Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Apr 5.
Published in final edited form as: Biochemistry. 2011 Feb 28;50(13):2567–2574. doi: 10.1021/bi2000214

Redox State-Dependent Interaction of HMGB1 and Cisplatin-Modified DNA

Semi Park 1, Stephen J Lippard 1,*
PMCID: PMC3068233  NIHMSID: NIHMS270269  PMID: 21355578

Abstract

HMGB1, one of the most abundant nuclear proteins, has a strong binding affinity for cisplatin-modified DNA. It has been proposed that HMGB1 enhances the anticancer efficacy of cisplatin by shielding platinated DNA lesions from repair. Two cysteine residues in HMGB1 domain A form a reversible disulfide bond under mildly oxidizing conditions. The reduced domain A protein binds to a 25-bp DNA probe containing a central 1,2-d(GpG) intrastrand cross-link, the major platinum-DNA adduct, with a 10-fold greater binding affinity than the oxidized domain A. The binding affinities of singly and doubly mutated HMGB1 domain A, respectively deficient in one or both cysteine residues that form the disulfide bond, are unaffected by changes in external redox conditions. The redox-dependent nature of the binding of HMGB1 domain A to cisplatin-modified DNA suggests that formation of the intradomain disulfide bond induces a conformational change that disfavors binding to cisplatin-modified DNA. Hydroxyl radical footprinting analyses of wild type domain A bound to platinated DNA under different redox conditions revealed identical cleavage patterns, implying that the asymmetric binding mode of the protein across from the platinated lesion is conserved irrespective of the redox state. The results of this study reveal that the cellular redox environment can influence the interaction of HMGB1 with the platinated DNA and suggest that the redox state of the A domain is a potential factor in regulating the role of the protein in modulating the activity of cisplatin as an anticancer drug.

INTRODUCTION

Cisplatin is one of the most widely used anticancer drugs, being effective against a range of tumors including ovarian, genitourinary, lung, head and neck cancers (1). Most noteworthy is the cure rate of testicular cancer, which has increased dramatically following the introduction of cisplatin-based chemotherapy (2). Cisplatin and its second generation analogues carboplatin and oxaliplatin bind to DNA preferentially at the N7 position of guanine bases (1, 3, 4), inhibiting replication (5, 6) and transcription (7-9). The inhibition of those critical DNA-related processes triggers subsequent intracellular events that activate necrotic and apoptotic pathways (10). Despite its outstanding antitumor activity, cisplatin chemotherapy is limited by intrinsic and acquired resistance of certain tumors (11). Several major mechanisms of cisplatin resistance have been discovered (12, 13), and there have been numerous attempts to overcome the problems based on these mechanisms. One strategy has been to develop analogs of cisplatin with different antitumor profiles, like carboplatin and oxaliplatin (14, 15). Another is to identify intracellular factors that participate in the mechanisms of cisplatin resistance, and to discover ways to control these factors.

HMGB1 is a highly abundant and ubiquitously expressed nuclear protein, the defining member of the HMG superfamily. This small, ~25 kDa protein functions as a transcription factor that bends DNA and assists other DNA-binding proteins to form their recognition complexes (16, 17). HMGB1 consists of two tandem DNA binding domains, high mobility group box A and B, and a highly acidic C terminal tail composed of a string of aspartate and glutamate residues (Figure 1). Both domains A and B consist of three α-helices that cooperatively wrap around DNA, approaching from the minor groove, in the DNA-HMG box complex. HMG boxes in HMGB1 bind to DNA in a structure-specific but sequence-independent manner, with greater binding affinity for nonlinear DNA such as bent, kinked, or unwound duplexes (18, 19).

Figure 1.

Figure 1

Sequence alignment of four human HMGB proteins. The orange background denotes residues that interact with the DNA backbone in complex of HMGB1 domain A bound to a site-specific cisplatin intrastrand DNA cross-link. Residues that are homologous but not identical are denoted with a light orange background. Intercalating residue Phe37 (green box) is conserved in every HMGB protein. Cys22 and Cys44 (blue box) are conserved from HMGB1 to HMGB3, but position 22 is replaced by tyrosine in HMGB4. HMGB1, -2, and -3 contain a C-terminal acidic tail (cyan background) of variable length, and HMGB4 lacks this feature. The numbering scheme does not include the initiator methionine residue.

HMGB1 as well as the A and B domains binds to platinated lesions on DNA with specificity for 1,2-intrastrand cross-links (20), which account for about 90% of the cisplatin-DNA adducts formed in vivo (21, 22). HMGB1 also has binding selectivity for interstrand cross-linked (ICLs) versus undamaged DNA, but not 1,3-intrastrand cross-links (23). HMGB1 domain A binds with greater specificity to platinated DNA than does domain B. In full-length HMGB1, it is the A domain that mainly binds to platinated lesions, although domain B also plays a role in strengthening the interaction (24).

An X-ray crystallographic analysis and binding assay revealed details of the interaction between HMGB1 domain A and DNA harboring a cisplatin 1,2-intrastrand d(GpG) cross-link (Figure 2) (25). A critical feature that dramatically enhances the binding preference of the domain for the platinated DNA is the occurrence of an intercalating residue, Phe37. The phenyl ring of Phe37 inserts into a hydrophobic notch formed in the minor groove across from the two platinum-modified guanine bases, and this stacking interaction significantly stabilizes the overall protein-DNA complexes and leads to an asymmetric positioning of the protein with respect to the platinum cross-link (24, 25).

Figure 2.

