.9 2.5 30 SA1836 hypothetical protein
 sa_c3481s3008_a_at* 3.7 2.5 30 SA1847 hypothetical protein
 sa_c3491s9181_a_at* 2.9 2.5 ND SA1850 hypothetical protein
 sa_c3621s3099_a_at 7.7 2.5 2.5 SA1903 hypothetical protein
 sa_c10121s8844_a_at 3.3 2.5 stable SA1940 hypothetical protein
 sa_c3838s3307_a_at 2.7 2.5 ND SA1971 hypothetical protein
 sa_c3924s3392_a_at* 4.1 2.5 30 SA1993 hypothetical protein
 sa_c3932s3401_a_at* 5.5 2.5 15 SA1995 hypothetical protein
 sa_c4171s3522_a_at* 5.4 2.5 stable SA2033 hypothetical protein
 sa_c4173s3526_a_at* 8.5 2.5 15 SA2034 hypothetical protein
 sa_c4185s3537_a_at 2.8 2.5 ND SA2037 hypothetical protein
 sa_c4365s3717_a_at 4.0 2.5 2.5 SA2082 hypothetical protein
 sa_c4438s3783_a_at* 2.8 15 2.5 SA2102 hypothetical protein
 sa_c4593s3925_a_at* 5.8 2.5 2.5 SA2152 hypothetical protein
 sa_c10197s8880_a_at* 3.9 2.5 2.5 SA2250 hypothetical protein
 sa_c4919s4228_a_at* 3.2 2.5 2.5 SA2251 hypothetical protein
 sa_c5005s4307_a_at* 3.7 2.5 2.5 SA2275 BioY family protein
 sa_c5199s4501_a_at* 24.4 2.5 2.5 SA2328 hypothetical protein
 sa_c5223s4525_a_at* 5.8 2.5 2.5 SA2334 hypothetical protein
 sa_c10593s9072cs_s_at 2.9 2.5 2.5 SA2338 hypothetical protein
 sa_c5492s4755_a_at* 2.1 2.5 30 SA2373 hypothetical protein
 sa_c9334s8169_a_at* 5.1 2.5 2.5 SA2383 hypothetical protein
 sa_c5606s4859_a_at* 2.8 2.5 30 SA2402 hypothetical protein
 sa_c6038s5239_a_at* 3.6 2.5 2.5 SA2528 hypothetical protein
 sa_c6102s5291_a_at 5.1 2.5 2.5 SA2548 hypothetical protein
 sa_c6151s5333_a_at* 3.5 2.5 ND SA2557 hypothetical protein
 sa_c6815s10098_at* 4.6 2.5 ND SA2728 hypothetical protein
 sa_c9448s8258_a_at* 2.1 2.5 ND SA2734 hypothetical protein
 sa_c7837s10217_at 3.8 2.5 ND N315-SA0556 hypothetical protein
 sa_c8222s10227_at* 3.9 2.5 2.5 N315-SA0671 hypothetical protein
 sa_c9400s10363_at* 2.7 2.5 stable N315-SA0692 hypothetical protein
 sa_c2124s1827_at 2.0 stable stable N315-SA1278 hypothetical protein
 sa_c3962s9856_a_at* 4.0 15 2.5 N315-SA1754 hypothetical protein
 sa_c9895s10439_a_at* 3.9 30 ND N315-SA1759 lytic enzyme
 sa_c3973s9865_a_at* 3.0 stable ND N315-SA1760 hypothetical protein
 sa_c3979s9871_at* 3.9 stable ND N315-SA1762 hypothetical protein
 sa_c9897s10440_s_at* 5.1 15 stable N315-SA1765 hypothetical protein
 sa_c3992s9884_a_at* 5.4 15 stable N315-SA1766 hypothetical protein
 sa_c3995s9886_a_at* 5.2 30 stable N315-SA1767 hypothetical protein
 sa_c4003s9891_a_at* 3.0 30 stable N315-SA1768 hypothetical protein
 sa_c4005s9893_a_at* 4.9 30 stable N315-SA1769 hypothetical protein
 sa_c4009s9897_a_at* 4.2 30 stable N315-SA1770 hypothetical protein
 sa_c4010s9899_at* 6.6 15 stable N315-SA1771 hypothetical protein
 sa_c4012s9901_a_at* 5.6 30 stable N315-SA1772 hypothetical protein
 sa_c4014s9903_a_at* 7.3 30 30 N315-SA1773 hypothetical protein
 sa_c10670s11122_a_at* 7.1 30 stable N315-SA1774 hypothetical protein
 sa_c4020s9905_at* 7.5 15 stable N315-SA1776 hypothetical protein
 sa_c10134s10547_a_at* 4.7 2.5 stable N315-SA1777 hypothetical protein
 sa_c4550s9974_x_at 4.5 2.5 2.5 N315-SAS070 hypothetical protein
 sa_c4556s9980_at 2.7 2.5 2.5 N315-SAS072 hypothetical protein
 sa_c9380s9405_a_at* 9.8 2.5 ND SACOL2526 putative membrane protein, authentic point mutation
 sa_c3984s9875_at* 5.2 30 30 SAR2047 hypothetical protein
 sa_c10668s11120_a_at* 4.5 30 2.5 SAR2051 hypothetical protein
 sa_c4001s9889_a_at* 5.3 30 stable SAR2053 hypothetical protein
 sa_c3987s9878_at* 4.7 15 30 SAV1953 phi PVL ORF 20 and 21 homolog
 sa_c4073s9945_at 3.4 2.5 2.5 SAV1992 hypothetical protein
*

Functional category and GeneChip qualifier indicated.

†

S. aureus strain COL locus unless otherwise indicated.

Alkaline-shock conditions increased the transcript titers of 128 genes (Figure 1B; Table 3). Interestingly, the majority of induced genes of known function were involved in amino acid biosynthesis and are not believed to be members of the σB regulon (Bischoff et al. 2004). More specifically, genes encoding enzymes required for lysine biosynthesis, dapA, dapB, and dapD, where up-regulated 4.5 to 9.4–fold. Genes involved in synthesis of the branched amino acids valine and isoleucine (ilvB and ilvC), as well as leucine (leuA-leuD), histidine (hisC, hisG, hisH, and hisZ), and threonine (thrB and thrC) were up-regulated between 2.2 and 23.3-fold in response to alkaline shock conditions. In addition to increased expression of amino acid biosynthesis genes, alkaline-shock induced the transcript titers of genes of the Opp oligopeptide system (oppA-oppC, 7.3 to 12.1-fold), which is believed to mediate the influx of essential amino acids (Hiron et al. 2007). It was also determined that alkaline conditions induced expression of genes that are presumed to maintain intracellular homeostasis and oxidative damage protection (Musarrat and Ahmad 1991). More specifically, the mnh operon (mnhA-mnhG; 3.1 to 4.6-fold), which is believed to encode a Na+/H+ antiporter and participate in neutralizing alkalinized conditions within other bacterial species, was found to be induced in response to alkali conditions (Hiramatsu et al. 1998). Likewise, alkaline shock induced expression of reactive oxygen species detoxifying proteins (katA and two OsmC-peroxidase family proteins) and several oxidative DNA damage repair enzymes, including: uvrA, uvrB, sbcC, and sbcD.

Table 3.

Genes up-regulated in alkaline-shocked cells.

Category and qualifier* Fold induction mRNA half-life (min)
Gene Locus† Description
pH 7.2 pH 10
Amino acid transport and metabolism
 sa_c1918s1640_a_at 7.1 ND 2.5 asd SA1429 aspartate-semialdehyde dehydrogenase
 sa_c1922s1644_a_at 9.4 ND 2.5 dapA SA1430 dihydrodipicolinate synthase
 sa_c1924s1648_a_at 5.7 ND 5 dapB SA1431 dihydrodipicolinate reductase
 sa_c1928s1652_a_at 4.5 ND 5 dapD SA1432 dicarboxylate N-succinyltransferase
 sa_c8240s7220_a_at 2.2 2.5 2.5 hisC SA0784 histidinol-phosphate aminotransferase
 sa_c6724s5865_a_at 3.2 ND 2.5 hisG SA2703 ATP phosphoribosyltransferase
 sa_c6708s5850_a_at 2.9 ND 5 hisH SA2699 imidazole glycerol phosphate synthase, glutamine amidotransferase subunit
 sa_c6728s5871_a_at 4.1 ND 2.5 hisZ SA2704 ATP phosphoribosyltransferase regulatory subunit
 sa_c1659s1395_a_at 17.0 5 2.5 hom SA1362 homoserine dehydrogenase
 sa_c5195s4497_a_at* 2.7 2.5 2.5 hutG SA2327 formiminoglutamase
 sa_c4213s3565_a_at 14.8 ND 2.5 ilvB SA2043 acetolactate synthase, large subunit, biosynthetic type
 sa_c9931s8627_a_at 18.5 ND 5 ilvC SA2045 ketol-acid reductoisomerase
 sa_c4217s3569_at 56.9 ND 5 ilvN SA2044 acetolactate synthase 1 regulatory subunit
 sa_c4223s3575_a_at 23.3 ND 5 leuA SA2046 2-isopropylmalate synthase
 sa_c4229s3580_a_at 4.1 ND 15 leuC SA2048 3-isopropylmalate dehydratase, subunit 1
 sa_c4239s3588_a_at 4.4 ND 15 leuD SA2049 3-isopropylmalate dehydratase, subunit 2
 sa_c10571s9056_a_at 7.3 ND 2.5 oppB SA0991 oligopeptide ABC transporter
 sa_c324s166_a_at 12.1 ND 2.5 oppC SA0992 oligopeptide ABC transporter
 sa_c350s191_a_at 9.7 ND 5 oppA SA0995 oligopeptide ABC transporter
 sa_c1669s1406_a_at 12.3 2.5 2.5 thrB SA1364 homoserine kinase
 sa_c1665s1401_a_at 10.2 ND 2.5 thrC SA1363 threonine synthase
 sa_c1810s1538_a_at 3.4 ND 5 tyrA SA1401 prephenate dehydrogenase
 sa_c4120s3473_a_at 3.3 ND 2.5 SA0191 M23/M37 peptidase domain protein
 sa_c7102s6213_a_at 3.0 ND 5 SA0429 homocysteine methyltransferase
 sa_c7199s6265_a_at 2.9 15 15 SA0444 conserved hypothetical protein
 sa_c9581s8342_a_at 10.6 ND 2.5 SA1360 aspartate kinase
 sa_c3202s2750_a_at 2.9 ND 2.5 SA1772 aminotransferase, class V
 sa_c5176s4476_a_at 2.2 ND 5 SA2322 M20/M25/M40 family peptidase
 sa_c5470s4736_a_at 2.7 ND 2.5 SA2368 acetyltransferase, GNAT family
 sa_c5355s4632_a_at 2.2 2.5 2.5 SA2453 ABC transporter
 sa_c6224s5400_a_at 3.2 2.5 2.5 SA2575 aminotransferase, class I
Carbohydrate transport and metabolism
 sa_c1812s1540_a_at 6.2 2.5 5 SA1402 putative glutamyl aminopeptidase
Lipid transport and metabolism
 sa_c10513s9045_a_at 2.1 ND 15 fabG SA2482 3-oxoacyl-reductase
 sa_c2791s2362_a_at 5.4 2.5 2.5 SA1661 putative acetyl-CoA carboxylase
 sa_c2799s2367_a_at 4.6 ND 2.5 SA1662 putative acetyl-CoA carboxylase
Inorganic ion transport and metabolism
 sa_c1679s1417_a_at 2.0 2.5 15 katA N315-SA1170 Catalase
 sa_c7917s9265_a_at 3.1 ND 2.5 mnhA SA0679 putative Na+/H+ antiporter
 sa_c7931s6914_a_at* 3.1 2.5 5 mnhD SA0682 putative Na+/H+ antiporter
 sa_c8887s7802_a_at* 4.1 2.5 5 mnhE SA0684 putative Na+/H+ antiporter
 sa_c7937s6924_at* 4.6 2.5 15 mnhF SA0685 putative Na+/H+ antiporter
 sa_c7941s6928_a_at* 4.0 2.5 15 mnhG SA0686 putative Na+/H+ antiporter
 sa_c9538s8314_a_at 2.2 ND 2.5 phnD SA0128 phosphonate ABC transporter
Energy production and conversion
 sa_c4225s3576_a_at 10.8 ND 5 leuB SA2047 3-isopropylmalate dehydrogenase
 sa_c8930s7847_a_at 2.4 5 5 SA0763 oxidoreductase
 sa_c8671s7618_a_at 2.3 2.5 5 SA0959 NADH-dependent flavin oxidoreductase
 sa_c5174s4471_a_at 4.0 2.5 5 SA2321 oxidoreductase
Coenzyme transport and metabolism
 sa_c3204s2753_a_at 4.8 ND 5 serA SA1773 D-3-phosphoglycerate dehydrogenase
 sa_c6220s5396_a_at 2.6 2.5 5 SA2574 2-hydroxyacid dehydrogenase family
Transport
 sa_c6938s6059_a_at 2.2 2.5 2.5 SA0305 ABC transporter
 sa_c2783s2353_a_at 3.3 ND 5 SA1659 hypothetical protein
Transcription
 sa_c10143s10555cv_s_at 7.9 2.5 15 N315-SA1804 putative transcriptional regulator
Signal transduction
 sa_c3083s2636_a_at 2.4 2.5 2.5 phoP SA1740 alkaline phosphatase synthesis transcriptional regulatory protein
 sa_c8744s7687_a_at 14.7 15 15 SA1759 universal stress protein family
Posttranslational modification, protein turnover, chaperone
 sa_c8485s7447_a_at 3.5 2.5 15 SA0872 OsmC/Ohr family protein
 sa_c3196s2743_a_at 3.5 2.5 5 SA1771 OsmC/Ohr family protein
 sa_c3603s3083_a_at 2.0 2.5 2.5 SA1897 putative protein export protein PrsA
Replication, recombination and repair
 sa_c1731s9098_a_at 3.2 2.5 2.5 sbcC SA1382 exonuclease
 sa_c1727s1464_a_at 3.6 2.5 2.5 sbcD SA1381 exonuclease
 sa_c8354s7326_a_at 2.3 2.5 2.5 uvrA SA0824 excinuclease ABC, A subunit
 sa_c10548s11008cv_s_at 3.1 2.5 2.5 uvrB SA0823 excinuclease ABC, B subunit
 sa_c1804s1534_a_at 30.4 ND 2.5 SA1400 ImpB/MucB/SamB family protein
 sa_c10309s10698_a_at 5.1 ND 15 N315-SA1196 conserved ImpB/MucB/SamB family protein
Cell wall and membrane biogenesis
 sa_c2346s1974_a_at 13.0 ND 2.5 cap5A SA0136 capsular polysaccharide biosynthesis
 sa_c2399s1991_a_at 8.3 ND 2.5 cap5C SA0138 capsular polysaccharide biosynthesis
 sa_c2413s1997_a_at 5.2 ND 2.5 cap5D SA0139 capsular polysaccharide biosynthesis
 sa_c9546s8318_a_at 5.8 ND 5 cap5E SA0140 capsular polysaccharide biosynthesis
 sa_c2479s2056_a_at 4.4 ND 5 cap5F SA0141 capsular polysaccharide biosynthesis
 sa_c2516s2092_a_at 3.2 ND 15 cap5G SA0142 UDP-N-acetylglucosamine 2-epimerase
 sa_c1737s1469_a_at 2.6 ND 5 mscL N315-SA1182 large-conductance mechanosensitive channel
 sa_c8184s7162_a_at 2.0 2.5 2.5 SA0764 glycosyl transferase, group 2 family protein
 sa_c9866s8605_at 2.7 2.5 2.5 SA1932 glycosyltransferase
 sa_c6240s5417_a_at 2.1 2.5 2.5 SA2578 glycosyl transferase, group 2 family protein
 sa_c6575s5743_a_at* 3.8 2.5 2.5 SA2668 LPXTG cell wall surface anchor family p
Virulence
 sa_c7173s10144_at 7.3 2.5 2.5 SA0904 pathogenicity island protein
 sa_c7177s10148_a_at* 8.0 ND 5 SA0905 pathogenicity island protein
Resistance
 sa_c10584s11041_s_at 3.1 5 15 N315-SA1529 metallo-beta-lactamase superfamily protein
 sa_c3138s9790_s_at 2.6 2.5 15 MSSA476-SAS1634 metallo-beta-lactamase superfamily protein
Phage
 sa_c7182s10152cs_s_at 10.0 2.5 2.5 SA2014 phage terminase family protein
 sa_c10465s10903_s_at 8.0 15 15 N315-SA1801 phage anti-repressor
Unknown function
 sa_c939s733_a_at 4.2 ND 15 SA0089 antigen, 67 kDa
 sa_c978s764_a_at 2.1 2.5 2.5 SA0092 hypothetical protein
 sa_c6917s6037_a_at 2.8 ND 2.5 SA0299 hypothetical protein
 sa_c7132s6241_a_at 18.2 ND 15 SA0436 hypothetical protein
 sa_c7255s6315_a_at 5.0 2.5 15 SA0457 hypothetical protein
 sa_c7313s9398_a_at 25.9 15 15 SA0480 hypothetical protein
 sa_c7321s6366_a_at 2.4 2.5 2.5 SA0488 hypothetical protein
 sa_c8424s7394_a_at 2.2 15 15 SA0851 hypothetical protein
 sa_c8455s7417_a_at 3.1 2.5 2.5 SA0862 hypothetical protein
 sa_c7760s6763_at* 19.9 15 15 SA0625 hypothetical protein
 sa_c8473s7434_a_at 3.0 2.5 5 SA0868 hypothetical protein
 sa_c10616s11070_s_at 2.1 2.5 2.5 SA0871 hypoyhetical protein
 sa_c304s144_a_at 4.9 15 15 SA0985 putative surface protein
 sa_c470s302_at 2.9 2.5 5 SA1026 hypothetical protein
 sa_c485s314_at 281.2 ND 15 SA1033 hypothetical protein
 sa_c1195s976_at 3.2 2.5 2.5 SA1225 hypothetical protein
 sa_c1449s1223_a_at 2.3 15 15 SA1306 hypothetical protein
 sa_c1705s1441_a_at 27.1 2.5 2.5 SA1375 hypothetical protein
 sa_c2275s9666_s_at 2.7 ND 2.5 SA1532 hypothetical protein
 sa_c2789s2357_a_at 5.0 2.5 5 SA1660 hypothetical protein
 sa_c2805s2371_a_at 4.7 2.5 2.5 SA1663 hypothetical protein
 sa_c2807s2375_a_at 6.3 ND 2.5 SA1664 hypothetical protein
 sa_c2851s2417_x_at 3.7 15 5 SA1679 hypothetical protein
 sa_c8524s7483_a_at 3.6 15 15 SA1680 hypothetical protein
 sa_c2942s2505_a_at* 4.9 2.5 2.5 SA1705 hypothetical protein
 sa_c3900s3368_at 17.8 2.5 2.5 SA1986 hypothetical protein
 sa_c3910s3377_a_at 3.4 2.5 2.5 SA1988 hypothetical protein
 sa_c10125s8848_a_at 16.4 stable stable SA1999 hypothetical protein
 sa_c4341s3693_a_at 3.3 2.5 15 SA2076 hypothetical protein
 sa_c4755s4067_a_at 25.6 ND 15 SA2197 putative surface protein
 sa_c5458s4723_a_at 3.4 2.5 15 SA2365 hypothetical protein
 sa_c5906s5139_a_at 4.1 2.5 2.5 SA2491 hypothetical protein
 sa_c10236s10653_at 4.7 ND 2.5 SA2547 hypothetical protein
 sa_c6206s5387_a_at* 21.1 ND 2.5 SA2571 hypothetical protein
 sa_c6248s5424_a_at 2.2 ND 2.5 SA2580 hypothetical protein
 sa_c6312s5485_a_at 3.2 2.5 2.5 SA2601 hypothetical protein
 sa_c6316s5489_a_at 3.2 2.5 2.5 SA2602 hypothetical protein
 sa_c4115s3465_a_at 3.5 2.5 2.5 SA2603 hypothetical protein
 sa_c6325s5493_a_at 4.5 2.5 2.5 SA2605 hypothetical protein
 sa_c6390s5558_at 6.8 ND 2.5 SA2621 hypothetical protein
 sa_c298s136_a_at 4.2 ND 5 SA2681 hypothetical protein
 sa_c9913s10456_a_at 3.1 ND 15 N315-SA1793 hypothetical protein
 sa_c4070s9942_a_at 10.0 15 15 N315-SA1799 hypothetical protein
 sa_c10141s10553_s_at 5.9 15 15 N315-SA1803 hypothetical protein
 sa_c5869s10025_at 2.8 ND 15 N315-SA2259 hypothetical protein
 sa_c4075s9947_at 5.4 ND 15 MW2-MW1930 hypothetical protein
 sa_c2404s9766cs_s_at 7.7 2.5 15 N315-SAS064 hypothetical protein
*

Functional category and GeneChip® qualifier indicated.