Figure 2

X-ray crystal structure of the complex between HMGB1 domain A and a 16-bp cisplatin-modified DNA under reducing conditions. Phe37 (cyan) inserts between two guanine bases bound to platinum (magenta). Two thiol groups from Cys22 and Cys44 are shown as van der Waals spheres. The hydrophobic core at the interface between helix I and helix II is shown as a bright pink surface.

The sensitivity of the cells to cisplatin can be altered by changing the expression levels of HMGB1 and other HMG-domain proteins (26-28). Moreover, in vitro repair assays reveal that HMGB1 impedes nucleotide excision repair (NER), the major mechanism by which platinated lesions are removed from DNA (29-31). Taken together, these studies suggest that HMGB1 bound to cisplatin-modified DNA shields the platinated lesion from recognition by the repair proteins. A correlation between HMGB1 and cisplatin cytotoxicity, however, is not universally obtained. A cytotoxicity study revealed that the cisplatin sensitivity in genetically modified HMGB1 knockout mouse embryonic fibroblasts (MEFs) is not substantially different from that of the parental MEF call line (32). The failure to correlate cell sensitivity to cisplatin with HMG box protein levels indicates either that there is no such correlation or that one or more variable factors among different cell lines alter the HMGB1-platinated DNA interaction. The present study was undertaken to test one possibility for the latter explanation.

HMGB1 domain A contains two cysteine residues, in positions 22 and 44, which can form a disulfide bond under mildly oxidizing conditions (33). Previous work revealed that oxidation or modification of these cysteine thiols decreases the binding affinity of HMGB1 to various DNA probes, including a cisplatin-modified one (34-36). Recently, the redox properties of HMGB1 domain A were investigated by NMR spectroscopy (37). The calculated redox potential of domain A falls within the physiological intracellular redox potential range, which suggests that a significant fraction of HMGB1 will exist in the oxidized form within cells. It is therefore possible that the variability in cellular response to cisplatin as a function of HMG box proteins will reflect the redox state of the cells.

In this article, we describe the influence of redox state changes within the HMGB1 domain A protein on its binding to DNA containing a cisplatin 1,2-d(GpG) intrastrand cross-link. The binding properties of HMGB1 domain A and variants modified to prevent disulfide bond formation were investigated under different redox conditions using electrophoretic mobility shift assays (EMSAs) and hydroxyl radical footprinting. The detailed changes in the nature of the binding and their dependence upon redox conditions are discussed in the light of the previously reported crystal structure of HMGB1 domain A bound to platinated DNA probe under reducing conditions. Our results allow an assessment of the importance of the HMGB1 redox state for the efficacy of the anticancer action of cisplatin and other bifunctional platinum-based drugs.

MATERIALS AND METHODS

Expression and Purification of HMGB1 Domain A

Wild type HMGB1 domain A and its variants were expressed in E. coli from a previously reported plasmid, pET32 Xa/LIC (24). Codons for one or both of the cysteine residues in HMGB1 domain A were replaced with those for alanine or serine by the Stratagene QuikChange site-directed mutagenesis kit protocol, and the modified plasmids were transformed into BL21 (DE3) cells. The transformed cells were grown in LB medium with 100 μg/mL ampicillin at 37 °C and 100 rpm. When OD600 was 0.5-1.0, IPTG was added at a final concentration of 50 μM to induce gene expression. After induction, cells were incubated at 28 °C for 14-16 hr and harvested by centrifugation. Proteins were extracted by sonication and purified with a Ni-NTA column (Novagen). N-terminal peptides including a histidine tag were proteolytically cleaved from the eluted domain A protein variants by Factor Xa and removed by passage down a Macro-prep high S cation exchange column (Bio-Rad). Purified domain A and its variants were dialyzed against storage buffer (10 mM Tris-HCl, pH 8.0, 50 mM NaCl, 0.1 mM EDTA, 0.1 mM PMSF). For disulfide bond formation, protein solutions were dialyzed overnight against storage buffer containing 5 μM CuCl2 and then redialyzed against buffer lacking CuCl2. The concentrations of proteins were determined by UV spectroscopic and BCA assays, and the absence of free thiols in wild type domain A protein was confirmed by a Thiostar Assay (Arbor Assays).

Platination, Purification, and Characterization of a 25-bp DNA Probe

A 25-bp oligonucleotide with a central platinum-binding TGGA sequence was used as a DNA probe for electrophoretic mobility shift and footprinting assays. Both the strand with adjacent guanines (5′ – CCTCTCCTCTCTG*G*ATCTTCTCTCC - 3′) and its complement (5′- GGAGAGAAGATCCAGAGAGGAGAGG - 3′) were purchased from Intergrated DNA Technologies and purified by ion exchange HPLC as previously described (38). Purified strands were platinated with cisplatin at the guanine residues bearing an asterisk, as previously described (38), and undesired products were removed by HPLC. The cisplatin-modified strand, unmodified strand, and the complementary strand were characterized by ion exchange HPLC, S1-nuclease analysis, and flameless Pt atomic absorption spectroscopy.

Electrophoretic Mobility Shift Assays

The single-stranded complement of a strand containing a central TGGA sequence (~10 pmol) was radiolabled at the 5′ end with [γ-32P]ATP by using polynucleotide kinase (PNK). PNK was heat-deactivated and removed by phenol extraction. Radiolabeled oligonucleotide was annealed with cisplatin-modified or unmodified strand in annealing buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1mM MgCl2) by cooling the temperature slowly from 95 °C to 4 °C over 3 hr. Differing amounts of domain A proteins were incubated in a final volume of 15 μL with the annealed probe at a final concentration 0.1 nM in binding buffer (10 mM HEPES pH 7.5, 10 mM MgCl2, 50 mM LiCl, 100 mM NaCl, 0.05% Nonidet P-40) for approximately 30 min on ice. DTT or β-mercaptoethanol was used as a reducing reagent at concentrations varying from 100 μM to 10 mM. After incubating on ice, 1.5 μL of loading buffer (7% sucrose, 0.17% ficoll 400, xylenol cyanol) was added prior to loading onto a 10% native polyacrylamide gel (37.5:1 acrylamide:bisacrylamide). The gel was run at 300 V for 1.33 hr with cooling by cold water in 0.5× TBE, dried at 80 °C for 1 – 2 hr, and visualized on a Storm Phosphorimager (Amersham Bioscience). The dissociation constant Kd, defined

Kd=[P][D][P⋅D] (1)

in eq 1, was computed, where [P], [D], and [P·D] are the concentrations of protein, DNA, and protein-DNA complex, respectively. The fraction of the protein-bound oligonucleotide, θ, was derived from eq (1) as indicated in eq 2. The dissociation constant Kd was approximated as the total protein concentrat

θ=PKd+P (2)

tion at the point in the titration where the fraction of protein-bound DNA is 0.5. The Kd values for the different variants were determined as an average of at least three independent trials.

Hydroxyl Radical Footprinting Assay

Approximately 15 nM of DNA probe containing a radiolabel at the 5′ end of the complementary strand were incubated with the indicated amounts of protein on ice for 30 min – 1 hr in 20 μL of binding buffer with or without added reducing reagent. A 5 μL aliquot of the reaction solution was loaded onto a 10% native polyacrylamide gel and electrophoresis was performed to confirm that most of the labeled DNA was bound to protein. Footprinting was initiated by adding a mixture of 2 μL 100 mM sodium ascorbate, 2 μL 1.5% H2O2, and 2 μL 25 mM/50 mM Fe(II)(NH4)2(SO4)2/EDTA. After 2 min, the reaction was quenched by addition of 10 μL of a 1 M thiourea solution. Proteins and salts were removed by phenol extraction and ethanol precipitation. A pellet containing the cleaved product was dissolved in 8 μL of loading buffer (100% formamide, bromophenol blue) and electrophoresed on a 15% denaturing urea polyacrylamide gel (19:1 acrylamide:bisacrylamide).

RESULTS

Binding Affinity of Wild Type Domain A to Platinated DNA Under Different Redox Conditions

The binding affinity of wild type domain A to DNA containing a cisplatin d(GpG) cross-link was examined under different redox conditions by EMSA. The absence of free thiol in recombinant HMGB1 domain A was confirmed by a Thiostar Assay. The fraction of the reduced form of domain A was less than 1/1000 of total protein. Under non-reducing conditions, the dissociation constant of oxidized domain A bound to the platinated probe was computed to be 7.6 nM. This value did not change significantly when H2O2 was added to the binding buffer, as expected from the Thiostar Assay result. Under reducing conditions, domain A exhibited a greater than 10-fold increase in binding affinity (Kd = 0.72 nM) compared to that observed under non-reducing conditions (Figure 3). There was no significant change in binding affinity with different concentrations of the reducing agent dithiotreitol (DTT) in the range from 0.1 to 10 mM, or when β-mercaptoethanol was used instead of DTT (Figure 4A). HMGB1 domain A has a high binding specificity for cisplatin-modified DNA over unmodified DNA. Under reducing conditions, the Kd value of the unmodified probe is more than 1000-fold greater than that of the cisplatin-modified probe having the same sequence (Figure S1, Supporting Information).

Figure 3.

Figure 3

EMSA analysis of wild type HMGB1 domain A bound to the cisplatin-modified DNA probe under different redox conditions. Variable amounts of protein from 0.25 nM to 25 nM were incubated under non-reducing condition or in the presence of 1 mM DTT with a radiolabeled 25-bp probe containing a central 1,2-intrastrand cross-link (~0.1 nM) (top). The fraction of DNA probe bound to oxidized (open circles) or reduced (closed circles) domain A is plotted as a function of protein concentration and the solid line is the fit of the data to eq 2 (bottom).

Figure 4.

Figure 4

The influence of reducing reagent on the binding of HMGB1 domain A to cisplatin-modified DNA. EMSA assays of 0.1 nM cisplatin-modified DNA probe with (A) wild type domain A in the range from 0.16 nM to 16 nM, incubated with labeled probe in binding buffer without reducing agent (left), in the presence of 5 mM DTT (middle), or with 5 mM β-mercaptoethanol (right). (B) C22S/C44S doubly mutated domain A with the same concentration and redox conditions as in (A). (C) C44S variant of domain A added over the range from 0.28 to 9.2 nM.