†

S. aureus strain COL locus unless otherwise indicated.

Consistent with previous reports, we also determined that alkaline shock conditions induced expression of eight putative virulence factor genes, which included members of the capsule biosynthesis operon (cap5A-cap5G; 3.2 to 13-fold) (Pane-Farre et al. 2006). As shown in Figure 3A., immunoblotting confirmed that capsule production was indeed increased in response to alkaline stress conditions. More specifically, in comparison to mock-treatment (pH 7.4) conditions and acid shock which resulted in a moderate increase in capsule production, alkaline conditions resulted in a more pronounced increase in capsule production. This suggested that capsule production is an alkaline-shock specific response, as opposed to an extreme pH response. Moreover, capsule might directly contribute to S. aureus survival during alkali conditions. However, no growth differences were observed between wild type or isogenic capsule-mutant cells following short term (30 min) or steady-state exposure to acidic (pH 4.0) or alkaline (pH 10.0) conditions (Figure 2B). Thus, while alkaline-shock up-regulates capsule production, it is not likely that doing so directly affects the organism’s pH tolerance. As shown in Figure 3B and 3C., reverse transcription mediated PCR measurements of the first gene of the capsule biosynthesis operon, capA, revealed that alkaline-shock up-regulation of capsule occurs in aσB-independent manner, which is inconsistent with the observations of Pané-Farré and colleagues (Pane-Farre et al. 2006). Given that Pané-Farré convincingly demonstrated that alkaline conditions elicit a σB response, and the sigma factor has been shown to effectively regulate capsule production in S. aureus strains COL, Newman and GP268 (Bischoff et al. 2004), the σB-independence observed here may be a strain dependent phenomenon. Regardless, these results indicate that other stress responsive factors affect S. aureus capsule production.

Figure 3. Capsule Expression.

Figure 3

Panel A shows an immunoblot for capsule detection formed by S. aureus strain UAMS-1 following growth at pH 7.4 (Mock) or induction of the alkaline-shock (pH 10), or acid-shock (pH 4) response. The dilution factor of starting cell-lysate suspensions is shown. Reverse-transcription mediated PCR results of various amounts (0–25 ng) of RNA isolated from wild type (Panel B) or isogenic ΔsigB (Panel C) cells grown at pH 7.4 or following alkaline-shock induction.

Taken together, alkaline-shock conditions appear to elicit a cellular response that is geared toward maintaining cellular pH homeostasis, eliminating oxidative damage moieties/repairing DNA lesions, and increasing cellular amino acid pools through import and biosynthesis pathways while simultaneously decreasing essential biological processes such as nucleic acid and protein synthesis. The finding that members of the protein synthesis machinery are decreased, but components of amino acid biosynthesis pathways and oligopeptide permease systems are upregulated in response to alkaline conditions is reminiscent of the organism’s stringent response (Anderson et al. 2006). The stringent response is an important bacterial system that allows for cellular adaptation to nutrient limiting conditions and is essential for S. aureus survival (Gentry et al. 2000).

Alkaline-Shock elevates the S. aureus stringent response alarmone ppGpp

The key mediator of the S. aureus stringent response is the “alarmone” ppGpp which increases during nutrient limiting conditions (Crosse et al. 2000). ppGpp accumulation redirects RNA polymerase transcript synthesis to members of the organism’s stringent response, resulting in the down-regulation of translation machinery and up-regulation of amino acid biosynthesis and transport systems. Based on the high degree of overlap between stringent response and alkaline responsive genes (71% similarity), we predicted that alkaline shock conditions elicit the S. aureus stringent response. To directly test that possibility, mass-spectroscopy was used to measure the ppGpp levels of S. aureus cells grown at neutral pH and stringent response-, alkaline shock- and acid shock- inducing conditions. As expected, while ppGpp levels were undetectable in cells grown at neutral pH, induction of the organism’s stringent response resulted in a significant increase of ppGpp levels (Table 6). Induction of the alkaline-shock response resulted in guanosine tetraphosphate levels that were comparable to stringent response induced cells, suggesting that the alkaline-shock response inducing conditions activate the organism’s stringent response. Conversely, ppGpp levels of acid-shocked cells were below levels of detection for the system, indicating that the change in guanosine tetraphosphate levels of alkaline shocked cells is not an extreme pH-stress response.

Table 6.

ppGpp Measurements.

Growth Condition ppGpp AUC h/z at 601.9*,† Calculated ppGpp (nM)†
pH 7.4 ND ND
Stringent 12,630 (± 1,704) 53 (± 7)
pH 4.0 ND ND
pH 10.0 9,128 (± 2,578) 38 (± 11)
*

Area Under the Curve (AUC) at 601.9 corresponding to the peak value of commercially available ppGpp.

†

Not Detectable (ND); Standard Deviation is indicated in parathesesis.

Global effects of pH stresses on mRNA stability

Recent studies have revealed that many S. aureus stress response-dependent alterations in transcript abundances can, in part, be attributed to alterations in RNA stability, as opposed (or in addition) to alterations in transcript synthesis. Thus, we set out to determine whether acid- or alkaline-shock conditions alter the mRNA turnover properties of S. aureus transcript species whose titers either increase or decrease in response to each stress. Such a finding would indicate that components of the extreme pH responses are post-transcriptionally regulated in a manner that involves the modulation of their mRNA degradation.

A comparison of the mRNA turnover properties of mock treated (pH 7.2) and pH-shocked cells revealed that their mRNA degradation properties differed. As shown in Figure 4, while most mock treated transcript species were rapidly degraded, induction of either the acid- or alkaline-shock response stabilized many mRNA species. More specifically, consistent with previous observations, it was found that during exponential growth at pH 7.4 most (83.9%) transcripts were rapidly degraded (half-lives of ≤ 2.5 min), 15% had intermediate half-lives (> 2.5 min but ≤ 30 min), and 1 % were stable (half lives > 30 min) (Anderson et al. 2006; Roberts et al. 2006). Conversely, during acid- or alkaline- shock conditions only 63.6% and 50.3% mRNA species had a half-life of ≤ 2.5 min, respectively. In comparison to growth at pH 7.4, exposure to acidic and alkaline conditions resulted in an increase in the number of transcripts exhibiting an intermediate half-life (38.6% and 24.1%, respectively). Interestingly, 10.5% of acidic-shocked bacterial transcripts were found to be stable, whereas 1.1% alkaline shock induced transcripts were stable.

Figure 4. mRNA Turnover Properties of Acid- or Alkaline-Shocked Exponential Phase S. aureus.

Figure 4

Graphed are the total numbers of S. aureus exponential phase mRNA species (% RNA molecules) exhibiting a half-life of less than 2.5 min (black bar), 2.5–5.0 min (dark-grey), 5.0–15.0 min (white), 15.0–30.0 min (hashed), or greater than 30 min (light-grey) during growth at pH 7.4 or following alkaline-shock (pH 10.0) or acid-shock (pH 4.0) induction.

A comparison of the mRNA turnover properties of transcripts whose titers either increased or decreased in response to sudden pH changes, revealed that pH-dependent alterations in mRNA degradation may, in part, account for the changes in their mRNA levels. For instance, 43 % and 16 % of the transcripts that were found to be up-regulated in response to acid- or alkaline-shock, respectively, exhibited a corresponding increase in mRNA stability during that stress condition, in comparison to mock treatment (Figure 5; Tables 2–4). This suggests that alterations in mRNA turnover, as opposed (or in addition) to alterations in transcript synthesis, may directly affect pH stress-dependent changes in their transcript titers. This phenomenon may be more expansive than observed here, as 31 % and 44 % of the pH 4 and pH 10 induced transcripts were not measurable during growth at pH 7.4, as a consequence their mRNA turnover properties could not be compared. Thus, while the transcript titers of these mRNA species increase in response to stress, their increase could be attributable to alterations in mRNA synthesis and/or reduced mRNA turnover.

Figure 5. Comparison of the mRNA Degradation Properties of Acid- or Alkaline-Shock Regulated mRNA Species.

Figure 5

Graphed are comparisons of the half-life measurements of mRNA species whose transcript titers increase in response to acid-shock (Panel A) or alkaline-shock (Panel B) conditions. The mRNA turnover properties of these transcripts is shown for unstressed or the indicated stress. Panels C and D show comparisons of the half-life measurements of transcripts that decrease in titer in response to acid- or alkaline- shock conditions, respectively.

A more detailed analysis of the mRNA turnover properties of transcripts that increase in titer in response to extreme pH revealed that most acid- or alkaline-shock inducible transcripts exhibit a half life of less than 2.5 min during growth at pH 7.4. Conversely, when induced in response to acidic conditions, many exhibit half-lives between 15 and 30 min or are stable (≥ 30 min; Figure 5A). Indeed, the average half-life of all acid-shock inducible transcripts is 4.3 min (± 4.2) during growth at neutral pH but is 17.7 min (± 13.6) during growth at pH 4.0; the latter excludes consideration of 8 “stable” transcripts (half life > 30 min). A similar, yet less pronounced trend was observed for alkaline inducible transcripts, which exhibited an average half life of 4.8 min (± 4.7) and 6.5 min (± 5.3) during growth at pH 7.2 and pH 10.0, respectively (Figure 5B).

Many of the mRNA species that were found to both increase in titer and stability in response to acid- or alkaline-shock conditions have been previously suggested to play an important role in adaptation to pH alterations. For instance, it was found that transcripts involved in maintaining the pH of the cell (ureA and ureB), transport (SACOL0086) and augmenting the reducing power of the cell (SACOL0111, SACOL0409, SACOL2534, and SACOL2594) were all stabilized during acid-shock conditions. Among the transcripts whose titers and stability increased in response to alkaline shock were members of the Mnh Na+/H+ antiporter system (mnhD-mnhG), antimicrobial resistance, oxidative damage protection (katA, SACOL0872, and SACOL1771), and numerous hypothetical genes (Table 3). This suggests that alterations in mRNA turnover, as opposed (or in addition) to alterations in transcript synthesis, may directly affect pH stress-dependent changes in their transcript titers and, consequently, facilitate S. aureus’ ability to adapt to extreme decreases or increases in pH.

Taken together, these data suggest that the mRNA turnover properties of acid- and alkaline-shocked cells differ from that of unstressed S. aureus. Further, changes in the mRNA levels of many differentially regulated genes could be attributable to their regulation at the post-transcriptional level in a manner that involves stress-dependent regulated changes in mRNA turnover. This suggests that modulating RNA turnover may be an important component of S. aureus’ ability to cope with acidic and alkaline conditions.

Stable RNA species and ribonucleases

As an entrée towards identifying factors that might contribute to acid- and/or alkaline-shock mediated mRNA stabilization, we considered that the two most likely scenarios that could account for these phenotypes are: 1) each stress condition induces/activates cellular RNA stabilizing moieties and/or 2) each condition represses ribonuclease (RNase) production/function.

Small non-coding RNAs (sRNAs) are a recently recognized class of regulatory molecules that affect the mRNA turnover properties of target transcripts of other bacterial species. The S. aureus virulence factor accessory regulator, RNAIII, is a sRNA-like molecule binds to and consequently stabilizes a subset of target transcripts (i.e. hla) suggesting that sRNAs exist within the organism (Morfeldt et al. 1995). Indeed, several recent reports have documented the existence of sRNA-like or bona fide sRNA molecules in S. aureus (Pichon and Felden 2005; Abu-Qatouseh et al. 2010; Beaume et al. 2010; Bohn et al. 2010). Moreover, we have previously shown that S. aureus produces a set of small extremely stable RNA molecules that lack an obvious open reading frame in a growth phase or stress responsive manner and found that at least two of these molecules regulate gene expression, presumably by altering the mRNA degradation properties of bound transcripts [(Anderson et al. 2006; Roberts et al. 2006) Miller and Dunman unpublished]. GeneChip® analyses revealed that during acid-shock conditions S. aureus produces 5 small extremely stable RNA species (SSRs), which lack an obvious open reading frame and map to genomic intergenic regions (Supplemental Table 1). These molecules are either not produced or are unstable during exponential or stationary phase growth, cold-shock, heat-shock, stringent, SOS, alkaline-shock, and iron-, manganese-, and zinc-deficient conditions. Likewise, our results revealed that during alkaline-shock conditions the organism produces a single SSR, which is located within the S. aureus genome at least three times (Supplemental Table 1). Any one (or a combination thereof during acid-shock conditions) may behave as a sRNA molecule and contribute to the altered mRNA turnover properties of pH-stressed cells. In addition to the production of SSRs it was observed that at least 4 putative ribonucleases were down-regulated in response to acidic conditions (YhaM, RnpA, RNase HII, and XseB; Table 2); 6 potential ribonucleases were downregulated during alkaline-shock conditions (RNase III, SACOL0540, RNase HII, XseA/XseB, and SACOL0534; Table 4). The altered mRNA turnover properties of pH stressed cells could reflect the corresponding down-regulation of these ribonucleases, SSR production, or both.

DISCUSSION

The successfulness of S. aureus as a human pathogen can be, in part, attributed to its ability to adapt to host-associated environmental stresses, such as alterations in alkalinity. Indeed, we and others have recently shown that S. aureus has developed adaptive responses which are presumed to augment the organism’s ability to survive pH changes and play important roles in pathogenesis (Weinrick et al. 2004; Pane-Farre et al. 2006; Bore et al. 2007; Geiger et al. 2010). Nonetheless, the mechanisms that govern the organism’s changes in gene expression in response to acidic or alkaline conditions are poorly characterized. Recent studies indicate that stress-dependent alterations in mRNA turnover are likely to augment S. aureus adaptation to stringent, heat-shock, and cold-shock conditions, but not SOS inducing conditions (Anderson et al. 2006). Thus, the main goal of the current study was to assess whether the modulation of mRNA turnover is likely to facilitate S. aureus adaptation to transient alterations in pH.

GeneChip® analyses indicate that the conditions used here elicit S. aureus cellular responses expected of acid- or alkaline-shocked cells. More specifically, we found that 30 min exposure to pH 4.0 adjusted medium affects the expression of noted genes of the organism’s acid-shock response, including: acid-neutralization processes and gene products that may increase its reducing power while simultaneously down-regulates macromolecular processes and systems that influx H+. Alkaline-shock conditions appear to elicit a cellular response that is geared toward maintaining cellular pH homeostatus, eliminating oxidative damage moieties/repairing DNA lesions.

One of the predominant outcomes of comparing the transcriptional profiles of acid- and alkaline-shocked cells is the observation that systems involved in maintaining intracellular pH homeostasis exhibit opposing expression properties in response to low and high pH stress. For instance, as previously described, acid-shock conditions increased transcript titers of the urease utilization system. During alkaline shock, the system was downregulated. Conversely, acid shock repressed Na+/H+ antiporters, whereas they were induced in response to alkaline conditions. Adaptation of S. aureus to each pH stress differed also in up-regulation of genes involved in amino acid metabolism. Alkaline-shock response conditions induced the transcript titers of gene products that are involved in branched amino acid biosynthesis, whereas acid-shock response conditions did not (the relevance of this observation is discussed below).

Both conditions also affected the expression properties of the organism’s virulon. Acid-shock resulted in a general down-regulation in the expression of the organism’s virulence factors. Among noted virulence factor regulatory genes that were down-regulated and could account for this phenomenon were the SaeRS-two component regulatory system, LytSR, ArlSR, and GdpS. Alkaline-shock resulted in the down-regulation of the major virulence factor regulator, RNAIII, as previously described (Regassa and Betley 1992). However, consistent with our previous observations for S. aureus strain UAMS-1, the reduction in RNAIII levels seemingly had minimal effect on the expression of the organism’s virulon (Cassat et al. 2006). Nonetheless, alkaline shock conditions resulted in a striking up-regulation in members of the capsule biosynthesis operon. This result is in agreement with the work of Pane-Farre, who also observed that alkaline-shock induced S. aureus strain COL capsule transcript titers (Pane-Farre et al. 2006). Given the importance of capsule biosynthesis in the organism’s ability to cause disease and the popularity of the molecule as a vaccine candidate we investigated this phenotype further. Immunoblotting confirmed that capsule production is indeed increased in response to alkaline shock conditions, implying that capsule may augment the organism’s ability to tolerate high pH. However, growth curve analyses indicated that this is not the case. We did not observe any growth advantage at high pH (i.e. alkali protective effects) for a capsule producing strain when compared an isogenic capsule deficient background. Further, real time PCR revealed that alkaline-mediated up-regulation of the capsule biosynthesis regulon is σB independent in S. aureus strain UAMS-1, which is in contrast to previous predictions and may reflect a strain background specific phenomenon (Pane-Farre et al. 2006).