Site-Directed Mutagenesis of Cysteine Residues

To examine the role of cysteine residues on the binding of HMGB1 domain A to platinated DNA, assays of singly or doubly mutated recombinant domain A proteins C22A, C44A, C44S, C22A/C44A, and C22S/C44S were carried out. There was no evidence of dimer formation by intermolecular disulfide bond formation involving two singly modified variants on non-reducing SDS-PAGE. Unlike wild type domain A, no variant displayed a significant difference in binding affinity for reducing versus non-reducing conditions (Figures 4B, 4C). This result was expected because these variants are unable to form the intramolecular disulfide bonds. All of these variants exhibited lower binding affinity compared to wild type domain A under reducing conditions (Table 1). Variants with serines replacing cysteines showed slightly higher binding affinity than those having alanines, presumably because of the more conservative nature of the replacement. Singly mutated variants have higher binding affinity than doubly mutated ones. The doubly mutated variant C22A/C44A showed the lowest relative binding affinity, however, compared to that of fully oxidized wild type domain A, its binding affinity is approximately 2-fold higher. The dissociation constant of the C22A variant represented the strongest binding affinity to cisplatin-modified DNA among domain A variants, although approximately 1.5-fold weaker than wild type domain A under reducing conditions. Also, the C22S/C44S doubly mutated variant showed similar binding affinity to the C44S singly mutated variant. These differences in binding affinity indicate that the mutation of each cysteine into a different amino acid slightly decreases the binding interaction between protein and DNA. This effect is not as strong as that of domain A oxidation; presumably the influence of modifying Cys22 is slightly less than that of altering Cys44.

Table 1.

Dissociation Constants of Wild-Type and Variants of Domain A Binding to a 25-bp Double-Stranded DNA Probe Containing a Site-Specific 1,2-d(GpG) Cross-Link as Determined by Electrophoretic Mobility Shift Assaysa

Protein Kd (nM) Kd(WT,red)/Kd
Wild type (red) 0.70 ± 0.10 1
Wild type (ox) 7.58 ± 0.74 0.092
C44S 1.60 ± 0.07 0.44
C22S/C44S 1.65 ± 0.37 0.42
C22A 1.12 ± 0.14 0.63
C44A 2.41 ± 0.31 0.29
C22A/C44A 3.40 ± 0.74 0.21
a

Values are an average of at least three independent experiments.

Hydroxyl Radical Footprinting

The intercalating residue Phe37 is positioned at the start of helix II of domain A and clamped by two guanine bases of the platinum cross-link. Because of this interaction, HMGB1 domain A interacts with the DNA probe mainly downstream of cisplatin lesion. The hydroxyl radical footprinting pattern of HMGB1 extends to the 3′ side of the 1,2-d(GpG) cross-link site, reflecting this asymmetry. The resulting footprint provides a unique signature of HMGB1 domain A binding to platinated DNA that is not observed for the platinated DNA bound to most of other HMG proteins, which display more symmetrical footprinting patterns with respect to the platinated lesion.

The hydroxyl radical footprinting assays of wild type domain A and its variants were carried out in order to investigate possible changes in the protein-DNA interface induced by formation of a disulfide bond or replacement of cysteines in the protein. Analysis of the EMSA patterns from aliquots of DNA-protein mixtures prior to initiating the footprinting reaction chemistry showed that greater than 95% of the DNA probe exists in protein-bound state (Figure S2B, Supporting Information). The hydroxyl radical footprinting patterns of wild type domain A both under non-reducing and reducing conditions are indistinguishable and display the asymmetry of the previous HMGB1 footprint (24). In addition, none of the variants of domain A produced a footprinting pattern different from that of wild type domain A (Figure S2, Supporting Information). In a control study, a mobility shift assay of oxidized domain A incubated with platinated DNA probes in binding buffer was performed in the presence of additional hydrogen peroxide or sodium ascorbate, reagents used to generate the hydroxyl radical (Figure S3. Supporting Information). The results confirmed that these redox active agents do not alter the redox state of the protein significantly during footprinting reactions (Figure 5).

Figure 5.

Figure 5

Footprinting analysis of HMGB1 domain A bound to the cisplatin-modified DNA probe. (A) Single-stranded DNA was radiolabeled at the 5′ end with [γ-32P]ATP and annealed to its complementary strand containing a 1,2-intrastrand d(GpG) cisplatin cross-link. A 15 nM portion of double-stranded probe was incubated without any protein (Lane 1), with ~ 600 nM of fully oxidized wild type domain A under non-reducing conditions (Lane 2), with 1 mM DTT (Lane 3), or C22A/C44A doubly mutated domain A (Lane 4) followed by hydroxyl radical cleavage. (B) Plot of the intensity of each cleaved DNA band from the hydroxyl radical footprinting experiments in A: Lane 1 (black), Lane 2 (blue), Lane 3 (red), and Land 4 (green). All footprinting patterns matched that of a previously reported footprinting pattern of wild type domain A under reducing conditions (25). (C) Plot of the intensity of each cleaved DNA band from the hydroxyl radical footprinting study of oxidized/reduced forms of HMGB1 A domain. The footprinting patterns of DNA probe bound to oxidized and reduced wild type domain are nearly identical.

DISCUSSION

Interaction of Cisplatin-Modified DNA with HMGB1 A Domain in Different Redox States

HMGB1 plays critical roles in many important biological mechanisms, being active not only within the nuclei of cells but also as a cytokine(19, 39, 40). HMGB1 contains two tandem HMG boxes, different in sequence but similar in tertiary structure to one another. Both of them have strong, structure-specific binding preferences for non-linear DNAs including cisplatin-modified DNA, but the nature of the binding interaction of the two domains to DNA bearing 1,2-d(GpG) intrastrand platinum cross-links is completely different because of different intercalating residues. The Phe37 intercalating residue in domain A is positioned at the beginning of the helix II of domain A and, therefore, HMGB1 domain A binds asymmetrically to the platinated lesion. Domain B and other HMG box proteins display symmetrical binding patterns. When full length HMGB1 binds to the cisplatin-modified DNA, it is mainly domain A that interacts with the platinum lesion (24).

Under physiological conditions, HMGB1 can exist in two different redox states, depending upon the presence or absence of a disulfide bond between Cys 22 and Cys 44 in domain A (33). With the use of a precipitation assay using globally platinated DNA, an early study established that the binding affinity of HMGB1 decreases under oxidizing conditions and that the oxidation involves cysteine residue not specifically identified in the protein (36). Our results establish that the interconversion between reduced and oxidized forms of domain A, involving Cys 22 and Cys 44 residues, regulates the binding interaction between HMGB1 and the major cisplatin-DNA adduct, a 1,2-d(GpG) intrastrand cross-link. Mutagenesis experiments involving these Cys residues provide clues about their roles in regulating the DNA binding properties of HMGB1 to cisplatin-modified DNA in the cellular context, as discussed below.

Change of HMGB1 Domain A Conformation Induced by Disulfide Bond Formation and Protein Interaction with DNA

Cys 22 and Cys 44, which can form an intramolecular disulfide bond, are located at the center of the helix I and helix II of HMGB1 domain A, respectively (Figure 2). The X-ray crystal structure of the protein-DNA complex shows that those cysteines are located at the inner side of the interface between two helices and face each other. The distance between the two sulfur atoms in this structure is 4.25 Å, which is approximately twice the length of a disulfide bond (25). This short distance implies that the overall conformation of the complex should not be dramatically altered by disulfide bond formation. The footprinting patterns of oxidized wild type domain A and domain A variants are identical to that of reduced HMGB1 domain A. This result indicates a high degree of conservation of the interactions between the residues in HMGB1 domain A and the DNA probe in the complex, including the critical π-π stacking interaction between the Phe37 side chain and the two platinated guanine bases.

Despite the similarity of the protein-DNA footprints, there is a 10-fold weakening of the binding affinity upon intramolecular disulfide bond formation. One possible explanation for this phenomenon is that the two cysteine residues interact directly with the platinated DNA and that lack of such an interaction in the oxidized form causes a decrease in binding affinity. The distances between the cysteine residues and atoms in the DNA probe, however, are too long for any direct interaction as revealed by the crystal structure of the complex. Another possibility is that formation of a disulfide linkage alters the conformation of domain A, possibly changing the alignment of the first and second helices and preventing formation of the optimal conformation for DNA binding. There are several amino acid residues close to two cysteines that interact both directly and indirectly with the DNA probe (Figure 1). A change of relative positions of these residues with respect to the DNA, induced by disulfide bond formation between the two cysteines, might be expected to destabilize the protein-DNA complex. Previous studies revealed that the higher binding affinity of HMGB1 under reducing conditions is not limited to cisplatin-modified DNA, but is generally applicable to other non-linear DNA probes (34, 35). Thus disulfide bond formation may influence the binding of HMGB1 to other forms of DNA probes in a similar manner. Unlike the case of wild type domain A, the presence of a reducing reagent does not influence the binding affinity of domain A variants to cisplatin-modified DNA probes, which suggests that no other redox chemistry except the breaking of disulfide bond occurs under the conditions used in the present study. Cys22 and Cys44 are conserved in three main HMGB proteins, HMGB1, 2, and 3 (Figure 1), which suggests the disulfide bond formation may play a pivotal role in regulating functions of HMGB proteins as transcription factors.

Influence of Cysteines on Protein Conformation

The variants of domain A do not exhibit redoxdependent changes in binding affinity for platinated DNA, but their interaction with the cisplatinmodified duplex is not as strong as that of the reduced wild type protein. The latter property is presumably a consequence of the lack of stabilizing interactions between the cysteine mercaptomethyl side chains and the neighboring amino acids with the platinated DNA. There is a hydrophobic core at the interface between helix I and helix II, and two cysteines are positioned at the center of the core (Figure 2) (41). It is not uncommon that replacement or modification of cysteines by other residues in a hydrophobic environment decreases the stability and activity of proteins (42-45). Both a previous NMR study of the C22S variant of domain A (46) and the X-ray crystal structure of wild type domain A (25) reveal the side chain of Cys44 to be buried in the hydrophobic core of the protein, whereas that of Cys22 in the unmodified protein and Ser22 in the C22S variant are more exposed to solvent and lie outside of the helix I/helix II interface. The relatively small decrease in binding affinity induced by the replacement of the Cys22 supports this analysis. Because the effect of the mutations on binding affinity is less than that of oxidizing the cysteine residues, we conclude that disruption of hydrophobic interactions between the protein and platinated DNA is less important than formation of a disulfide linkage.

In Vivo Redox Chemistry of HMGB1

HMGB1 is a DNA binding protein that recognizes cisplatin 1,2-intrastrand cross-links with a high preference over unmodified DNA. In vitro repair assays revealed a dramatic reduction in NER efficacy in the presence of excess HMGB1 (29), and binding of HMGB1 might function to increase the anticancer efficacy of cisplatin by shielding the lesions from repair proteins. Unlike studies in vitro, however, attempts to alter the sensitivity of cells to cisplatin by controlling HMGB1 expression levels have not been uniformly successful, with the results depending on conditions and the types of cell lines used in the individual studies.

Disulfide bonds are the most common covalent linkages between protein side chains. Thioldisulfide interconversions can change important properties of proteins, including local/global conformations and metal-binding affinity in a redox-dependent manner and thereby regulate many critical intracellular functions (42, 47, 48). The stability of the disulfide bond under physiological conditions is highly sensitive to the redox potential of the cysteine/cystine redox pair, which is determined by the protein local environment.