Despite the aforementioned differences, we also observed considerable overlap between the two stress responses suggesting that, while the organism elicits specific processes to cope with low verses high pH stress, it also relies on a common set of biological processes to cope with extreme pH stress. More specifically, a number of genes were down-regulated in response to both pH stresses, particularly those involved in protein and nucleic acid synthesis, indicating that acid and alkaline shock conditions cause an overall decrease in cellular metabolism. In support of that possibility, extended growth during acid- or alkaline-shock conditions resulted in diminished cellular proliferation in comparison to S. aureus grown at neutral pH. This altered growth phenotype may provide the opportunity for the organism to repair and/or eliminate pH-mediated cellular damage. Similar phenotypes have been shown for other bacteria; acidic pH limits Campylobacter jejuni and Bacillus cereus growth, whereas alkaline pH has been reported to limit the growth of Desulfovibrio vulgaris and E. faecalis (Appelbe and Sedgley 2007; Stolyar et al. 2007; Mols and Abee 2008; Reid et al. 2008). Interestingly, diminished growth of E. faecalis during alkaline-pH stress correlates to induction of the organism’s stringent response (Abranches et al. 2009).

The stringent response was first characterized as a physiological condition that promotes Escherichia coli adaptation to nutrient limiting conditions via accumulation of intracellular pools of the “alarmones” pppGpp and ppGpp, which are collectively referred to as (p)ppGpp. (p)ppGpp, in turn, is thought to bind to E. coli RNA polymerase and redirect transcript synthesis. Only recently have corresponding studies been extended to other bacteria; this renewed interest has been accentuated, in part, by the realization that the stringent response plays an important role in bacterial virulence and antibiotic tolerance (Joseleau-Petit et al. 1994; Greenway and England 1999; Lemos et al. 2004; Gaynor et al. 2005; Kim et al. 2005; Pomares et al. 2008; Abranches et al. 2009). Those studies have also led to the realization that the stringent response is a more ubiquitous cellular stress response that allows bacteria to switch from a growth to a survival mode. Using DNA microarrays we found that induction of the S. aureus stringent response results in a physiological state that is similar to other bacteria and includes the down-regulation of translational processes and simultaneous up-regulation of genes whose products are believed to be involved in amino acid biosynthesis and transport as well as pathogenesis and antibiotic resistance (Anderson et al. 2006). Of direct relevance to the current work, many of these same transcriptional changes were observed to be shared by alkaline-shocked S. aureus. Indeed, there is a 71% transcriptional overlap between stringent and alkaline-shocked exponential phase S. aureus (Anderson et al. 2006). Moreover, we previously showed that stringent response induction results in regulated alterations in mRNA turnover that are similar to the mRNA degradation properties described here for alkaline-shocked cells (Anderson et al. 2006). Based on these similarities we predicted that alkaline-shock conditions elicit the S. aureus stringent response (Boes et al. 2008; Abranches et al. 2009). Our results indicate that this is the case; the stringent response alarmone ppGpp was observed to accumulate within alkaline shocked cells. Conversely, acid-shock responses do not result in ppGpp accumulation. Taken together these results indicate that S. aureus adapts to alkaline shock conditions by eliciting the stringent response. It remains to be seen which of the three putative S. aureus ppGpp synthases, RelP, RelQ, or the essential factor RSH, mediate this phenomenon (Geiger et al. 2010).

Collectively, these results both confirm the work of others and extend our understanding of the organism’s transcriptional responses to extreme pH, particularly in regards to alkaline-shock conditions. Moreover, our data indicate that the conditions used here are appropriate to study the S. aureus acid- and alkaline-shock responses in more detail. Accordingly, we assessed whether the organism alters its mRNA turnover properties in response to pH stress and whether these changes are likely to contribute to its ability to cope with alterations in pH. While mRNA degradation appears to be a rapid process within exponential phase S. aureus grown at pH 7.4, induction of either the acid- or alkaline-shock response resulted in the stabilization of many messenger RNA species. Further, a comparison of the mRNA degradation properties of transcript species that are increased in response to either acid- or alkaline-shock revealed that regulated changes in their decay may, in part, account for their elevated levels. Indeed, 43 % and 16 % of the transcripts that were found to be up-regulated in response to acid- or alkaline-shock, respectively, exhibited a corresponding increase in mRNA stability during that stress condition, in comparison to mock treated cells. Thus, alterations in the mRNA degradation properties of these transcript species are likely to contribute to their elevated levels within the cell during acid and alkaline-shock conditions. This mechanism may provide an efficient means for the organism to increase protein production of factors that contribute to pH adaptation without having to expend energy needed for de novo transcript synthesis.

Among the mRNA species whose changes in mRNA titers could be attributable to alterations in mRNA turnover were several factors that have been well-characterized to contribute to pH adaptation. For instance, the urease system has been shown to facilitate bacterial tolerance to acidic conditions (Ferrero et al. 1992; Bhagat and Virdi 2009; Hu et al. 2009). Our results revealed that the transcript levels for members of the urease system increased in response to acid-shock and that these increases could be due, in part, to stabilization of urease transcripts at low pH. Likewise, acetoin production (alsSD) is believed to promote cellular pH homeostasis and bacterial tolerance to acidic conditions (Hornbaek et al. 2004; Kinsinger et al. 2005; Schilling et al. 2007; Wilks et al. 2009). The current study found that alsSD transcripts levels are increased in response to acid-shock and that this increase correlates to mRNA stabilization during acid-stress. Taken together, these results imply that the modulation of mRNA turnover affects the transcript titers, and presumably protein production, of genes that are likely to mediate S. aureus adaptation to acid-shock conditions. Similarly, regulated changes in mRNA degradation are likely to contribute to the staphylococcal response to alkaline-shock. Indeed, it is well recognized that Na+/H+ antiporters play an essential and predominant role in bacterial adaptation to alkaline conditions (Reviewed in (Padan et al. 2005)). Our results revealed that S. aureus adapt to alkaline shock conditions by increasing the transcript titers of the Mnh Na+/H+ system and that these transcripts are stabilized during high pH stress. While our data indicate that S. aureus alters its mRNA turnover in response to extreme pH stress and that this, in turn, affects the transcript titers of messenger RNA species that are believed to augment the organism’s ability to cope with alterations in pH, it remains to be seen what molecular components govern these changes in RNA degradation.

Non-coding RNAs (sRNAs) are a recently recognized class of regulatory molecules that, when produced, mediate bacterial virulence factor production and stress adaptation. Base-pairing and altering the mRNA turnover properties of target transcripts is one mechanism by which sRNAs regulate biological processes. In that regard, while S. aureus RNAIII contains the open reading frame for δ-hemolysin and, as such, does not meet the strictest definition of a non-coding RNA the molecule has been shown to bind target transcripts and regulate their mRNA turnover properties. Thus, RNAIII can be considered a sRNA like molecule and raises the possibility that the organism is capable of producing other sRNAs. Indeed, recent reports have documented that S. aureus produces at least two sRNA molecules and while their regulatory effects remain to be determined- many others have ostensibly been identified (Pichon and Felden 2005; Abu-Qatouseh et al. 2010; Beaume et al. 2010; Bohn et al. 2010). Accordingly, we and others have found that S. aureus produces a set of extremely stable RNAs that lack an obvious open reading frame in a growth and/or stress dependent manner (Pichon and Felden 2005; Anderson et al. 2006; Roberts et al. 2006). Further, it has been found that at least two of these molecules regulate gene expression (Miller and Dunman, unpublished). A survey of the transcripts that are produced in response to acid- or alkaline-shock conditions indicates that the organism produces 9 stable RNA species that do not contain an open reading frame in response to pH stress. It is intriguing to consider that these molecules may behave as sRNAs and regulate biological processes that contribute to S. aureus pH adaptation. It was also observed that several putative ribonucleases were down-regulated in response to each pH stress condition. Thus, the altered mRNA turnover properties of acid- and alkaline-shocked S. aureus may be a function of any one (or a combination) of these possible ribonucleases, sRNA like molecules or both. Studies are currently underway to define the molecular components that modulate pH stress dependent changes in mRNA turnover, as small molecules that affect their activity would be expected to limit the organism’s ability to adapt to pH stress and could be considered for therapeutic development.

Supplementary Material

Supp Table S1. Supplementary Table 1.

S. aureus sRNA-like molecules that are produced in response to acid-or alkaline-shock conditions.

Table 5.

Genes down-regulated in response to alkaline pH.