HMGB1 domain A has two cysteine residues adjacent to each other in its tertiary structure (Figure 2). The standard redox potential of the intramolecular disulfide bond of domain A is - 237 ± 7 mV (vs. NHE), as determined in an NMR study investigating the redox properties of the protein (37). This value is in normal cellular range of redox potentials as determined by the redox state of the GSH/GSSG couple (49). Therefore, if the redox potential of full-length HMGB1 does not substantially differ from that of domain A, even subtle alterations of intracellular redox potential at different stages in the cell cycle or in different types of the cell (50) will dramatically alter the ratio of oxidized to reduced levels of HMGB1. An increase of the fraction of oxidized HMGB1 will decrease the binding strength of HMGB1 to the platinated lesion and consequently diminish its ability to shield the damaged duplex from excision repair protein. It is therefore conceivable that variations in the redox state of the HMGB1 can explain the controversial results in previous attempts to establish a correlation between expression levels of HMGB1 and cisplatin cytotoxicity.

HMGB Proteins and High Toxicity of Cisplatin Toward Testicular Cancer

Cisplatin is particularly effective against testicular cancer (2). After the structure-specific binding properties of HMG-domain proteins to platinated DNA and the repair-retarding capacity of HMGB1 were reported, HMGB proteins specific to testes were noted as elements that might participate in sensitizing testicular cancer toward cisplatin. Unlike HMGB1, which is expressed universally among mammalian cells, HMGB2, which has a similar sequence and structure as HMGB1, is over-expressed in testis cells (51). An increase in the expression level of HMGB2 by transfection of an HMGB2 cDNA enhanced the cisplatin sensitivity of PC-14 cells (52). Also, previous studies on testis-specific HMG (tsHMG), a murine HMG-domain protein, demonstrated that expression of the protein in the HeLa cells substantially sensitizes them to cisplatin (27).

Recently, HMGB4, a new member of HMGB protein superfamily was discovered (53). HMGB4 is expressed exclusively in testis. Unlike other HMGB proteins, there is a Tyr instead of Cys in position 22 in human HMGB4. Also, this protein does not have the C-terminal acidic tail that decreases the binding affinity of HMGB proteins to DNA (Figure 1). Conserved in HMGB4 are the critical intercalating Phe37 residue and most of the DNA-interacting residues revealed in the crystal of HMGB1 A domain bound to cisplatin-modified DNA. It is possible that HMGB4 will bind and interact with platinated DNA in a similar way as HMGB1, but with a stronger binding interaction that is independent of the redox state of the cells. In particular, we propose based on the findings of the present study that HMGB4 plays an important role in determining the efficacy of cisplatin against testicular cancer. Work is currently in progress to evaluate this hypothesis.

CONCLUSION

In this investigation the influence of a change in the Cys/Cys–Cys redox state on the interaction of the main DNA-binding element of HMGB1 and cisplatin-modified DNA was evaluated by EMSA and DNA footprinting analyses. HMGB1 domain A exhibits notably strong, nanomolar binding affinity for a 1,2-intrastrand d(GpG) cisplatin cross-linked DNA probe. Intramolecular disulfide bond formation between Cys22 and Cys44 decreases the binding affinity by an order of magnitude. This decrease in the binding affinity was proved to arise exclusively from disulfide bond formation. The dissociation constant of domain A variants having one or both of the cysteines replaced by alanine or serine was unaffected by the external redox environment. Compared to the reduced, wild type domain A, the binding affinities of the variants decreased, presumably through disruption of hydrophobic interactions between two helices I and II involved in DNA binding. Hydroxyl radical footprinting patterns of platinated probes bound to domain A under different redox conditions reveal that its overall positioning on the platinated duplex does not change significantly with redox state. Given the results of these binding studies and the structural properties of the domain A/platinated DNA complex, restriction of the relative alignment of helices I and II caused by disulfide bond formation appears to be the major factor affecting the binding affinity.

Supplementary Material

Supporting Info

ACKNOWLEDGEMENT

This work was supported by the National Cancer Institute under Grant CA034992. We thank Drs. Katherine Lovejoy, Yongwon Jung, Guangyu Zhu, and Shanta Dhar for helpful discussions.

Abbreviations

HMGB1

high mobility group box 1

HMG

high mobility group

EMSA

electrophoretic mobility shift assay

NER

nucleotide excision repair

cisplatin

cis-diamminedichloroplatinum(II)

BCA

bicinchoninic acid

DTT

dithiothreitol

EDTA

ethylenediaminetetraacetic acid

FPLC

fast protein liquid chromatography

HPLC

high pressure/performance liquid chromatography

IPTG

isopropyl β-D-1-thiogalactopyranoside

PMSF

phenylmethanesulfonyl fluoride

SDS-PAGE

sodium dodecyl sulfate polyacrylamide gel electrophoresis

Footnotes

SUPPORTING INFORMATION AVAILABLE

Supplemental figures describing EMSA analyses of wild type domain A binding to cisplatin-modified and unmodified probes (Figure S1), footprinting studies of cisplatin-modified probes binding to variants of domain A (Figure S2), and EMSA analyses of cisplatin-modified probe in the presence of various redox reagents (Figure S3). This material is available free of charge via the Internet at http://pubs.acs.org.