Category and qualifier* Fold reduction mRNA half-life (min)
Gene Locus† Description
pH 7.2 pH 10
Amino acid transport and metabolism
 sa_c6513s5681_a_at 4.3 2.5 2.5 arcC SA2654 carbamate kinase
 sa_c6521s5689_a_at 2.4 2.5 ND arcD SA2655 arginine/ornithine antiporter
 sa_c2196s1895_a_at 2.9 2.5 5 aroA SA1504 3-phosphoshikimate 1-carboxyvinyltransferase
 sa_c2199s1902_a_at 4.4 2.5 5 aroB SA1505 3-dehydroquinate synthase
 sa_c2759s2334_a_at* 4.5 2.5 2.5 aroE SA1652 shikimate 5-dehydrogenase
 sa_c9420s8234_a_at* 3.4 2.5 ND betA SA2627 choline dehydrogenase
 sa_c7587s6607_a_at 2.3 2.5 2.5 cysE SA0575 serine acetyltransferase
 sa_c7368s9209_a_at* 7.8 2.5 2.5 cysM SA0502 cysteine synthase/cystathionine beta-synthase family protein
 sa_c5246s4544_a_at* 8.4 2.5 5 gltS SA2340 sodium:glutamate symporter
 sa_c4081s3441_a_at 2.1 2.5 ND ggt SA0188 gamma-glutamyltranspeptidase
 sa_c1139s920_a_at* 11.8 2.5 2.5 IspA SA1208 lipoprotein signal peptidase
 sa_c3744s3222_a_at 2.6 2.5 2.5 map SA1946 methionine aminopeptidase,
 sa_c10721s11169cv_s_at 9.0 2.5 2.5 metB N315-SA0419 cystathionine gamma-synthase
 sa_c3445s9086_a_at* 30.3 2.5 2.5 metK SA1837 S-adenosylmethionine synthetase
 sa_c7740s6743_a_at 3.3 2.5 2.5 proP SA0620 osmoprotectant proline transporter
 sa_c8210s7190_a_at 8.0 2.5 ND pabA SA0773 para-aminobenzoate synthase, glutamine amidotransferase, component II
 sa_c6360s5530_a_at 2.4 2.5 2.5 panC SA2614 pantoate--beta-alanine ligase
 sa_c6355s5526_a_at 2.6 2.5 2.5 panD SA2613 aspartate alpha-decarboxylase
 sa_c3866s3337_a_at 5.7 2.5 ND pheA SA1977 prephenate dehydratase
 sa_c6088s5276_a_at 3.8 2.5 5 sdaAA SA2544 L-serine dehydratase, iron-sulfur-dependent, α
 sa_c6092s5283_a_at* 6.5 2.5 ND sdaAB SA2545 L-serine dehydratase, iron-sulfur-dependent, β
 sa_c8697s7646_a_at 7.7 2.5 2.5 spsA SA0968 signal peptidase IA, inactive
 sa_c5023s4322_at** 2.6 15 ND ureA SA2280 urease, γ
 sa_c5029s4326_a_at** 3.9 15 ND ureB SA2281 urease, β
 sa_c5031s4330_a_at 6.2 15 ND ureC SA2282 urease, α
 sa_c9293s8136_a_at 4.3 2.5 ND ureD SA2286 urease accessory protein
 sa_c5035s4334_at 5.4 5 ND ureE SA2283 urease accessory protein
 sa_c5039s4340_a_at 5.2 15 ND ureF SA2284 urease accessory protein
 sa_c5043s4344_a_at 3.6 2.5 2.5 ureG SA2285 urease accessory protein
 sa_c3997s3420_a_at 3.8 2.5 ND SA0184 peptide ABC transporter
 sa_c6776s5917_a_at 2.1 2.5 2.5 SA0262 choloylglycine hydrolase family
 sa_c7372s10188cs_s_at* 7.3 2.5 2.5 SA0503 trans-sulfuration enzyme family
 sa_c7431s6453_a_at* 3.5 2.5 2.5 SA0519 acetyltransferase, GNAT family
 sa_c7445s6465_a_at 2.8 2.5 ND SA0523 Orn/Lys/Arg decarboxylase
 sa_c7688s6694_a_at 3.8 2.5 2.5 SA0606 HAD superfamily hydrolase
 sa_c7879s6872_at 2.6 2.5 2.5 SA0667 HAD superfamily hydrolase
 sa_c368s210_a_at 2.2 2.5 ND SA1000 oligopeptide ABC transporter,
 sa_c9067s7955_a_at 2.9 2.5 5 SA1036 putative protease
 sa_c10308s8994_a_at 2.5 2.5 2.5 SA1051 isochorismate synthase family
 sa_c5349s4625_a_at* 28.6 2.5 ND SA1108 spermidine/putrescine ABC transporter
 sa_c9028s7925_a_at* 15.0 2.5 ND SA1109 spermidine/putrescine ABC transporter
 sa_c795s596_a_at* 17.0 2.5 5 SA1110 spermidine/putrescine ABC transporter
 sa_c803s604_a_at* 7.9 2.5 2.5 SA1111 spermidine/putrescine ABC transporter
 sa_c1215s998_a_at* 6.8 2.5 2.5 SA1231 protein phosphatase 2C domain-containing protein
 sa_c10578s11035_s_at* 6.3 2.5 2.5 SA1232 protein kinase
 sa_c1368s1139_a_at 4.5 2.5 2.5 SA1281 putative membrane-associated zinc metalloprotease
 sa_c1852s1575_a_at 2.7 2.5 2.5 SA1412 hydrolase-related protein
 sa_c1866s1587_a_at 5.6 2.5 ND SA1414 peptide ABC transporter
 sa_c1870s1592_a_at 4.9 2.5 ND SA1415 peptide ABC transporter
 sa_c1872s1598_a_at 7.6 2.5 ND SA1416 putative peptide ABC transporter
 sa_c1876s1602_a_at 6.9 2.5 ND SA1417 peptide ABC transporter
 sa_c2551s9779_a_at 2.1 2.5 2.5 SA1588 proline dipeptidase
 sa_c9627s8384_a_at 4.3 2.5 2.5 SA1654 HAD superfamily hydrolase
 sa_c9565s8328_a_at 3.4 2.5 2.5 SA1667 peptidase, U32 family
 sa_c9562s8324_a_at 5.0 2.5 2.5 SA1668 peptidase, U32 family
 sa_c2817s2385_a_at 6.2 2.5 2.5 SA1669 O-methyltransferase family protein
 sa_c9532s8312_a_at 3.1 2.5 2.5 SA1677 aminotransferase, class V
 sa_c2910s2472_a_at* 3.9 2.5 2.5 SA1698 hypothetical protein
 sa_c3042s9391_a_at 2.9 2.5 2.5 SA1728 amino acid permease
 sa_c3178s2725_a_at* 3.1 2.5 ND SA1765 aminotransferase, class V
 sa_c5373s4646_a_at* 2.6 2.5 ND SA1915 amino acid ABC transporter
 sa_c3655s3137_a_at 3.3 5 ND SA1916 amino acid ABC transporter,
 sa_c3759s3231_a_at 3.3 2.5 2.5 SA1950 putative cobyric acid synthase
 sa_c3810s3279_a_at 2.9 2.5 ND SA1963 high affinity proline permease
 sa_c4189s3541_a_at 4.9 2.5 2.5 SA2038 O-sialoglycoprotein endopeptidase
 sa_c4197s3549_at 7.3 2.5 2.5 SA2039 putative ribosomal-protein-alanine acetyltransferase
 sa_c9831s8573_a_at 4.2 2.5 2.5 SA2107 phosphotyrosine phosphatase
 sa_c4460s3803_a_at* 3.6 2.5 2.5 SA2109 modification methylase
 sa_c5126s4423_a_at* 4.2 2.5 2.5 SA2309 amino acid permease
 sa_c5389s4662_a_at 3.6 2.5 ND SA2410 amino acid ABC transporter
 sa_c5638s4893_a_at* 13.9 2.5 2.5 SA2412 amino acid ABC transporter
 sa_c8215s7194_a_at 4.1 2.5 2.5 SACOL0774 putative para-aminobenzoate synthase, component I, authentic frameshift
Carbohydrate transport and metabolism
 sa_c8171s9308_a_at 24.0 2.5 2.5 fruA N315-SA0655 fructose specific permease
 sa_c8169s7149_a_at 15.4 2.5 2.5 fruK SA0758 1-phosphofructokinase
 sa_c5217s4516_a_at 4.2 2.5 2.5 galM SA2332 aldose 1- epimerase
 sa_c7032s9332_a_at* 15.9 2.5 ND glpT SA0407 glycerol-3-phosphate transporter
 sa_c5987s5189_a_at 2.9 2.5 ND gntP SA2514 gluconate transporter
 sa_c5995s5196_a_at 4.6 2.5 ND gntK SA2515 gluconokinase
 sa_c6202s5382_a_at 3.2 2.5 15 lacA SA2570 galactoside O-acetyltransferase
 sa_c10479s10921_s_at 4.0 2.5 2.5 manA1 SA2135 mannose-6-phosphate isomerase
 sa_c6557s5724_a_at 5.9 2.5 ND manA2 SA2664 mannose-6-phosphate isomerase
 sa_c8176s7154_a_at 2.5 2.5 2.5 nagA SA0761 N-acetylglucosamine-6-phosphate deacetylase
 sa_c6517s5684_a_at 2.2 2.5 5 rbsK SA0253 ribokinase
 sa_c9971s8667_a_at 2.5 2.5 2.5 rpe SA1235 ribulose-phosphate 3-epimerase
 sa_c8397s7370_a_at* 2.1 15 15 tpiA SA0840 triosephosphate isomerase
 sa_c3742s3217_a_at* 20.9 5 5 SA0175 PTS system, IIABC components
 sa_c6561s5728_a_at 3.2 2.5 ND SA0254 ribose transport protein
 sa_c9189s8052_a_at 3.1 2.5 ND SA0315 putative N-acetylmannosamine-6-P epimerase
 sa_c7012s6133_a_at 3.8 2.5 ND SA0402 PTS system, IIA component
 sa_c7422s6445_a_at* 7.7 2.5 ND SA0517 alpha-amylase family protein
 sa_c8584s7543_at 3.0 2.5 2.5 SA0931 hydrolase, haloacid dehalogenase
 sa_c1132s914_a_at 2.7 2.5 2.5 SA1207 glyoxalase family protein
 sa_c3212s2761_a_at* 10.3 2.5 ND SA1775 PTS system, IIBC components
 sa_c4153s3505_a_at 2.2 2.5 2.5 SA2028 putative fructokinase
 sa_c4572s3904_a_at 4.3 2.5 ND SA2146 PTS system, mannitol-specific IIBC components
 sa_c5504s9245_a_at* 5.1 2.5 5 SA2376 putative PTS system, sucrose-specific IIBC components
 sa_c6096s5287_a_at* 9.3 2.5 ND SA2546 putative perfringolysin O regulator protein
 sa_c6555s5722_a_at 3.7 2.5 ND SA2663 PTS system, fructose-specific IIABC components
Inorganic ion transport and metabolism
 sa_c5254s4551_a_at 2.4 2.5 2.5 corA SA2342 putative magnesium and cobalt transport protein
 sa_c418s255_a_at 3.8 2.5 2.5 mgtE SA1013 magnesium transporter
 sa_c8659s7606_a_at 2.1 2.5 2.5 mnhA SA0955 Na+/H+ antiporter
 sa_c9129s7998_a_at 2.2 2.5 5 mnhC SA0953 Na+/H+ antiporter
 sa_c9132s8002_a_at 4.6 5 15 mnhE SA0951 Na+/H+ antiporter
 sa_c8649s7599_a_at 3.4 5 5 mnhF SA0950 Na+/H+ antiporter
 sa_c8645s7595_a_at 4.1 2.5 15 mnhG SA0949 Na+/H+ antiporter
 sa_c4995s10003_a_at 10.8 5 ND modA SA2272 molybdenum ABC transporter
 sa_c4991s4295_a_at 7.9 2.5 5 modB SA2271 molybdenum ABC transporter,
 sa_c4989s4292_a_at* 10.2 2.5 ND modC SA2270 molybdenum ABC transporter
 sa_c1230s1008_at 3.5 5 ND sirA SA0099 iron compound ABC transporter
 sa_c1172s953_a_at 2.0 2.5 ND sirB SA0098 iron compound ABC transporter
 sa_c7236s6302_a_at* 11.5 2.5 ND SA0454 sodium:dicarboxylate symporter
 sa_c7333s6374_a_at* 2.4 15 ND SA0491 putative cobalamin synthesis
 sa_c7475s6499_a_at* 6.0 2.5 2.5 SA0531 tetrapyrrole methylase family
 sa_c7871s6863_a_at* 4.1 2.5 2.5 SA0665 putative iron compound ABC transporter
 sa_c7875s6868_a_at 4.2 2.5 ND SA0666 iron compound ABC transporter
 sa_c7989s6976_at 2.2 2.5 2.5 SA0705 iron compound ABC transporter
 sa_c7993s6980_at 2.6 2.5 5 SA0706 iron compound ABC transporter
 sa_c8909s7826_a_at* 2.2 2.5 2.5 SA0722 phosphate transporter family protein
 sa_c8284s7261_a_at 2.2 15 ND SA0799 transferrin receptor
 sa_c700s509_a_at 5.1 2.5 ND SA1084 cobalt transport family protein
 sa_c704s512_a_at 4.3 2.5 2.5 SA1085 ABC transporter
 sa_c815s618cs_s_at 12.0 2.5 2.5 SA1114 Mn2+/Fe2+ transporter,
 sa_c3862s3332_at 4.8 2.5 2.5 SA1976 nitric-oxide synthase
 sa_c4536s3879_a_at 4.4 2.5 15 SA2138 cation efflux family protein
 sa_c4778s4087_a_at 3.0 2.5 2.5 SA2209 cobalt transport family protein
 sa_c5160s4458_a_at* 12.5 2.5 2.5 SA2319 Na+/H+ antiporter family
 sa_c5500s4763_a_at 5.8 2.5 2.5 SA2375 CorA family
 sa_c5522s4780_a_at* 5.1 2.5 2.5 SA2382 proton/sodium-glutamate symporter
 sa_c5534s4791_a_at* 7.6 2.5 ND SA2386 nitrite extrusion protein
 sa_c10691s11141cv_s_at 5.3 2.5 2.5 SA2718 anion transporter family protein
 sa_c422s9317_a_at 4.0 2.5 5 SA1014 putative Na+/H+ antiporter
Lipid transport and metabolism
 sa_c3108s2661_a_at 2.7 2.5 2.5 accA SA1747 acetyl-CoA carboxylase carboxyltransferase α
 sa_c2541s2121_a_at 6.8 2.5 2.5 accB SA1572 acetyl-CoA carboxylase, biotin carboxyl carrier protein
 sa_c2537s2117_a_at 5.5 2.5 2.5 accC SA1571 acetyl-CoA carboxylase biotin carboxylase subunit
 sa_c3110s2665_a_at 4.1 2.5 2.5 accD SA1748 acetyl-CoA carboxylase β
 sa_c1264s1041_at 3.0 15 30 acpP SA1247 acyl carrier protein
 sa_c9605s8367_a_at* 12.1 2.5 2.5 cdsA SA1280 phosphatidate cytidylyltransferase
 sa_c1624s9141_a_at 2.7 2.5 5 cls1 SA1351 cardiolipin synthetase
 sa_c4357s3707_at 2.7 2.5 2.5 cls2 SA2079 cardiolipin synthetase
 sa_c1260s1035_a_at* 12.0 2.5 2.5 fabD SA1244 malonyl CoA-acyl carrier protein transacylase
 sa_c318s157_a_at* 5.5 2.5 2.5 fabF SA0988 3-oxoacyl-(acyl-carrier-protein) synthase II
 sa_c9967s8662_at 6.4 2.5 5 fabG1 SA1245 3-oxoacyl-reductase, acyl-carrier
 sa_c312s155_a_at 20.3 2.5 2.5 fabH SA0987 3-oxoacyl-(acyl-carrier-protein) synthase III
 sa_c7805s6807_a_at 2.2 2.5 2.5 mvk SA0636 mevalonate kinase
 sa_c1256s1031_a_at 7.9 2.5 2.5 plsX SA1243 putative glycerol-3-phosphate acyltransferase
 sa_c7092s6204_a_at 5.8 2.5 2.5 SA0426 acetyl-CoA acetyltransferase
 sa_c8003s6987_a_at 4.5 2.5 ND SA0708 DAK2 domain protein
 sa_c8019s7004_a_at 5.2 2.5 2.5 SA0712 lipase/esterase
 sa_c1242s1022_a_at* 3.6 2.5 2.5 SA1240 DAK2 domain protein
 sa_c3216s2764_a_at 26.0 2.5 ND SA1776 putative 1-acyl-sn-glycerol-3-phosphate acyltransferase
 sa_c3830s3301_a_at 3.8 2.5 2.5 SA1967 geranylgeranylglyceryl phosphate synthase
 sa_c10498s10949_s_at 2.8 2.5 ND SA2278 acyl-CoA dehydrogenase-related
 sa_c9318s8160_a_at 2.4 2.5 2.5 SA2345 putative esterase
 sa_c6159s5341_a_at 4.1 2.5 2.5 SA2560 hydroxymethylglutaryl-CoA reductase
 sa_c6163s5345_a_at 4.1 5 5 SA2561 hydroxymethylglutaryl-CoA synthase
 sa_c6501s5670_a_at 2.6 2.5 2.5 SA2651 putative tributyrin esterase EstA
Nucleotide transport and metabolism
 sa_c4816s4124_at* 3.6 15 15 adk SA2218 adenylate kinase
 sa_c2883s2448_at* 4.1 2.5 2.5 apt SA1690 adenine phosphoribosyltransferase
 sa_c1185s965_a_at 3.9 2.5 2.5 gmk SA1221 guanylate kinase
 sa_c9216s8076_a_at* 4.1 2.5 2.5 guaB SA0460 inosine-5-monophosphate dehydrogenase
 sa_c1697s1432_a_at* 19.0 2.5 5 guaC SA1371 guanosine 5′-monophosphate oxidoreductase
 sa_c7543s6563_at* 6.1 2.5 2.5 hpt SA0554 hypoxanthine phosphoribosyltransferase
 sa_c2771s2343_a_at 4.5 2.5 2.5 mtn SA1655 5-methylthioadenosine/S-adenosylhomocysteine nucleosidase
 sa_c8803s7743_a_at* 11.9 2.5 2.5 nupC SA0566 nucleoside permease
 sa_c9157s8026_a_at* 2.7 2.5 2.5 prsA SA0544 ribose-phosphate pyrophosphokinas
 sa_c65s61_a_at* 34.4 2.5 15 purA SA0018 adenylosuccinate synthetase
 sa_c10589s9063_a_at 2.8 2.5 2.5 purB SA1969 adenylosuccinate lyase
 sa_c9149s8019_a_at 4.9 2.5 2.5 purR SA0539 pur operon repressor
 sa_c1155s937_a_at* 8.2 2.5 ND pyrC SA1213 dihydroorotase
 sa_c6327s5497_a_at* 7.6 2.5 2.5 pyrD SA2606 dihydroorotate dehydrogenase 2
 sa_c1167s950_a_at* 5.4 5 15 pyrF SA1216 orotidine 5-phosphate decarboxylase
 sa_c4482s3827_a_at 8.1 2.5 2.5 pyrG SA2119 CTP synthase
 sa_c9613s8375_a_at 2.8 2.5 2.5 pyrH SA1277 uridylate kinase
 sa_c1147s928_a_at* 13.2 2.5 2.5 pyrR SA1210 pyrimidine regulatory protein
 sa_c9829s8568_a_at* 3.9 2.5 2.5 tdk SA2111 thymidine kinase
 sa_c7447s6470_a_at 2.9 2.5 2.5 tmk SA0524 thymidylate kinase
 sa_c9569s8332_a_at* 3.5 2.5 2.5 udk SA1666 uridine kinase
 sa_c4446s3792_a_at* 2.1 2.5 15 upp SA2104 uracil phosphoribosyltransferase
 sa_c1151s932_a_at* 7.0 2.5 ND uraA SA1211 uracil permease
 sa_c5453s4720_a_at 2.7 2.5 2.5 SA0225 inosine-uridine preferring nucleoside hydrolase
 sa_c8842s7778_a_at 5.4 2.5 2.5 SA0603 deoxynucleoside kinase family
 sa_c7681s6690_a_at* 17.1 2.5 ND SA0604 deoxynucleoside kinase family
 sa_c7687s9277_a_at 3.1 2.5 2.5 SACOL0605 cytidine/deoxycytidylate deaminase
 sa_c9732s8478_a_at 6.1 2.5 ND SA1509 nucleoside diphosphate kinase