REFERENCES

  • 1.Jamieson ER, Lippard SJ. Structure, recognition, and processing of cisplatin-DNA adducts. Chem. Rev. 1999;99:2467–2498. doi: 10.1021/cr980421n. [DOI] [PubMed] [Google Scholar]
  • 2.Bosl GJ, Motzer RJ. Testicular germ-cell cancer. N. Engl. J. Med. 1997;337:242–253. doi: 10.1056/NEJM199707243370406. [DOI] [PubMed] [Google Scholar]
  • 3.Cohen GL, Ledner JA, Bauer WR, Ushay HM, Caravana C, Lippard SJ. Sequence dependent binding of cis-dichlorodiammineplatinum(II) to DNA. J. Am. Chem. Soc. 1980;102:2487–2488. [Google Scholar]
  • 4.Davies MS, Berners-Price SJ, Hambley TW. Rates of platination of -AG- and -GA- containing double-stranded oligonucleotides: effect of chloride concentration. J. Inorg. Biochem. 2000;79:167–172. doi: 10.1016/s0162-0134(99)00180-4. [DOI] [PubMed] [Google Scholar]
  • 5.Shimizu M, Rosenberg B. A similar action to UV-irradiation and a preferential inhibition of DNA synthesis in E. coli by antitumor platinum compounds. J. Antibiot. 1973;26:243–245. doi: 10.7164/antibiotics.26.243. [DOI] [PubMed] [Google Scholar]
  • 6.Harder HC, Smith RG, Leroy AF. Template primer inactivation by cis- and trans-dichlorodiammine platinum for human DNA polymerase α , β , and Rauscher murine leukemia virus reverse transcriptase, as a mechanism of cytotoxicity. Cancer Res. 1976;36:3821–3829. [PubMed] [Google Scholar]
  • 7.Corda Y, Job C, Anin MF, Leng M, Job D. Spectrum of DNA-platinum adduct recognition by prokaryotic and eukaryotic DNA-dependent RNA-polymerases. Biochemistry. 1993;32:8582–8588. doi: 10.1021/bi00084a027. [DOI] [PubMed] [Google Scholar]
  • 8.Mello JA, Lippard SJ, Essigmann JM. DNA-adducts of cis-diamminedichloroplatinum(II) and its trans isomer inhibit RNA-polymerase-II differentially in vivo. Biochemistry. 1995;34:14783–14791. doi: 10.1021/bi00045a020. [DOI] [PubMed] [Google Scholar]
  • 9.Mymryk JS, Zaniewski E, Archer TK. Cisplatin inhibits chromatin remodeling, transcription factor binding, and transcription from the mouse mammary tumor virus promoter in vivo. Proc. Natl. Acad. Sci. U. S. A. 1995;92:2076–2080. doi: 10.1073/pnas.92.6.2076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Siddik ZH. Cisplatin: mode of cytotoxic action and molecular basis of resistance. Oncogene. 2003;22:7265–7279. doi: 10.1038/sj.onc.1206933. [DOI] [PubMed] [Google Scholar]
  • 11.Dempke W, Voigt W, Grothey A, Hill BT, Schmoll HJ. Cisplatin resistance and oncogenes - a review. Anti-Cancer Drugs. 2000;11:225–236. doi: 10.1097/00001813-200004000-00001. [DOI] [PubMed] [Google Scholar]
  • 12.Richon VM, Schulte N, Eastman A. Multiple mechanisms of resistance to cis-diamminedichloroplatinum(II) in murine leukemia-L1210 cells. Cancer Res. 1987;47:2056–2061. [PubMed] [Google Scholar]
  • 13.Lai GM, Ozols RF, Young RC, Hamilton TC. Effect of glutathione on DNA repair in cisplatin-resistant human ovarian cancer cell lines. J. Natl. Cancer Inst. 1989;81:535–539. doi: 10.1093/jnci/81.7.535. [DOI] [PubMed] [Google Scholar]
  • 14.Wong E, Giandomenico CM. Current status of platinum-based antitumor drugs. Chem. Rev. 1999;99:2451–2466. doi: 10.1021/cr980420v. [DOI] [PubMed] [Google Scholar]
  • 15.Shlebak AA, Clark PI, Green JA. Hypersensitivity and cross-reactivity to cisplatin and analogues. Cancer Chemother. Pharmacol. 1995;35:349–351. doi: 10.1007/BF00689458. [DOI] [PubMed] [Google Scholar]
  • 16.Giese K, Cox J, Grosschedl R. The HMG domain of lymphoid enhancer factor 1 bends DNA and facilitates assembly of functional nucleoprotein structures. Cell. 1992;69:185–195. doi: 10.1016/0092-8674(92)90129-z. [DOI] [PubMed] [Google Scholar]
  • 17.Thomas JO, Travers AA. HMG1 and 2, and related ‘architectural’ DNA-binding proteins. Trends Biochem. Sci. 2001;26:167–174. doi: 10.1016/s0968-0004(01)01801-1. [DOI] [PubMed] [Google Scholar]
  • 18.Bianchi ME, Beltrame M, Paonessa G. Specific recognition of cruciform DNA by nuclear protein HMG1. Science. 1989;243:1056–1059. doi: 10.1126/science.2922595. [DOI] [PubMed] [Google Scholar]
  • 19.Thomas JO. HMG1 and 2: architectural DNA-binding proteins. Biochem. Soc. Trans. 2001;29:395–401. doi: 10.1042/bst0290395. [DOI] [PubMed] [Google Scholar]