 sa_c2243s1939_a_at 4.6 2.5 5 SA1520 pyridine nucleotide-disulfide oxidoreductase
 sa_c3024s2581_a_at 3.0 2.5 2.5 SA1724 MutT/nudix family protein
 sa_c3186s2733_a_at 3.6 2.5 5 SA1768 GAF domain-containing protein
 sa_c3455s2983_a_at 3.1 2.5 2.5 SA1841 MutT/nudix family protein
 sa_c3597s3080_at 2.6 2.5 15 SA1894 HIT family protein
 sa_c4896s4204_a_at* 7.1 2.5 2.5 SA2242 xanthine/uracil permease
 sa_c5009s4311_a_at 2.0 2.5 ND SA2276 inosine-uridine preferring nucleoside hydrolase
Energy production and conversion
 sa_c3153s2701_a_at 2.0 2.5 2.5 ackA SA1760 acetate kinase
 sa_c4418s3765_a_at* 2.7 15 15 atpA SA2097 F0F1 ATP synthase α
 sa_c4434s3779_a_at* 3.5 15 15 atpB SA2101 F0F1 ATP synthase subunit A
 sa_c9843s8585_at* 2.9 15 15 atpC SA2094 F0F1 ATP synthase ε
 sa_c9839s8581_a_at* 2.4 15 15 atpD SA2095 F0F1 ATP synthase β
 sa_c4430s3777_at* 2.2 15 15 atpE SA2100 F0F1 ATP synthase subunit C
 sa_c4426s3773_a_at* 2.5 15 15 atpF SA2099 F0F1 ATP synthase subunit B
 sa_c4414s3760_at* 2.2 15 15 atpG SA2096 F0F1 ATP synthase γ
 sa_c4422s3769_a_at* 2.3 15 15 atpH SA2098 F0F1 ATP synthase δ
 sa_c6417s5584_a_at* 2.9 2.5 15 betB SA2628 betaine aldehyde dehydrogenase
 sa_c5252s4546_a_at 2.1 2.5 2.5 fni SA2341 isopentenyl diphosphate isomerase
 sa_c6467s5637_a_at 3.3 5 ND gpxA2 SA2641 glutathione peroxidase
 sa_c2505s2085_a_at 3.0 2.5 2.5 lpdA SA1563 dihydrolipoamide dehydrogenase
 sa_c9418s8233_a_at 2.6 5 5 mqo SA2623 malate:quinone oxidoreductase
 sa_c5574s4827_a_at* 11.9 2.5 ND narG SA2395 respiratory nitrate reductase α
 sa_c5570s4822_a_at* 2.7 2.5 ND narH SA2394 respiratory nitrate reductase β
 sa_c5564s4818_a_at* 2.8 5 ND narJ SA2393 respiratory nitrate reductase δ
 sa_c3448s2976_a_at 2.9 15 ND pckA SA1838 phosphoenolpyruvate carboxykinase (ATP)
 sa_c771s572_a_at 2.4 15 15 pdHA SA1102 pyruvate dehydrogenase complex α
 sa_c775s576_a_at 2.1 15 15 pdhB SA1103 pyruvate dehydrogenase complex β
 sa_c783s584_a_at 2.5 15 15 pdhD SA1105 dihydrolipoamide dehydrogenase
 sa_c623s446_a_at* 9.9 30 5 qoxA SA1069 quinol oxidase, subunit I
 sa_c9054s7945_a_at* 8.1 30 2.5 qoxB SA1070 quinol oxidase, subunit II
 sa_c619s442_at* 9.0 15 15 qoxC SA1068 quinol oxidase, subunit III
 sa_c615s436_at 12.3 15 15 qoxD SA1067 quinol oxidase, subunit IV
 sa_c969s761_a_at 3.3 2.5 2.5 sdhA SA1159 succinate dehydrogenase flavoprotein subunit
 sa_c10643s11097_s_at 3.2 2.5 5 sdhB SA1160 succinate dehydrogenase iron-sulfur
 sa_c965s755_at 4.5 2.5 5 sdhC SA1158 succinate dehydrogenase, cytochrome b558 subunit
 sa_c1326s1101_a_at 2.1 2.5 5 sucD SA1263 succinyl-CoA synthase subunit α
 sa_c4387s3735_a_at 2.5 2.5 ND SA0197 Gfo/Idh/MocA family oxidoreductase
 sa_c6021s5217_a_at 2.1 2.5 2.5 SA0241 alcohol dehydrogenase
 sa_c6985s6107_a_at* 4.7 2.5 ND SA0392 NADH-dependent flavin oxidoreductase, Oye family
 sa_c8588s7547_a_at 2.2 2.5 5 SA0932 D-isomer specific 2-hydroxyacid dehydrogenase family protein
 sa_c8625s7576_a_at 3.7 5 15 SA0944 putative NADH dehydrogenase
 sa_c871s671_a_at 2.9 2.5 5 SA1130 putative glycerophosphoryl diester phosphodiesterase
 sa_c2220s1920_a_at* 5.5 2.5 2.5 SA1514 glycerol-3-phosphate dehydrogenase, NAD-dependent
 sa_c2448s2032_a_at 2.5 2.5 2.5 SA1545 short chain dehydrogenase/reductase family oxidoreductase
 sa_c2493s2074_a_at 6.6 5 5 SA1560 2-oxoisovalerate dehydrogenase
 sa_c2497s2076_a_at 8.5 5 2.5 SA1561 2-oxoisovalerate dehydrogenase
 sa_c2501s2080_a_at 3.9 2.5 5 SA1562 2-oxoisovalerate dehydrogenase
 sa_c3114s2669_a_at 4.5 2.5 2.5 SA1749 putative NADP-dependent malic
 sa_c9227s8083_a_at 4.5 2.5 2.5 SA1914 putative iron-sulfur cluster-binding
 sa_c5088s4384_a_at 2.1 5 15 SA2296 glycerate dehydrogenase
 sa_c5092s4387_a_at 2.7 2.5 2.5 SA2297 hypothetical protein
 sa_c5464s4730_a_at 4.2 2.5 2.5 SA2367 alcohol dehydrogenase
 sa_c9395s8219_a_at 3.5 2.5 2.5 SA2569 1-pyrroline-5-carboxylate dehydrogenase
Transport
 sa_c5292s9302_a_at 4.3 2.5 2.5 tcaB SA2350 TcaB protein
 sa_c3118s2672_a_at* 11.0 2.5 ND SA0159 ABC transporter
 sa_c4055s3432_a_at 3.3 2.5 ND SA0187 RGD-containing lipoprotein
 sa_c5387s4658_a_at* 4.1 2.5 5 SA0422 ABC transporter
 sa_c1908s1632_a_at* 10.0 2.5 2.5 SA1427 ABC transporter
 sa_c2626s2200_a_at* 5.1 2.5 2.5 SA1612 ABC transporter
 sa_c3355s2890_a_at 12.0 2.5 ND SA1809 putative drug transporter
 sa_c5379s4651_a_at 4.7 2.5 5 SA1994 ABC transporter
 sa_c3936s3405_a_at 4.0 2.5 5 SA1996 ABC transporter
 sa_c4181s3535_a_at 2.4 2.5 2.5 SA2036 ABC transporter
 sa_c4661s3981_a_at 2.4 2.5 ND SA2170 putative ransporter
 sa_c4937s4242_a_at 6.7 2.5 ND SA2257 putative drug transporter
 sa_c5801s5043_a_at* 5.8 2.5 2.5 SA2460 putative drug transporter
 sa_c6017s5213_a_at* 4.8 2.5 2.5 SA2521 putative transporter
 sa_c5345s4618_a_at* 2.3 2.5 5 SA2525 ABC transporter
 sa_c6186s5364_a_at* 3.2 2.5 ND SA2566 putative MmpL efflux pump
 sa_c6475s5646_a_at 3.3 2.5 ND SA2643 ABC transporter
 sa_c5369s4644_a_at 2.6 2.5 ND SA2644 ABC transporter
 sa_c3043s2596_a_at* 3.3 2.5 ND SACOL0158 ABC transporter
Coenzyme transport and metabolism
 sa_c7555s6575_a_at 4.4 2.5 2.5 folB SA0559 dihydroneopterin aldolase
 sa_c2964s2521_a_at 9.4 2.5 2.5 folC SA1709 folylpolyglutamate synthase/dihydrofolate synthase
 sa_c7561s6578_a_at 6.7 2.5 2.5 folK SA0560 hydroxymethyldihydropteridine pyrophosphokinase
 sa_c9351s8180_a_at 2.4 2.5 2.5 hemB SA1715 delta-aminolevulinic acid dehydratase
 sa_c2992s2549_a_at 4.2 2.5 2.5 hemC SA1717 porphobilinogen deaminase
 sa_c2990s2545_a_at 3.1 2.5 2.5 hemD SA1716 uroporphyrinogen-III synthase
 sa_c3585s3067_a_at 2.8 2.5 2.5 hemE SA1889 uroporphyrinogen decarboxylase
 sa_c3577s3059_a_at 4.1 2.5 2.5 hemG SA1887 protoporphyrinogen oxidase
 sa_c3584s3063_a_at 2.8 2.5 2.5 hemH SA1888 ferrochelatase
 sa_c2984s2541_a_at 2.7 2.5 5 hemL SA1714 glutamate-1-semialdehyde-2,1-aminomutase
 sa_c2517s2095_a_at 5.9 2.5 2.5 ispA SA1566 geranyltranstransferase
 sa_c8772s7713_a_at 9.7 2.5 ND kdtB SA1134 lipopolysaccharide core biosynthesis protein
 sa_c546s374_a_at 4.7 2.5 ND menA SA1049 1,4-dihydroxy-2-naphthoate octaprenyltransferase
 sa_i2997d_x_at 2.0 2.5 2.5 menC SA1843 putative o-succinylbenzoic acid (OSB) synthetase
 sa_c552s378_a_at 2.5 2.5 2.5 menD SA1052 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylic acid synthase/2-oxoglutarate decarboxylase
 sa_c4947s4252_a_at 3.1 2.5 2.5 moaA SA2261 molybdenum cofactor biosynthesis
 sa_c4977s4280_a_at 2.7 2.5 ND moaB SA2268 molybdenum cofactor biosynthesis
 sa_c4955s4259_a_at 3.2 2.5 2.5 moaD SA2263 molybdopterin converting factor
 sa_c4959s4263_a_at 2.8 2.5 5 moaE SA2264 molybdenum cofactor biosynthesis
 sa_c4951s4255_a_at 2.9 2.5 2.5 mobA SA2262 molybdopterin-guanine dinucleotide biosynthesis
 sa_c4965s4269_a_at 2.4 2.5 5 mobB SA2265 molybdopterin-guanine dinucleotide biosynthesis
 sa_c4967s4271_a_at 3.1 2.5 2.5 moeA SA2266 putative molybdopterin biosynthesis
 sa_c2753s2324_a_at* 5.1 2.5 5 nadD SA1650 nicotinate (nicotinamide) nucleotide adenylyltransferase
 sa_c6363s5534_a_at 2.7 2.5 2.5 panB SA2615 3-methyl-2-oxobutanoate hydroxymethyltransferase
 sa_c6367s5538_a_at 4.6 2.5 5 panE SA2616 2-dehydropantoate 2-reductase
 sa_c3387s2918_a_at 6.6 2.5 2.5 ribBA SA1818 riboflavin biosynthesis protein
 sa_c3391s2919_a_at 7.1 2.5 ND ribE SA1819 riboflavin synthase, alpha subunit
 sa_c1406s1179_a_at 2.7 2.5 2.5 ribF SA1291 riboflavin biosynthesis protein
 sa_c3173s2721_a_at* 19.7 2.5 2.5 thiI SA1764 thiamine biosynthesis protein
 sa_c7000s6122_a_at 3.5 2.5 5 SA0398 lipoate-protein ligase A family
 sa_c8206s7186_a_at 6.7 2.5 2.5 SA0771 putative 6-pyruvoyl tetrahydrobiopterin synthase
 sa_c8256s7233_at* 12.2 2.5 ND SA0789 7-cyano-7-deazaguanine reductase
 sa_c2206s1907_a_at 4.8 2.5 2.5 SA1510 polyprenyl synthetase
 sa_c2210s1911_a_at 5.8 2.5 2.5 SA1511 ubiquinone/menaquinone biosynthesis methyltransferase
 sa_c2711s2285_a_at* 6.8 2.5 2.5 SA1640 coproporphyrinogen III oxidase
 sa_c9805s8544_a_at 8.4 2.5 5 SA2122 pantothenate kinase
Transcription
 sa_c2166s1867_a_at 2.9 2.5 2.5 birA SA1496 birA bifunctional protein
 sa_c9676s8432_a_at 2.3 2.5 2.5 glk SA1604 glucokinase
 sa_c1490s1267_a_at 3.6 2.5 5 glpP SA1317 glycerol uptake operon antiterminator regulatory protein
 sa_c6194s5372_a_at* 3.5 2.5 2.5 lytR SA0246 response regulator
 sa_c8922s7839_a_at 5.0 2.5 2.5 norR SA0746 transcriptional regulator, MarR family
 sa_c1384s1156_a_at* 5.5 2.5 2.5 nusA SA1285 transcription elongation factor
 sa_c2529s2110_a_at 4.4 2.5 2.5 nusB SA1569 transcription antitermination protein
 sa_c7613s6627_at 2.7 2.5 2.5 nusG SA0582 transcription antitermination protein
 sa_c9825s8564_a_at 3.6 2.5 2.5 rho SA2113 transcription termination factor
 sa_c1268s1046_a_at 8.5 2.5 ND rnc SA1248 ribonuclease III
 sa_c7637s6652_a_at* 2.5 15 15 ropC SA0589 RNA polymerase β
 sa_c4796s4102_at* 4.9 15 15 rpoA SA2213 RNA polymerase α
 sa_c7633s6648_a_at* 3.2 5 2.5 rpoB SA0588 RNA polymerase β
 sa_c2650s2225_a_at* 2.4 2.5 2.5 rpoD SA1618 RNA polymerase sigma factor
 sa_c9811s8552_a_at 3.6 2.5 2.5 rpoE SA2120 RNA polymerase δ
 sa_c1187s970_at 2.0 2.5 2.5 rpoZ SA1222 RNA polymerase ο
 sa_c9851s9296_a_at 2.7 2.5 2.5 rsbu SA2057 sigma factor B regulator protein
 sa_c1108s889_at 2.7 2.5 2.5 sarS SA0096 staphylococcal accessory regulator
 sa_c5056s4355_a_at* 7.7 2.5 ND sarY SA2289 staphylococcal accessory regulator
 sa_c1214s994_a_at* 7.5 2.5 2.5 sun SA1229 Sun protein
 sa_c10502s10951cv_s_at 3.6 2.5 2.5 tcaR SA2353 transcriptional regulator
 sa_c3928s3395_a_at 2.2 2.5 ND SA0179 phosphosugar-binding transcriptional regulator
 sa_c7020s6143_a_at 2.9 2.5 ND SA0404 transcriptional regulator
 sa_c7120s6232_a_at 3.4 2.5 ND SA0432 spoOJ protein
 sa_c7424s6449_a_at 4.1 2.5 2.5 SA0518 GntR family transcriptional regulator
 sa_c8164s7148_a_at 18.0 2.5 2.5 SA0757 DeoR family transcriptional regulator
 sa_c8938s7854_at 12.2 2.5 ND SA0772 exsB protein
 sa_c791s594_at* 17.0 2.5 ND SA1107 Cro/CI family transcriptional regulator
 sa_c1250s1027_at 10.6 2.5 2.5 SA1242 fatty acid biosynthesis transcriptional regulator
 sa_c9601s8362_a_at 2.2 2.5 2.5 SA1296 GntR family transcriptional regulator
 sa_c9781s8524_a_at 6.1 2.5 2.5 SA1398 putative transcriptional regulator
 sa_c3623s3103_a_at* 23.6 2.5 2.5 SA1904 putative transcriptional regulator
 sa_c10590s9067_a_at 3.6 2.5 5 SA1997 GntR family transcriptional regulator
 sa_c4177s3531_a_at 2.2 2.5 2.5 SA2035 redox-sensing transcriptional repressor
 sa_c4577s3908_a_at 2.9 2.5 2.5 SA2147 BglG family transcriptional antiterminator
 sa_c4931s4238_a_at 3.3 2.5 ND SA2256 MarR family transcriptional regulator
 sa_c446s279_a_at* 7.2 2.5 ND SA2290 AraC family transcriptional regulator
 sa_c5122s4419_at 4.0 2.5 2.5 SA2308 phosphosugar-binding transcriptional regulator, RpiR family
 sa_c5187s4486_a_at 3.4 2.5 ND SA2325 LysR family ranscriptional regulator
 sa_c5496s4759_a_at 5.7 2.5 2.5 SA2374 TetR family transcriptional regulator
 sa_c5510s4767_a_at 3.1 2.5 2.5 SA2378 AraC family transcriptional regulator
 sa_c441s275_a_at** 3.3 5 ND SA2593 TetR family transcriptional regulator,
 sa_c6509s5677_a_at* 7.6 2.5 ND SA2653 Crp/FNR family transcriptional regulator
 sa_c1956s1681_a_at 9.1 2.5 ND SA2731 CSD family cold shock protein
Translation
 sa_c2837s2403_a_at 7.7 2.5 2.5 alaS SA1673 alanyl-tRNA synthetase
 sa_c7865s6854_a_at* 3.5 2.5 2.5 argS SA0663 arginyl-tRNA synthetase
 sa_c2160s1859_a_at 2.6 2.5 2.5 asnS SA1494 asparaginyl-tRNA synthetase
 sa_c1948s1673cv_x_at 2.7 2.5 5 cspA N315-SA1234 major cold shock protein
 sa_c10576s9058_a_at 3.0 2.5 2.5 def SA1100 peptide deformylase
 sa_c1203s985_a_at* 6.0 2.5 2.5 def2 SA1227 polypeptide deformylase
 sa_c1207s989_a_at* 5.7 2.5 2.5 fmt SA1228 methionyl-tRNA formyltransferase
 sa_c1362s1136_a_at* 2.8 2.5 5 frr SA1278 ribosome recycling factor
 sa_c8835s7770_a_at* 2.9 15 15 fusA SA0593 elongation factor G
 sa_c3802s3271_a_at 3.5 5 5 gatB SA1960 aspartyl/glutamyl-tRNA amidotransferase subunit B
 sa_c9878s8614_a_at 5.5 5 5 gatC SA1962 aspartyl/glutamyl-tRNA amidotransferase subunit C
 sa_c7583s6603_a_at 6.9 2.5 2.5 gltX SA0574 glutamyl-tRNA synthetase
 sa_c1128s910_a_at 11.2 2.5 2.5 ileS SA1206 isoleucyl-tRNA synthetase
 sa_c4812s4120_at* 3.7 15 15 infA SA2217 translation initiation factor IF-1
 sa_c1394s1169_a_at* 5.3 2.5 5 infB SA1288 translation initiation factor IF-2
 sa_c2715s2289_a_at 4.9 2.5 2.5 lepA SA1641 GTP-binding protein
 sa_c3349s2883_a_at 8.9 2.5 2.5 leuS SA1808 leucyl-tRNA synthetase
 sa_c7567s6587_a_at 4.5 2.5 2.5 lysS SA0562 lysyl-tRNA synthetase
 sa_c7479s6503_a_at 2.9 2.5 2.5 metS SA0533 methionyl-tRNA synthetase
 sa_c1466s1245_a_at 4.6 2.5 2.5 miaB SA1312 tRNA-i(6)A37 modification enzyme
 sa_c8764s7707_a_at 4.1 2.5 2.5 pheS SA1148 phenylalanyl-tRNA synthetase α
 sa_c933s729_a_at 4.1 2.5 2.5 pheT SA1149 phenylalanyl-tRNA synthetase β
 sa_c1410s1184_a_at* 4.5 2.5 2.5 pnp SA1293 polynucleotide phosphorylase
 sa_c4462s3807_at* 6.2 2.5 2.5 prfA SA2110 peptide chain release factor 1
 sa_c8340s7313_at 3.4 2.5 2.5 prfB SA0818 peptide chain release factor 2
 sa_c10084s8804_a_at 5.4 5 5 queA SA1695 S-adenosylmethionine:tRNA ribosyltransferase-isomerase
 sa_c1398s1173_at 3.4 2.5 2.5 rbfA SA1289 ribosome-binding factor A
 sa_c1316s1090_a_at* 3.8 2.5 2.5 rbgA SA1260 ribosomal biogenesis GTPase
 sa_c1294s1067_a_at* 11.1 2.5 5 rimM SA1255 16S rRNA processing protein
 sa_c2422s2004_a_at 3.8 2.5 2.5 rluB SA1536 ribosomal large subunit pseudouridine synthase B
 sa_c7620s6631_a_at* 6.5 15 15 rplA SA0584 50S ribosomal protein L1
 sa_c9959s8654_a_at* 5.8 15 15 rplB SA2236 50S ribosomal protein L2
 sa_c4888s4195_a_at* 4.8 5 5 rplC SA2239 50S ribosomal protein L3
 sa_c4848s4156_at* 4.9 15 15 rplE SA2227 50S ribosomal protein L5
 sa_c9951s8647_at* 5.3 15 15 rplF SA2224 50S ribosomal protein L6
 sa_c7621s6634_a_at* 4.6 5 5 rplJ SA0585 50S ribosomal protein L10
 sa_c8818s7755_a_at* 2.9 15 15 rplK SA0583 50S ribosomal protein L11
 sa_c7625s6638_at* 10.8 2.5 15 rplL SA0586 50S ribosomal protein L7/L12
 sa_c9943s8640_a_at* 3.5 2.5 2.5 rplM SA2207 50S ribosomal protein L13
 sa_c9955s8651_a_at* 5.0 15 15 rplN SA2229 50S ribosomal protein L14
 sa_c4824s4130_a_at* 3.9 15 15 rplO SA2220 50S ribosomal protein L15
 sa_c4864s4170_at* 4.4 15 15 rplP SA2232 50S ribosomal protein L16
 sa_c4792s4098_at* 5.5 15 15 rplQ SA2212 50S ribosomal protein L17
 sa_c4836s4142_at* 4.2 15 15 rplR SA2223 50S ribosomal protein L18
 sa_c1302s1077_a_at* 7.2 15 15 rplS SA1257 50S ribosomal protein L19
 sa_c3028s2585_at* 19.5 2.5 2.5 rplT SA1725 50S ribosomal protein L20
 sa_c2926s2487_at* 4.4 5 15 rplU SA1702 50S ribosomal protein L21
 sa_c4872s4181_at* 3.7 15 15 rplV SA2234 50S ribosomal protein L22
 sa_c4852s4158_at* 4.1 15 15 rplX SA2228 50S ribosomal protein L24
 sa_c7511s6531_a_at* 5.9 15 5 rplY SA0545 50S ribosomal Protein L25
 sa_c2922s2484_a_at* 3.8 5 15 rpmA SA1700 50S ribosomal protein L27
 sa_c4860s4166_at* 5.1 15 15 rpmC SA2231 50Sribosomal protein L29
 sa_c4828s4134_at* 3.7 15 15 rpmD SA2221 50Sribosomal protein L30
 sa_c4466s3812_a_at 2.5 5 15 rpmE SA2112 50S ribosomal protein L31
 sa_c891s9388_a_at* 4.2 2.5 5 rpmF SA1137 50S ribosomal protein L32
 sa_c10253s8932_a_at 2.7 2.5 2.5 rpmH SA2740 50S ribosomal protein L34
 sa_c3032s2589_at* 16.1 2.5 5 rpmI SA1726 50S ribosomal protein L35
 sa_c4808s4116_at 2.3 15 15 rpmJ SA2216 50S ribosomal protein L36
 sa_c10332s10718_s_at 4.1 2.5 2.5 rpsB SA1274 30S ribosomal protein S2
 sa_c4868s4175_a_at* 5.1 15 15 rpsC SA2233 30S ribosomal protein S3
 sa_c4832s4138_at* 4.2 15 15 rpsE SA2222 30S ribosomal protein S5
 sa_c7136s6248_at* 6.7 15 5 rpsF SA0437 30S ribosomal protein S6
 sa_c8830s7766_a_at* 4.5 15 15 rpsG SA0592 30S ribosomal protein S7
 sa_c4840s4147_a_at* 5.9 15 15 rpsH SA2225 30S ribosomal protein S8
 sa_c4770s4080_a_at* 6.5 2.5 2.5 rpsI SA2206 30S ribosomal protein S9
 sa_c9963s8658_a_at* 4.7 5 15 rpsJ SA2240 30S ribosomal protein S10
 sa_c4800s4106_at* 5.5 15 15 rpsK SA2214 30S ribosomal protein S11
 sa_c7645s6658_a_at* 3.6 15 15 rpsL SA0591 30S ribosomal protein S12
 sa_c4804s4110_at* 3.6 15 15 rpsM SA2215 30S ribosomal protein S13
 sa_c4844s4152_at* 6.3 15 15 rpsN SA2226 30S ribosomal protein S14
 sa_c10032s8739_a_at 4.6 5 2.5 rpsO SA1292 30S ribosomal protein S15
 sa_c1290s1065_at* 5.5 2.5 5 rpsP SA1254 30S ribosomal protein S16
 sa_c10191s8871_a_at 3.9 15 15 rpsQ SA2230 30S ribosomal protein S17
 sa_c7144s6255_a_at* 11.5 5 15 rpsR SA0439 30S ribosomal protein S18
 sa_c4876s4184_at* 5.9 5 15 rpsS SA2235 30S ribosomal protein S19
 sa_c2719s2293_at* 2.1 15 15 rpsT SA1642 30S ribosomal protein S20
 sa_c35s30_a_at 13.8 2.5 5 serS SA0009 seryl-tRNA synthetase
 sa_c9438s8253_a_at* 4.7 5 5 tgt SA1694 queuine tRNA-ribosyltransferase
 sa_c8734s7676_a_at 11.2 2.5 5 thrS SA1729 threonyl-tRNA synthetase
 sa_c1300s1073_a_at* 10.9 2.5 5 trmD SA1256 tRNA (guanine-N1)-methyltransferase
 sa_c6837s5972_a_at* 3.8 2.5 2.5 trmE SA2738 tRNA modification GTPase TrmE
 sa_c376s218_a_at 4.4 2.5 5 trpS SA1001 tryptophanyl-tRNA synthetase
 sa_c4774s4084_a_at 4.6 2.5 5 truA SA2208 tRNA pseudouridine synthase A
 sa_c1404s1177_a_at 2.9 2.5 2.5 truB SA1290 tRNA pseudouridine 55 synthase
 sa_c8838s7774_a_at* 2.1 30 15 tuf SA0594 translation elongation factor Tu
 sa_c9619s8379_a_at 2.2 2.5 5 tsf SA1276 translation elongation factor Ts
 sa_c8748s7692_a_at* 10.9 2.5 2.5 tyrS SA1778 tyrosyl-tRNA synthetase
 sa_c2972s2529_a_at 11.7 2.5 2.5 valS SA1710 valyl-tRNA synthetase
 sa_c7499s6519_a_at 3.2 2.5 2.5 SA0540 putative endoribonuclease L-PSP
 sa_c7535s6554_a_at 2.2 2.5 2.5 SA0552 hypothetical protein
 sa_c7597s6610_a_at 2.5 2.5 5 SA0578 RNA methyltransferase,
 sa_c7641s6656_a_at* 3.9 15 15 SA0590 30S ribosomal protein L7 Ae-like
 sa_c8103s7087_a_at 2.7 2.5 2.5 SA0739 acetyltransferase, family
 sa_c414s251_a_at 3.6 2.5 2.5 SA1012 ribosomal large subunit pseudouridine synthase D
 sa_c9033s7929_a_at 3.0 2.5 2.5 SA1098 metallo-beta-lactamase family protein
 sa_c929s726_at 3.2 2.5 2.5 SA1147 RNA methyltransferase,
 sa_c1143s924_a_at* 10.3 2.5 2.5 SA1209 ribosomal large subunit pseudouridine synthase D
 sa_c1390s1164_a_at* 6.1 2.5 2.5 SA1287 30S ribosomal protein L7 AE
 sa_c2454s2037_a_at 4.5 2.5 2.5 SA1548 AtsA/ElaC family protein
 sa_c3306s2847_a_at 3.6 2.5 2.5 SA1798 tRNA (guanine-N(7)-)-methyltransferase
 sa_c3631s3112_a_at 3.9 2.5 2.5 SA1907 ribosomal large subunit pseudouridine synthase D
 sa_c3647s3130_a_at* 5.5 2.5 2.5 SA1913 RNA methyltransferase,
 sa_c3790s3262_a_at 4.2 2.5 5 SA1957 RNA methyltransferase,
Posttranslational modification, protein turnover, chaperone
 sa_c3012s2568_a_at 3.1 2.5 2.5 clpX SA1721 ATP-dependent protease
 sa_c855s656_a_at* 5.9 2.5 2.5 ctaA SA1124 cytochrome oxidase assembly
 sa_c2996s2553_a_at 6.6 2.5 2.5 hemX SA1718 hemX protein
 sa_c3016s2573_a_at 2.4 5 5 tig SA1722 trigger factor
 sa_c9167s8035_a_at 4.6 2.5 2.5 SA0556 chaperonin, 33 kDa
 sa_c8202s7182_a_at 4.0 2.5 2.5 SA0770 radical activating enzyme family
Replication, recombination and repair
 sa_c2162s1863_a_at 3.0 2.5 2.5 dinG SA1495 DNA polymerase III ε
 sa_c2656s2229_a_at 3.2 2.5 2.5 dnaG SA1619 DNA primase
 sa_c8736s7680_a_at 3.4 2.5 2.5 dnaI SA1731 primosomal protein
 sa_c7435s6457_a_at 2.6 2.5 2.5 dnaX SA0520 DNA polymerase III γτ
 sa_c1478s1255_a_at 3.1 2.5 2.5 hexA SA1315 DNA mismatch repair protein
 sa_c1488s1263_a_at 4.5 2.5 2.5 hexB SA1316 DNA mismatch repair protein
 sa_c7309s6364_a_at 3.3 2.5 2.5 hsdM2 SA1862 type I restriction-modification
 sa_c10158s10584_at 2.5 2.5 2.5 int N315-SA1835 hypothetical protein
 sa_c3824s3292_a_at 3.3 2.5 5 ligA SA1965 DNA ligase, NAD-dependent
 sa_c2914s2476_a_at* 3.8 2.5 2.5 obgE SA1699 GTPase
 sa_c1768s1502_a_at 2.3 2.5 2.5 parE SA1389 DNA topoisomerase IV subunit B
 sa_c3826s3296_a_at 2.4 2.5 2.5 pcrA SA1966 ATP-dependent DNA helicase
 sa_c1376s1149_a_at 2.6 2.5 2.5 polC SA1283 DNA polymerase III
 sa_c7575s6595_a_at 2.9 2.5 2.5 radA SA0572 DNA repair protein
 sa_c2887s2452_a_at* 2.9 2.5 2.5 recJ SA1691 single-stranded-DNA-specific exonuclease
 sa_c2509s2087_a_at 2.6 2.5 2.5 recN SA1564 DNA repair protein
 sa_c7441s6461_a_at 2.3 2.5 5 recR SA0522 recombination protein
 sa_c2134s1838_at 4.6 2.5 2.5 recU SA1489 Holliday junction-specific endonuclease
 sa_c8711s7654_a_at 2.9 2.5 2.5 rexA SA0971 exonuclease
 sa_c1320s1091_a_at* 4.5 2.5 ND rnhB SA1261 ribonuclease HII
 sa_c2908s2469_a_at* 5.0 2.5 2.5 ruvA SA1697 Holliday junction DNA helicase
 sa_c9430s8244_a_at* 4.1 2.5 2.5 ruvB SA1696 Holliday junction DNA helicase
 sa_c2429s2013_at 2.4 2.5 2.5 scpA SA1538 segregation and condensation protein A
 sa_c2426s2008_a_at 2.5 2.5 2.5 scpB SA1537 segregation and condensation protein B
 sa_c7140s6251_at* 4.5 15 15 ssb SA0438 single-stranded DNA-binding protein
 sa_c7768s6771_a_at 6.1 2.5 2.5 ung SA0627 uracil-DNA glycosylase
 sa_c2525s2106_a_at 8.2 2.5 2.5 xseA SA1568 exodeoxyribonuclease VII, large subunit
 sa_c2521s2102_a_at* 8.7 2.5 2.5 xseB SA1567 exodeoxyribonuclease VII, small subunit
 sa_c7458s6479_a_at 5.0 2.5 2.5 SA0526 putative DNA polymerase III δ′
 sa_c9145s8014_a_at 3.0 2.5 2.5 SA0534 deoxyribonuclease, TatD family
 sa_c7541s6559_a_at* 6.9 2.5 2.5 SA0553 hypothetical protein
 sa_c953s746_a_at 3.0 2.5 2.5 SA1153 hypothetical protein
 sa_c959s748_a_at 2.3 2.5 2.5 SA1154 recombination and DNA strand exchange inhibitor protein
 sa_c1344s1117_a_at* 6.2 2.5 ND SA1266 putative DNA processing protein DprA
 sa_c1522s1300_a_at 3.7 2.5 2.5 SA1326 putative GTP-binding protein
 sa_c1643s1381_at* 6.3 2.5 ND SA1357 thermonuclease
 sa_c2640s2213_a_at 11.4 2.5 2.5 SA1615 ATP dependent DNA helicase
 sa_c2726s2297_a_at 3.6 2.5 2.5 SA1643 DNA polymerase III δ
 sa_c2861s2424_a_at 4.0 2.5 2.5 SA1682 recombination factor protein RarA
 sa_c2977s2534_a_at 2.3 2.5 2.5 SA1711 DNA-3-methyladenine glycosylase
 sa_c3053s2604_a_at* 4.0 2.5 2.5 SA1732 replication initiation and membrane attachment protein
 sa_c3611s3091_at 2.5 2.5 2.5 SA1900 DNA repair exonuclease
 sa_c4309s3661_a_at 7.6 2.5 2.5 SA2072 ATP dependent DNA helicase
 sa_c5962s10062cv_s_at 2.4 2.5 2.5 SA2499 putative helicase
 sa_c1542s9612_at 3.1 2.5 ND SACOL1573 integrase/recombinase
Signal transduction
 sa_c6155s5336_a_at* 2.2 2.5 2.5 lytS SA0245 sensor histidine kinase
 sa_c831s632_a_at* 12.7 2.5 2.5 typA SA1118 GTP-binding protein
 sa_c69s68_a_at 2.0 2.5 2.5 yycG SA0020 sensory box histidine kinase
 sa_c4488s3831_a_at 2.8 2.5 2.5 SA0201 DNA-binding response regulator
 sa_c4513s3855_a_at 2.5 2.5 2.5 SA0202 sensor histidine
 sa_c8316s7293_a_at* 8.4 2.5 2.5 SA0809 GGDEF domain-containing protein
 sa_c9202s8059_a_at 2.3 2.5 2.5 SA1906 putative sensor histidine kinase
 sa_c5315s4596_a_at 2.5 2.5 ND SA2358 DNA-binding response regulator
 sa_c6481s5649_a_at 2.1 2.5 2.5 SA2645 putative sensor histidine kinase
 sa_c6483s5653_a_at 3.8 2.5 5 SA2646 DNA-binding response regulator
Cell wall and membrane biogenesis
 sa_c4317s3671_at 2.1 2.5 2.5 ddl SA2074 D-alanylalanine synthetase
 sa_c1100s881_a_at 4.7 2.5 5 divlB SA1197 cell division protein
 sa_c8601s7554_a_at 5.4 2.5 2.5 dltA SA0935 D-alanine--D-alanyl protein ligase
 sa_c6835s5969_a_at* 3.5 2.5 2.5 gidB SA2736 glucose-inhibited division protein B
 sa_c1848s1571_a_at 3.4 2.5 2.5 femA SA1410 femA protein
 sa_c5976s5182_a_at* 4.6 2.5 2.5 galU SA2508 UTP-glucose-1-phosphate uridylyltransferase
 sa_c2934s2498_a_at 2.5 2.5 2.5 mreC SA1704 rod shape-determining protein
 sa_c10310s8999_a_at* 5.8 2.5 ND murAA SA2092 UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1
 sa_c8293s7271_a_at 4.1 2.5 2.5 murB SA0801 UDP-N-acetylenolpyruvoylglucosamine reductase
 sa_c459s9094_a_at 3.6 2.5 2.5 murE SA1023 UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase
 sa_c4313s3667_a_at 2.0 2.5 2.5 murF SA2073 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
 sa_c10005s8699_a_at 5.4 2.5 2.5 pbp1 SA1194 penicillin-binding protein 1
 sa_c2140s1839_a_at 3.9 2.5 2.5 pbp2 SA1490 penicillin-binding protein 2
 sa_c8117s7099_a_at 4.8 2.5 5 uppP SA0743 undecaprenyl pyrophosphate phosphatase
 sa_c9611s8371_a_at* 5.2 2.5 2.5 uppS SA1279 undecaprenyl diphosphate synthase
 sa_c1750s1485_a_at 2.7 2.5 ND SA0117 polysaccharide extrusion protein
 sa_c10723s11171cv_s_at 8.6 2.5 2.5 SA0507 LysM domain protein
 sa_c7959s6944_a_at 2.1 2.5 2.5 SA0694 teichoic acids export protein
 sa_c8942s7857_a_at 2.4 2.5 2.5 SA0778 sulfatase family protein
 sa_c8964s7875_a_at 4.5 2.5 2.5 SA0810 glycosyl transferase
 sa_c8344s7317_a_at 4.8 2.5 5 SA0820 LysM domain protein
 sa_c524s9582cv_s_at 14.4 2.5 ND SA1043 glycosyl transferase, group 1 family protein
 sa_c2175s1875_a_at 2.4 2.5 2.5 SA1498 glycosyl transferase, group 1 family protein
 sa_c10078s8796_a_at 7.4 2.5 2.5 SA1687 N-acetylmuramoyl-L-alanine amidase
 sa_c2930s2494_a_at 3.9 2.5 2.5 SA1703 putative rod shape-determining protein MreD
 sa_c3330s2873_at* 4.1 2.5 2.5 SA1804 polysaccharide biosynthesis protein
 sa_c8776s7720_a_at* 6.2 2.5 2.5 SA1825 N-acetylmuramoyl-L-alanine amidase
 sa_c3764s3235_a_at 3.8 2.5 2.5 SA1951 Mur ligase family protein
 sa_c5094s4391_a_at* 11.7 2.5 2.5 SA2298 N-acetylmuramoyl-L-alanine amidase
Cell cycle control
 sa_c9724s8471_a_at* 5.0 2.5 2.5 engA SA1515 GTP-binding protein
 sa_c3004s2562_a_at 3.4 2.5 2.5 engB SA1720 GTPase
 sa_c1104s883_a_at* 2.3 5 2.5 ftsA SA1198 cell division protein
 sa_c7547s6567_a_at 2.2 2.5 2.5 ftsH SA0555 putative cell division protein
 sa_c9453s8264_a_at* 3.0 2.5 2.5 gidA SA2737 tRNA uridine 5-carboxymethylaminomethyl modification enzyme
 sa_c847s650_a_at 4.7 2.5 2.5 SA1122 cell cycle protein FtsW
 sa_c1124s904_a_at 4.4 2.5 2.5 SA1205 putative cell-division initiation protein
 sa_c1274s1050_a_at 7.2 2.5 2.5 SA1250 putative chromosome segregation SMC protein
 sa_c1423s1196_a_at 2.5 2.5 2.5 SA1295 FtsK/SpoIIIE family protein
Intracellular trafficking and secretion
 sa_c1288s1061_a_at 4.3 2.5 2.5 ffh SA1253 signal recognition particle protein
 sa_c7609s6622_a_at 2.6 2.5 2.5 secE SA0581 preprotein translocase
 sa_c9947s8643_a_at* 3.6 15 15 secY SA2219 preprotein translocase
 sa_c6603s5771_a_at 3.2 2.5 ND secY SA2675 preprotein translocase
 sa_c10080s8800_at* 7.9 5 15 yajC SA1693 preprotein translocase
 sa_c10265s8943_a_at 4.1 2.5 2.5 SA0418 mttA/Hcf106 family protein
 sa_c2899s2464_a_at* 5.9 2.5 2.5 SA1692 bifunctional preprotein translocase
Virulence
 sa_c3966s9857_a_at* 7.2 5 ND chp N315-SA1755 chemotaxis-inhibiting protein
 sa_c4761s9994_a_at 8.3 15 ND coa N315-SA0222 staphylocoagulase precursor
 sa_c4144s3498_a_at 4.1 2.5 5 hld SA2022 delta-hemolysin
 sa_c3556s9823_at 3.2 2.5 ND sen N315-SA1643 enterotoxin SeN
 sa_c1082s9604_a_at* 2.2 15 15 spa SA0095 protein A precursor
 sa_c9481s10390_x_at 5.5 2.5 ND yent1 N315-SA1645 enterotoxin
 sa_c3561s9828_a_at* 4.6 2.5 ND yent2 N315-SA1644 enterotoxin
 sa_c7024s6147_a_at 6.7 2.5 ND SA0405 MATE efflux family protein
 sa_c2775s9782_at* 3.6 2.5 ND SA1657 putative enterotoxin type A
 sa_c5066s4362_a_at* 39.3 2.5 5 SA2291 staphyloxanthin biosynthesis
 sa_c5082s4380_a_at* 37.0 2.5 ND SA2295 taphyloxanthin biosynthesis
 sa_c6250s5428_a_at* 4.6 2.5 ND SA2581 staphyloxanthin biosynthesis
Resistance
 sa_c5721s4964_a_at* 4.0 2.5 2.5 bcr SA2437 bicyclomycin resistance protein
 sa_c1968s1693_a_at 2.9 2.5 ND SA0122 putative tetracycline resistance protein
 sa_c342s182_a_at 11.0 2.5 ND SA2347 EmrB/QacA family drug resistance transporter
 sa_c346s186_a_at 2.4 2.5 ND SA2413 EmrB/QacA family drug resistance transporter
Unknown function
 sa_c3818s3290_a_at 2.2 2.5 5 camS SA1964 hypothetical protein
 sa_c1116s897_a_at 2.3 2.5 2.5 ylmF SA1202 hypothetical protein
 sa_c10327s9007_a_at 6.0 2.5 5 ylmG SA1203 hypothetical protein
 sa_c1122s901_a_at 4.5 2.5 2.5 ylmH SA1204 YlmH protein
 sa_c77s76_a_at 3.2 2.5 2.5 yycI SA0022 hypothetical protein
 sa_c25s24_a_at 6.9 2.5 ND SA0007 hypothetical protein
 sa_c9259s8103_a_at 4.1 2.5 ND SA0255 hypothetical protein
 sa_c7047s6159_a_at 4.7 2.5 ND SA0411 hypothetical protein
 sa_c7070s6181_a_at 3.3 2.5 ND SA0419 hypothetical protein
 sa_c7078s6191_a_at 3.2 2.5 ND SA0421 hypothetical protein
 sa_c7088s6200_a_at* 6.6 2.5 ND SA0425 hypothetical protein
 sa_c9086s7967cs_a_at 9.9 2.5 2.5 SA0450 hypothetical protein
 sa_c7579s6599_a_at 5.8 2.5 2.5 SA0573 hypothetical protein
 sa_c7714s6714_a_at 2.0 2.5 2.5 SA0613 hypothetical protein
 sa_c7752s6755_at 2.4 2.5 ND SA0623 hypothetical protein
 sa_c7774s6775_a_at 4.4 2.5 2.5 SA0628 hypothetical protein
 sa_c7776s6779_a_at 3.3 2.5 5 SA0629 hypothetical protein
 sa_c7859s6850_at 3.5 2.5 2.5 SA0662 hypothetical protein
 sa_c7985s6972_at 2.4 2.5 2.5 SA0703 hypothetical protein
 sa_c8013s6998_a_at 26.8 2.5 2.5 SA0711 hypothetical protein
 sa_c8905s7823_a_at* 2.5 2.5 2.5 SA0721 hypothetical protein
 sa_c8079s7064_a_at 2.4 2.5 5 SA0734 hypothetical protein
 sa_c8131s7116_a_at 2.1 2.5 2.5 SA0749 hypothetical protein
 sa_c8147s7131_a_at 2.6 2.5 2.5 SA0752 hypothetical protein
 sa_c8151s7135_at 2.2 2.5 ND SA0753 hypothetical protein
 sa_c8928s7841_a_at* 4.0 2.5 ND SA0755 hypothetical protein
 sa_c8200s7177_a_at 3.8 2.5 2.5 SA0769 hypothetical protein
 sa_c8226s7201_a_at 4.6 2.5 2.5 SA0776 hypothetical protein
 sa_c8228s7205_a_at* 4.1 2.5 2.5 SA0777 hypothetical protein
 sa_c8262s7237_a_at* 4.4 2.5 ND SA0790 hypothetical protein
 sa_c8288s7265_a_at 4.1 2.5 2.5 SA0800 hypothetical protein
 sa_c8296s7275_a_at* 8.4 2.5 ND SA0802 hypothetical protein
 sa_c8312s7292_a_at 4.5 2.5 2.5 SA0807 hypothetical protein
 sa_c8958s7869_a_at 5.0 2.5 2.5 SA0808 hypothetical protein
 sa_c8324s10230_a_at 4.2 2.5 2.5 SA0812 hypothetical protein
 sa_c8360s7335_a_at 2.6 2.5 2.5 SA0827 hypothetical protein
 sa_c8365s7337_a_at 3.1 2.5 2.5 SA0828 hypothetical protein
 sa_c8463s7426_a_at* 6.5 2.5 ND SA0864 hypothetical protein
 sa_c8581s7540_a_at 3.0 2.5 2.5 SA0930 hypothetical protein
 sa_c8595s7551_at 4.1 2.5 2.5 SA0934 hypothetical protein
 sa_c8086s7067_a_at 2.3 2.5 2.5 SA0939 hypothetical protein
 sa_c8693s7642_a_at 3.9 2.5 2.5 SA0967 hypothetical protein
 sa_c429s262_a_at* 5.6 2.5 2.5 SA1017 hypothetical protein
 sa_c439s269_a_at 3.8 2.5 2.5 SA1019 hypothetical protein
 sa_c453s285_a_at 2.4 2.5 2.5 SA1021 hypothetical protein
 sa_c463s294_a_at 7.6 2.5 2.5 SA1024 hypothetical protein
 sa_c493s322_at 3.6 2.5 5 SA1035 hypothetical protein
 sa_c517s346_a_at* 2.4 15 15 SA1041 hypothetical protein
 sa_c521s9580_a_at 6.1 2.5 ND SA1042 hypothetical protein
 sa_c525s350_at* 4.6 2.5 5 SA1044 hypothetical protein
 sa_c10307s8990_a_at 2.2 2.5 2.5 SA1050 hypothetical protein
 sa_c9045s7941_a_at 3.7 2.5 ND SA1086 hypothetical protein
 sa_c712s522_a_at 2.0 2.5 2.5 SA1088 hypothetical protein
 sa_c732s540_a_at 2.4 2.5 ND SA1093 hypothetical protein
 sa_c744s9414_a_at 2.8 2.5 2.5 SA1099 hypothetical protein
 sa_c787s588_a_at 6.7 5 ND SA1106 hypothetical protein
 sa_c807s608_a_at* 3.0 2.5 2.5 SA1112 hypothetical protein
 sa_c863s665_at* 5.7 2.5 5 SA1126 hypothetical protein
 sa_c879s682_a_at 6.6 2.5 ND SA1131 hypothetical protein
 sa_c8780s7721_a_at* 13.0 2.5 ND SA1132 hypothetical protein
 sa_c883s684_a_at 7.3 2.5 2.5 SA1133 hypothetical protein
 sa_c8768s7712_at 3.7 2.5 5 SA1136 hypothetical protein
 sa_c945s9288_a_at 2.7 2.5 2.5 SA1151 hypothetical protein
 sa_c949s742_at 6.2 2.5 2.5 SA1152 hypothetical protein
 sa_c9975s8671_a_at* 8.4 2.5 2.5 SA1230 hypothetical protein
 sa_c1226s1006_a_at 2.9 2.5 2.5 SA1236 hypothetical protein
 sa_c1238s1018_a_at 3.9 2.5 2.5 SA1239 hypothetical protein
 sa_c1378s1153_a_at 5.1 2.5 2.5 SA1284 hypothetical protein
 sa_c10333s9011_a_at 7.2 2.5 5 SA1286 hypothetical protein
 sa_c1453s1230_a_at* 4.3 2.5 2.5 SA1307 hypothetical protein
 sa_c1470s1249_a_at 3.4 2.5 2.5 SA1313 hypothetical protein
 sa_c1526s1304_a_at 3.1 2.5 2.5 SA1327 hypothetical protein
 sa_c1699s1436_a_at* 4.0 2.5 2.5 SA1373 hypothetical protein
 sa_c1711s1447_a_at* 4.7 5 5 SA1378 hypothetical protein
 sa_c1723s1460_a_at 2.2 2.5 2.5 SA1380 hypothetical protein
 sa_c1762s1498_a_at* 4.9 2.5 2.5 SA1388 hypothetical protein
 sa_c1785s1516_a_at 3.0 2.5 2.5 SA1394 hypothetical protein
 sa_c2050s1762_a_at 3.6 2.5 2.5 SA1464 hypothetical protein
 sa_c2054s1766_a_at 3.0 2.5 2.5 SA1465 hypothetical protein
 sa_c2058s1770_at 2.1 2.5 2.5 SA1466 hypothetical protein
 sa_c2063s1774_a_at 3.4 2.5 2.5 SA1467 hypothetical protein
 sa_c2066s1777_a_at* 36.6 2.5 ND SA1468 hypothetical protein
 sa_c2109s1814_a_at* 29.3 2.5 ND SA1481 hypothetical protein
 sa_c2120s1823_a_at* 13.1 2.5 2.5 SA1483 hypothetical protein
 sa_c9740s8486_a_at 2.7 2.5 2.5 SA1485 hypothetical protein
 sa_c2182s1883_a_at 3.1 2.5 ND SA1501 hypothetical protein
 sa_c9728s8474_a_at 3.6 2.5 2.5 SA1512 hypothetical protein
 sa_c2489s2070_at 3.3 15 2.5 SA1558 hypothetical protein
 sa_c2533s2114_at 4.6 2.5 2.5 SA1570 hypothetical protein
 sa_c10583s11040_a_at 2.3 2.5 ND SA1585 hypothetical protein
 sa_c2611s2187_a_at 2.3 2.5 2.5 SA1605 hypothetical protein
 sa_c10360s10752_s_at 2.3 2.5 2.5 SA1606 rhomboid family protein unknown function
 sa_c2693s2265_a_at* 3.7 2.5 2.5 SA1633 hypothetical protein
 sa_c2695s2269_a_at* 4.5 2.5 5 SA1634 hypothetical protein
 sa_c2745s2315_a_at* 6.3 2.5 2.5 SA1647 hypothetical protein
 sa_c9631s8387_a_at* 2.7 2.5 2.5 SA1648 hypothetical protein
 sa_c2757s2330_a_at* 4.9 2.5 2.5 SA1651 hypothetical protein
 sa_c9407s9231_a_at* 6.0 5 15 SA1701 hypothetical protein
 sa_c2946s2510_a_at 3.4 2.5 ND SA1706 hypothetical protein
 sa_c2982s2536_a_at 3.5 2.5 5 SA1712 putative abrB protein
 sa_c3020s2577_a_at 3.2 2.5 2.5 SA1723 hypothetical protein
 sa_c3160s2708_a_at 3.7 5 5 SA1761 hypothetical protein
 sa_c3170s2715_a_at* 12.3 2.5 ND SA1763 hypothetical protein
 sa_c3282s2825_a_at 3.0 2.5 2.5 SA1792 hypothetical protein
 sa_c3286s2830_a_at 5.3 2.5 2.5 SA1793 hypothetical protein
 sa_c3336s9800_a_at* 3.8 2.5 ND SA1805 hypothetical protein
 sa_c3357s2894_a_at 5.2 2.5 2.5 SA1810 hypothetical protein
 sa_c10093s8829_at 3.0 2.5 2.5 SA1826 hypothetical protein
 sa_c3441s2971_a_at* 2.7 2.5 2.5 SA1836 hypothetical protein
 sa_c3481s3008_a_at* 3.2 2.5 5 SA1847 hypothetical protein
 sa_c3485s3012_a_at 4.9 2.5 ND SA1848 hypothetical protein
 sa_c3491s9181_a_at* 5.5 2.5 ND SA1850 hypothetical protein
 sa_c3576s3055_a_at 3.4 2.5 2.5 SA1885 hypothetical protein
 sa_c10110s8831_at 4.3 2.5 2.5 SA1890 hypothetical protein
 sa_c3607s3087_a_at 2.0 2.5 2.5 SA1899 hypothetical protein
 sa_c3681s3162_a_at 4.7 2.5 2.5 SA1923 hypothetical protein
 sa_c3696s3175_a_at 2.2 2.5 2.5 SA1928 hypothetical protein
 sa_c10117s8839_a_at 2.7 2.5 2.5 SA1934 hypothetical protein
 sa_c3709s9185_a_at 5.9 2.5 2.5 SA1935 hypothetical protein
 sa_c3750s3226_a_at 2.5 2.5 ND SA1947 hypothetical protein
 sa_c3786s3258_a_at 3.2 2.5 2.5 SA1956 hypothetical protein
 sa_c3842s3311_at 2.2 2.5 5 SA1972 hypothetical protein
 sa_c3846s3316_at 2.9 2.5 2.5 SA1973 hypothetical protein
 sa_c3912s3381_at 3.1 2.5 2.5 SA1989 hypothetical protein
 sa_c3916s3383_a_at 3.1 2.5 2.5 SA1990 hypothetical protein
 sa_c3920s3388_at 4.9 2.5 2.5 SA1991 hypothetical protein
 sa_c3924s3392_a_at* 3.6 2.5 5 SA1993 hypothetical protein
 sa_c3932s3401_a_at* 5.4 2.5 5 SA1995 hypothetical protein
 sa_c4171s3522_a_at* 14.8 2.5 ND SA2033 hypothetical protein
 sa_c4173s3526_a_at* 29.0 2.5 ND SA2034 hypothetical protein
 sa_c4203s3553_a_at 6.5 2.5 2.5 SA2040 hypothetical protein
 sa_c4205s3557_a_at 3.1 2.5 2.5 SA2041 hypothetical protein
 sa_c4285s3637_a_at 2.9 2.5 2.5 SA2063 hypothetical protein
 sa_c4289s3643_a_at 2.3 2.5 ND SA2064 hypothetical protein
 sa_c4345s3694_at 3.2 2.5 5 SA2077 hypothetical protein
 sa_c4361s3711_a_at 3.1 2.5 2.5 SA2080 hypothetical protein
 sa_c4438s3783_a_at* 2.6 15 15 SA2102 hypothetical protein
 sa_c4456s3801_a_at 6.2 2.5 2.5 SA2108 hypothetical protein
 sa_c4480s3823_a_at 4.7 2.5 2.5 SA2118 hypothetical protein
 sa_c4519s3864_a_at 2.6 2.5 2.5 SA2133 hypothetical protein
 sa_c10171s8867_at 8.2 2.5 2.5 SA2134 hypothetical protein
 sa_c10176s10598_s_at 4.8 2.5 5 SA2140 hypothetical protein
 sa_c4593s3925_a_at* 2.2 2.5 2.5 SA2152 hypothetical protein
 sa_c4635s3957_a_at 11.9 2.5 2.5 SA2164 hypothetical protein
 sa_c10197s8880_a_at 7.0 2.5 ND SA2250 hypothetical protein
 sa_c4919s4228_a_at* 4.8 2.5 ND SA2251 hypothetical protein
 sa_c5005s4307_a_at* 4.4 2.5 ND SA2275 BioY family protein
 sa_i4391u_x_at 8.2 2.5 ND SA2299 hypothetical protein
 sa_c5114s4412_a_at 17.7 2.5 ND SA2306 hypothetical protein
 sa_c5138s4434_a_at 2.6 2.5 2.5 SA2312 hypothetical protein
 sa_c5199s4501_a_at* 18.6 2.5 ND SA2328 hypothetical protein
 sa_c5211s4512_at 4.2 2.5 ND SA2331 hypothetical protein
 sa_c5219s4518_at 4.8 2.5 2.5 SA2333 hypothetical protein
 sa_c5223s4525_a_at* 2.0 2.5 2.5 SA2334 hypothetical protein
 sa_c5266s4564_a_at 2.2 2.5 2.5 SA2346 hypothetical protein
 sa_c5274s4572_a_at 7.0 2.5 ND SA2348 hypothetical protein
 sa_c5480s4745_at 2.7 2.5 15 SA2371 hypothetical protein
 sa_c5492s4755_a_at* 3.9 2.5 ND SA2373 hypothetical protein
 sa_c9334s8169_a_at* 5.1 2.5 2.5 SA2383 hypothetical protein
 sa_c5606s4859_a_at* 2.1 2.5 ND SA2402 hypothetical protein
 sa_c5620s4877_a_at 3.2 2.5 2.5 SA2407 putative lipoprotein
 sa_c5624s4878_a_at 5.7 2.5 2.5 SA2408 putative lipoprotein
 sa_c5727s4967_a_at 6.0 2.5 ND SA2438 hypothetical protein
 sa_c5745s4988_a_at 9.6 2.5 ND SA2443 hypothetical protein
 sa_c5788s5026_a_at 2.0 2.5 2.5 SA2456 hypothetical protein
 sa_c10518s10967_s_at 2.3 2.5 2.5 SA2520 hypothetical protein
 sa_c9378s8205_a_at 2.2 2.5 2.5 SA2522 DedA family protein
 sa_c6038s5239_a_at* 4.6 2.5 ND SA2528 hypothetical protein
 sa_c6151s5333_a_at* 6.2 2.5 ND SA2557 hypothetical protein
 sa_c10530s10985_s_at 2.4 2.5 ND SA2599 hypothetical protein
 sa_c6333s5501_a_at 4.9 2.5 2.5 SA2607 hypothetical protein
 sa_c6424s5594_a_at 2.7 2.5 2.5 SA2630 hypothetical protein
 sa_c6565s5735_a_at 2.8 2.5 2.5 SA2665 putative phage infection protein
 sa_c6764s5905_a_at 3.7 2.5 2.5 SA2713 hypothetical protein
 sa_c6815s10098_at* 2.3 2.5 ND SA2728 hypothetical protein
 sa_c6825s5958_a_at 2.4 2.5 ND SA2733 hypothetical protein
 sa_c9448s8258_a_at* 2.1 2.5 ND SA2734 hypothetical protein
 sa_c7843s6835_a_at 2.4 2.5 2.5 N315-SA0559 hypothetical protein
 sa_c8143s7126_at 2.1 2.5 ND N315-SA0647 hypothetical protein
 sa_c8222s10227_at* 6.6 2.5 ND N315-SA0671 hypothetical protein
 sa_c9400s10363_at* 3.4 2.5 ND N315-SA0692 hypothetical protein
 sa_c9750s10427_at 3.6 2.5 ND N315-SA1015 hypothetical protein
 sa_c3428s2956_a_at 3.5 2.5 ND N315-SA1600 hypothetical protein
 sa_i9856dr_x_at 3.8 2.5 ND N315-SA1753 hypothetical protein
 sa_c3962s9856_a_at* 2.2 15 5 N315-SA1754 hypothetical protein
 sa_c9895s10439_a_at 4.5 30 ND N315-SA1759 hypothetical protein
 sa_c3973s9865_a_at* 3.9 stable ND N315-SA1760 hypothetical protein
 sa_c3979s9871_at* 5.2 stable ND N315-SA1762 hypothetical protein
 sa_c9897s10440_s_at* 9.1 15 ND N315SA1765 hypothetical protein
 sa_c3992s9884_a_at* 6.8 15 ND N315SA1766 hypothetical protein
 sa_c3995s9886_a_at* 7.2 30 15 N315-SA1767 hypothetical protein
 sa_c4003s9891_a_at* 3.9 30 ND N315-SA1768 hypothetical protein
 sa_c4005s9893_a_at* 9.4 30 ND N315-SA1769 hypothetical protein
 sa_c4009s9897_a_at* 5.8 2.5 2.5 N315-SA1770 hypothetical protein
 sa_c4010s9899_at* 8.7 15 15 N315-SA1771 hypothetical protein
 sa_c4012s9901_a_at* 8.5 15 15 N315-SA1772 hypothetical protein
 sa_c4014s9903_a_at* 9.5 30 15 N315-SA1773 hypothetical protein
 sa_c10670s11122_a_at 8.4 30 15 N315-SA1774 hypothetical protein
 sa_c4020s9905_at* 5.9 15 ND N315-SA1776 hypothetical protein
 sa_c10134s10547_a_at 6.1 2.5 ND N315-SA1777 hypothetical protein
 sa_c8467s10245_s_at 2.1 2.5 ND N315-SAS018 hypothetical protein
 sa_c3959s9853_a_at 10.0 2.5 2.5 N315-SAS058 hypothetical protein
 sa_c3047s2600_a_at 4.2 2.5 2.5 SA1730 hypothetical protein
 sa_c3984s9875_at* 7.4 30 ND SAR2047 hypothetical protein
 sa_c10668s11120_a_at 8.2 30 ND SAR2051 hypothetical protein
 sa_c4001s9889_a_at* 6.8 30 15 SAR2053 hypothetical protein
 sa_c3987s9878_at* 7.0 15 15 SAV1953 phi PVL ORF 20 and 21 homolog
 sa_c7393s6421_a_at 2.2 2.5 2.5 SACOL0510 hypothetical protein
 sa_c9380s9405_a_at* 3.1 2.5 ND SACOL2526 hypothetical protein
*

Functional category and GeneChip® qualifier indicated.

†

S. aureus strain COL locus unless otherwise indicated.

Acknowledgments

This work was supported by National Institutes of Health grant AI073780 (P.M.D.). K.L.A. was supported by American Heart Association pre-doctoral award 0715547Z. The authors would also like to acknowledge the generosity of Johnson and Johnson Inc. by providing expertise and instruments needed to perform aspects of this work.

Abbreviations

SSRs

Small stable RNAs

S. aureus

Staphylococcus aureus

References

  1. Abranches J, Martinez AR, Kajfasz JK, Chavez V, Garsin DA, et al. The molecular alarmone (p)ppGpp mediates stress responses, vancomycin tolerance, and virulence in Enterococcus faecalis. J Bacteriol. 2009;191(7):2248–2256. doi: 10.1128/JB.01726-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Abu-Qatouseh LF, Chinni SV, Seggewiss J, Proctor RA, Brosius J, et al. Identification of differentially expressed small non-protein-coding RNAs in Staphylococcus aureus displaying both the normal and the small-colony variant phenotype. J Mol Med. 2010;88(6):565–575. doi: 10.1007/s00109-010-0597-2. [DOI] [PubMed] [Google Scholar]
  3. Anderson KL, Dunman PM. Messenger RNA Turnover Processes in Escherichia coli, Bacillus subtilis, and Emerging Studies in Staphylococcus aureus. Int J Microbiol. 2009;2009(5):525491. doi: 10.1155/2009/525491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Anderson KL, Roberts C, Disz T, Vonstein V, Hwang K, et al. Characterization of the Staphylococcus aureus heat-shock, cold-shock, stringent, and SOS responses and their effects on log-phase mRNA turnover. J Bacteriol. 2006;188(19):6739–6756. doi: 10.1128/JB.00609-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Appelbe OK, Sedgley CM. Effects of prolonged exposure to alkaline pH on Enterococcus faecalis survival and specific gene transcripts. Oral Microbiol Immunol. 2007;22(3):169–174. doi: 10.1111/j.1399-302X.2007.00340.x. [DOI] [PubMed] [Google Scholar]
  6. Beaume M, Hernandez D, Farinelli L, Deluen C, Linder P, et al. Cartography of methicillin-resistant S. aureus transcripts: detection, orientation and temporal expression during growth phase and stress conditions. PLoS One. 2010;5(5):e10725. doi: 10.1371/journal.pone.0010725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Beenken KE, Dunman PM, McAleese F, Macapagal D, Murphy E, et al. Global Gene Expression in Staphylococcus aureus Biofilms. J Bacteriol. 2004;186(14):4665–4684. doi: 10.1128/JB.186.14.4665-4684.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bernstein JA, Khodursky AB, Lin PH, Lin-Chao S, Cohen SN. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A. 2002;99(15):9697–9702. doi: 10.1073/pnas.112318199. Epub 2002 Jul 9615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bhagat N, Virdi JS. Molecular and biochemical characterization of urease and survival of Yersinia enterocolitica biovar 1A in acidic pH in vitro. BMC Microbiol. 2009;9(262):262. doi: 10.1186/1471-2180-9-262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bischoff M, Dunman P, Kormanec J, Macapagal D, Murphy E, et al. Microarray-based analysis of the Staphylococcus aureus sigmaB regulon. J Bacteriol. 2004;186(13):4085–4099. doi: 10.1128/JB.186.13.4085-4099.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Boes N, Schreiber K, Schobert M. SpoT-triggered stringent response controls usp gene expression in Pseudomonas aeruginosa. J Bacteriol. 2008;190(21):7189–7199. doi: 10.1128/JB.00600-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bohn C, Rigoulay C, Chabelskaya S, Sharma CM, Marchais A, et al. Experimental discovery of small RNAs in Staphylococcus aureus reveals a riboregulator of central metabolism. Nucleic Acids Res. 2010;2010:28. doi: 10.1093/nar/gkq462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Booth IR. Regulation of cytoplasmic pH in bacteria. Microbiol Rev. 1985;49(4):359–378. doi: 10.1128/mr.49.4.359-378.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Bore E, Langsrud S, Langsrud O, Rode TM, Holck A. Acid-shock responses in Staphylococcus aureus investigated by global gene expression analysis. Microbiology. 2007;153(Pt 7):2289–2303. doi: 10.1099/mic.0.2007/005942-0. [DOI] [PubMed] [Google Scholar]
  15. Boucher HW, Corey GR. Epidemiology of methicillin-resistant Staphylococcus aureus. Clin Infect Dis. 2008;46 Suppl 5(46):S344–349. doi: 10.1086/533590. [DOI] [PubMed] [Google Scholar]
  16. Bronner S, Monteil H, Prevost G. Regulation of virulence determinants in Staphylococcus aureus: complexity and applications. FEMS Microbiol Rev. 2004;28(2):183–200. doi: 10.1016/j.femsre.2003.09.003. [DOI] [PubMed] [Google Scholar]
  17. Cassat J, Dunman PM, Murphy E, Projan SJ, Beenken KE, et al. Transcriptional profiling of a Staphylococcus aureus clinical isolate and its isogenic agr and sarA mutants reveals global differences in comparison to the laboratory strain RN6390. Microbiology. 2006;152(Pt 10):3075–3090. doi: 10.1099/mic.0.29033-0. [DOI] [PubMed] [Google Scholar]
  18. Cassat JE, Dunman PM, McAleese F, Murphy E, Projan SJ, et al. Comparative Genomics of Staphylococcus aureus Musculoskeletal Isolates. J Bacteriol. 2005;187(2):576–592. doi: 10.1128/JB.187.2.576-592.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Crosse AM, Greenway DL, England RR. Accumulation of ppGpp and ppGp in Staphylococcus aureus 8325–4 following nutrient starvation. Lett Appl Microbiol. 2000;31(4):332–337. doi: 10.1046/j.1472-765x.2000.00822.x. [DOI] [PubMed] [Google Scholar]
  20. Dunman PM, Murphy E, Haney S, Palacios D, Tucker-Kellogg G, et al. Transcription profiling-based identification of Staphylococcus aureus genes regulated by the agr and/or sarA loci. J Bacteriol. 2001;183(24):7341–7353. doi: 10.1128/JB.183.24.7341-7353.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Fang L, Xia B, Inouye M. Transcription of cspA, the gene for the major cold-shock protein of Escherichia coli, is negatively regulated at 37 degrees C by the 5′-untranslated region of its mRNA. FEMS Microbiol Lett. 1999;176(1):39–43. doi: 10.1111/j.1574-6968.1999.tb13639.x. [DOI] [PubMed] [Google Scholar]
  22. Fang L, Jiang W, Bae W, Inouye M. Promoter-independent cold-shock induction of cspA and its derepression at 37 degrees C by mRNA stabilization. Mol Microbiol. 1997;23(2):355–364. doi: 10.1046/j.1365-2958.1997.2351592.x. [DOI] [PubMed] [Google Scholar]
  23. Ferrero RL, Cussac V, Courcoux P, Labigne A. Construction of isogenic urease-negative mutants of Helicobacter pylori by allelic exchange. J Bacteriol. 1992;174(13):4212–4217. doi: 10.1128/jb.174.13.4212-4217.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gaynor EC, Wells DH, MacKichan JK, Falkow S. The Campylobacter jejuni stringent response controls specific stress survival and virulence-associated phenotypes. Mol Microbiol. 2005;56(1):8–27. doi: 10.1111/j.1365-2958.2005.04525.x. [DOI] [PubMed] [Google Scholar]
  25. Geiger T, Goerke C, Fritz M, Schafer T, Ohlsen K, et al. Role of the (p)ppGpp synthase RSH, a RelA/SpoT homolog, in stringent response and virulence of Staphylococcus aureus. Infect Immun. 2010;78(5):1873–1883. doi: 10.1128/IAI.01439-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Gentry D, Li T, Rosenberg M, McDevitt D. The rel gene is essential for in vitro growth of Staphylococcus aureus. J Bacteriol. 2000;182(17):4995–4997. doi: 10.1128/jb.182.17.4995-4997.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Gillaspy AF, Lee CY, Sau S, Cheung AL, Smeltzer MS. Factors affecting the collagen binding capacity of Staphylococcus aureus. Infect Immun. 1998;66(7):3170–3178. doi: 10.1128/iai.66.7.3170-3178.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Gillaspy AF, Hickmon SG, Skinner RA, Thomas JR, Nelson CL, et al. Role of the accessory gene regulator (agr) in pathogenesis of staphylococcal osteomyelitis. Infect Immun. 1995;63(9):3373–3380. doi: 10.1128/iai.63.9.3373-3380.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Goldenberg D, Azar I, Oppenheim AB. Differential mRNA stability of the cspA gene in the cold-shock response of Escherichia coli. Mol Microbiol. 1996;19(2):241–248. doi: 10.1046/j.1365-2958.1996.363898.x. [DOI] [PubMed] [Google Scholar]
  30. Goldstein J, Pollitt NS, Inouye M. Major cold shock protein of Escherichia coli. Proc Natl Acad Sci U S A. 1990;87(1):283–287. doi: 10.1073/pnas.87.1.283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Gordon RJ, Lowy FD. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin Infect Dis. 2008;46 Suppl 5(46):S350–359. doi: 10.1086/533591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Greenway DL, England RR. The intrinsic resistance of Escherichia coli to various antimicrobial agents requires ppGpp and sigma s. Lett Appl Microbiol. 1999;29(5):323–326. doi: 10.1046/j.1472-765x.1999.00642.x. [DOI] [PubMed] [Google Scholar]
  33. Hiramatsu T, Kodama K, Kuroda T, Mizushima T, Tsuchiya T. A putative multisubunit Na+/H+ antiporter from Staphylococcus aureus. J Bacteriol. 1998;180(24):6642–6648. doi: 10.1128/jb.180.24.6642-6648.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Hiron A, Borezee-Durant E, Piard JC, Juillard V. Only one of four oligopeptide transport systems mediates nitrogen nutrition in Staphylococcus aureus. J Bacteriol. 2007;189(14):5119–5129. doi: 10.1128/JB.00274-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Hornbaek T, Jakobsen M, Dynesen J, Nielsen AK. Global transcription profiles and intracellular pH regulation measured in Bacillus licheniformis upon external pH upshifts. Arch Microbiol. 2004;182(6):467–474. doi: 10.1007/s00203-004-0729-6. [DOI] [PubMed] [Google Scholar]
  36. Hu Y, Lu P, Wang Y, Ding L, Atkinson S, et al. OmpR positively regulates urease expression to enhance acid survival of Yersinia pseudotuberculosis. Microbiology. 2009;155(Pt 8):2522–2531. doi: 10.1099/mic.0.028381-0. [DOI] [PubMed] [Google Scholar]
  37. Jarry TM, Cheung AL. Staphylococcus aureus escapes more efficiently from the phagosome of a cystic fibrosis bronchial epithelial cell line than from its normal counterpart. Infect Immun. 2006;74(5):2568–2577. doi: 10.1128/IAI.74.5.2568-2577.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Jiang W, Hou Y, Inouye M. CspA, the major cold-shock protein of Escherichia coli, is an RNA chaperone. J Biol Chem. 1997;272(1):196–202. doi: 10.1074/jbc.272.1.196. [DOI] [PubMed] [Google Scholar]
  39. Jones PG, Mitta M, Kim Y, Jiang W, Inouye M. Cold shock induces a major ribosomal-associated protein that unwinds double-stranded RNA in Escherichia coli. Proc Natl Acad Sci U S A. 1996;93(1):76–80. doi: 10.1073/pnas.93.1.76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Joseleau-Petit D, Thevenet D, D’Ari R. ppGpp concentration, growth without PBP2 activity, and growth-rate control in Escherichia coli. Mol Microbiol. 1994;13(5):911–917. doi: 10.1111/j.1365-2958.1994.tb00482.x. [DOI] [PubMed] [Google Scholar]
  41. Kim S, Watanabe K, Suzuki H, Watarai M. Roles of Brucella abortus SpoT in morphological differentiation and intramacrophagic replication. Microbiology. 2005;151(Pt 5):1607–1617. doi: 10.1099/mic.0.27782-0. [DOI] [PubMed] [Google Scholar]
  42. Kinsinger RF, Kearns DB, Hale M, Fall R. Genetic requirements for potassium ion-dependent colony spreading in Bacillus subtilis. J Bacteriol. 2005;187(24):8462–8469. doi: 10.1128/JB.187.24.8462-8469.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Klevens RM, Morrison MA, Nadle J, Petit S, Gershman K, et al. Invasive methicillin-resistant Staphylococcus aureus infections in the United States. Jama. 2007;298(15):1763–1771. doi: 10.1001/jama.298.15.1763. [DOI] [PubMed] [Google Scholar]
  44. Kuroda M, Ohta T, Hayashi H. Isolation and the gene cloning of an alkaline shock protein in methicillin resistant Staphylococcus aureus. Biochem Biophys Res Commun. 1995;207(3):978–984. doi: 10.1006/bbrc.1995.1281. [DOI] [PubMed] [Google Scholar]
  45. Lemos JA, Brown TA, Jr, Burne RA. Effects of RelA on key virulence properties of planktonic and biofilm populations of Streptococcus mutans. Infect Immun. 2004;72(3):1431–1440. doi: 10.1128/IAI.72.3.1431-1440.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Luong T, Sau S, Gomez M, Lee JC, Lee CY. Regulation of Staphylococcus aureus capsular polysaccharide expression by agr and sarA. Infect Immun. 2002;70(2):444–450. doi: 10.1128/IAI.70.2.444-450.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Luong TT, Newell SW, Lee CY. Mgr, a novel global regulator in Staphylococcus aureus. J Bacteriol. 2003;185(13):3703–3710. doi: 10.1128/JB.185.13.3703-3710.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Manka W, Adrianowicz L, Wesolek Z, Adrianowicz K. The value of determining vaginal secretion reaction (pH) as a screening test of bacterial vaginosis. Wiad Lek. 2002;55(1–2):51–55. [PubMed] [Google Scholar]
  49. Mols M, Abee T. Role of ureolytic activity in Bacillus cereus nitrogen metabolism and acid survival. Appl Environ Microbiol. 2008;74(8):2370–2378. doi: 10.1128/AEM.02737-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Morfeldt E, Taylor D, von Gabain A, Arvidson S. Activation of alpha-toxin translation in Staphylococcus aureus by the trans-encoded antisense RNA, RNAIII. EMBO J. 1995;14(18):4569–4577. doi: 10.1002/j.1460-2075.1995.tb00136.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Musarrat J, Ahmad M. Damage and mutagenesis of bacteriophage lambda induced by high pH. Mutagenesis. 1991;6(3):207–211. doi: 10.1093/mutage/6.3.207. [DOI] [PubMed] [Google Scholar]
  52. Novick RP. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol Microbiol. 2003;48(6):1429–1449. doi: 10.1046/j.1365-2958.2003.03526.x. [DOI] [PubMed] [Google Scholar]
  53. Padan E, Bibi E, Ito M, Krulwich TA. Alkaline pH homeostasis in bacteria: new insights. Biochim Biophys Acta. 2005;1717(2):67–88. doi: 10.1016/j.bbamem.2005.09.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Pane-Farre J, Jonas B, Forstner K, Engelmann S, Hecker M. The sigmaB regulon in Staphylococcus aureus and its regulation. Int J Med Microbiol. 2006;296(4–5):237–258. doi: 10.1016/j.ijmm.2005.11.011. [DOI] [PubMed] [Google Scholar]
  55. Pichon C, Felden B. Small RNA genes expressed from Staphylococcus aureus genomic and pathogenicity islands with specific expression among pathogenic strains. Proc Natl Acad Sci U S A. 2005;102(40):14249–14254. doi: 10.1073/pnas.0503838102. Epub 12005 Sep 14223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Pomares MF, Vincent PA, Farias RN, Salomon RA. Protective action of ppGpp in microcin J25-sensitive strains. J Bacteriol. 2008;190(12):4328–4334. doi: 10.1128/JB.00183-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Regassa LB, Betley MJ. Alkaline pH decreases expression of the accessory gene regulator (agr) in Staphylococcus aureus. J Bacteriol. 1992;174(15):5095–5100. doi: 10.1128/jb.174.15.5095-5100.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Reid AN, Pandey R, Palyada K, Whitworth L, Doukhanine E, et al. Identification of Campylobacter jejuni genes contributing to acid adaptation by transcriptional profiling and genome-wide mutagenesis. Appl Environ Microbiol. 2008;74(5):1598–1612. doi: 10.1128/AEM.01508-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Roberts C, Anderson KL, Murphy E, Projan SJ, Mounts W, et al. Characterizing the effect of the Staphylococcus aureus virulence factor regulator, SarA, on log-phase mRNA half-lives. J Bacteriol. 2006;188(7):2593–2603. doi: 10.1128/JB.188.7.2593-2603.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Schilling O, Frick O, Herzberg C, Ehrenreich A, Heinzle E, et al. Transcriptional and metabolic responses of Bacillus subtilis to the availability of organic acids: transcription regulation is important but not sufficient to account for metabolic adaptation. Appl Environ Microbiol. 2007;73(2):499–507. doi: 10.1128/AEM.02084-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Schneider LA, Korber A, Grabbe S, Dissemond J. Influence of pH on wound-healing: a new perspective for wound-therapy? Arch Dermatol Res. 2007;298(9):413–420. doi: 10.1007/s00403-006-0713-x. [DOI] [PubMed] [Google Scholar]
  62. Shang F, Xue T, Sun H, Xing L, Zhang S, et al. The Staphylococcus aureus GGDEF domain-containing protein, GdpS, influences protein A gene expression in a cyclic diguanylic acid-independent manner. Infect Immun. 2009;77(7):2849–2856. doi: 10.1128/IAI.01405-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Sleator RD, Hill C. Bacterial osmoadaptation: the role of osmolytes in bacterial stress and virulence. FEMS Microbiol Rev. 2002;26(1):49–71. doi: 10.1111/j.1574-6976.2002.tb00598.x. [DOI] [PubMed] [Google Scholar]
  64. Stolyar S, He Q, Joachimiak MP, He Z, Yang ZK, et al. Response of Desulfovibrio vulgaris to alkaline stress. J Bacteriol. 2007;189(24):8944–8952. doi: 10.1128/JB.00284-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Takayama K, Kjelleberg S. The role of RNA stability during bacterial stress responses and starvation. Environ Microbiol. 2000;2(4):355–365. doi: 10.1046/j.1462-2920.2000.00119.x. [DOI] [PubMed] [Google Scholar]
  66. Voyich JM, Braughton KR, Sturdevant DE, Whitney AR, Said-Salim B, et al. Insights into mechanisms used by Staphylococcus aureus to avoid destruction by human neutrophils. J Immunol. 2005;175(6):3907–3919. doi: 10.4049/jimmunol.175.6.3907. [DOI] [PubMed] [Google Scholar]
  67. Weinrick B, Dunman PM, McAleese F, Murphy E, Projan SJ, et al. Effect of mild acid on gene expression in Staphylococcus aureus. J Bacteriol. 2004;186(24):8407–8423. doi: 10.1128/JB.186.24.8407-8423.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Wilks JC, Kitko RD, Cleeton SH, Lee GE, Ugwu CS, et al. Acid and base stress and transcriptomic responses in Bacillus subtilis. Appl Environ Microbiol. 2009;75(4):981–990. doi: 10.1128/AEM.01652-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Table S1. Supplementary Table 1.

S. aureus sRNA-like molecules that are produced in response to acid-or alkaline-shock conditions.

RESOURCES