  • 20.Pil PM, Lippard SJ. Specific binding of chromosomal protein HMG1 to DNA damaged by the anticancer drug cisplatin. Science. 1992;256:234–237. doi: 10.1126/science.1566071. [DOI] [PubMed] [Google Scholar]
  • 21.Fichtinger-Schepman AMJ, van der Veer JL, den Hartog JHJ, Lohman PHM, Reedijk J. Adducts of the antitumor drug cis-diamminedichloroplatinum(II) with DNA: formation, identification, and quantitation. Biochemistry. 1985;24:707–713. doi: 10.1021/bi00324a025. [DOI] [PubMed] [Google Scholar]
  • 22.Eastman A. The formation, isolation and characterization of DNA adducts produced by anticancer platinum complexes. Pharmacol. Ther. 1987;34:155–166. doi: 10.1016/0163-7258(87)90009-x. [DOI] [PubMed] [Google Scholar]
  • 23.Kasparkova J, Delalande O, Stros M, Elizondo-Riojas MA, Vojtiskova M, Kozelka J, Brabec V. Recognition of DNA interstrand cross-link of antitumor cisplatin by HMGB1 protein. Biochemistry. 2003;42:1234–1244. doi: 10.1021/bi026695t. [DOI] [PubMed] [Google Scholar]
  • 24.Jung Y, Lippard SJ. Nature of full-length HMGB1 binding to cisplatin-modified DNA. Biochemistry. 2003;42:2664–2671. doi: 10.1021/bi026972w. [DOI] [PubMed] [Google Scholar]
  • 25.Ohndorf UM, Rould MA, He Q, Pabo CO, Lippard SJ. Basis for recognition of cisplatin-modified DNA by high-mobility-group proteins. Nature. 1999;399:708–712. doi: 10.1038/21460. [DOI] [PubMed] [Google Scholar]
  • 26.He Q, Liang CH, Lippard SJ. Steroid hormones induce HMG1 overexpression and sensitize breast cancer cells to cisplatin and carboplatin. Proc. Natl. Acad. Sci. U. S. A. 2000;97:5768–5772. doi: 10.1073/pnas.100108697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zamble DB, Mikata Y, Eng CH, Sandman KE, Lippard SJ. Testis-specific HMG-domain protein alters the responses of cells to cisplatin. J. Inorg. Biochem. 2002;91:451–462. doi: 10.1016/s0162-0134(02)00472-5. [DOI] [PubMed] [Google Scholar]
  • 28.Brown SJ, Kellett PJ, Lippard SJ. Ixr1, a yeast protein that binds to platinated DNA and confers sensitivity to cisplatin. Science. 1993;261:603–605. doi: 10.1126/science.8342024. [DOI] [PubMed] [Google Scholar]
  • 29.Huang JC, Zamble DB, Reardon JT, Lippard SJ, Sancar A. HMG-domain proteins specifically inhibit the repair of the major DNA adduct of the anticancer drug cisplatin by human excision nuclease. Proc. Natl. Acad. Sci. U. S. A. 1994;91:10394–10398. doi: 10.1073/pnas.91.22.10394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ugrinova I, Zlateva S, Pashev IG, Pasheva EA. Native HMGB1 protein inhibits repair of cisplatin-damaged nucleosomes in vitro. Int. J. Biochem. Cell Biol. 2009;41:1556–1562. doi: 10.1016/j.biocel.2009.01.010. [DOI] [PubMed] [Google Scholar]
  • 31.Zamble DB, Mu D, Reardon JT, Sancar A, Lippard SJ. Repair of cisplatin-DNA adducts by the mammalian excision nuclease. Biochemistry. 1996;35:10004–10013. doi: 10.1021/bi960453+. [DOI] [PubMed] [Google Scholar]
  • 32.Wei M, Burenkova O, Lippard SJ. Cisplatin sensitivity in Hmgb1−/− and Hmgb1+/+ mouse cells. J. Biol. Chem. 2003;278:1769–1773. doi: 10.1074/jbc.M210562200. [DOI] [PubMed] [Google Scholar]
  • 33.Hoppe G, Talcott KE, Bhattacharya SK, Crabb JW, Sears JE. Molecular basis for the redox control of nuclear transport of the structural chromatin protein Hmgb1. Exp. Cell Res. 2006;312:3526–3538. doi: 10.1016/j.yexcr.2006.07.020. [DOI] [PubMed] [Google Scholar]
  • 34.Sheflin LG, Fucile NW, Spaulding SW. The specific interactions of HMG 1 and HMG 2 with negatively supercoiled DNA are modulated by their acidic C-terminal domains and involve cysteine residues in their HMG 1/2 Boxes. Biochemistry. 1993;32:3238–3248. doi: 10.1021/bi00064a005. [DOI] [PubMed] [Google Scholar]
  • 35.Urbonaviciute V, Meister S, Fürnrohr BG, Frey B, Gückel E, Schett G, Herrmann M, Voll RE. Oxidation of the alarmin high-mobility group box 1 protein (HMGB1) during apoptosis. Autoimmunity. 2009;42:305–307. doi: 10.1080/08916930902831803. [DOI] [PubMed] [Google Scholar]
  • 36.Billings PC, Davis RJ, Engelsberg BN, Skov KA, Hughes EN. Characterization of High Mobility Group Protein binding to cisplatin-damaged DNA. Biochem. Biophys. Res. Commun. 1992;188:1286–1294. doi: 10.1016/0006-291x(92)91371-v. [DOI] [PubMed] [Google Scholar]
  • 37.Sahu D, Debnath P, Takayama Y, Iwahara J. Redox properties of the A-domain of the HMGB1 protein. FEBS Lett. 2008;582:3973–3978. doi: 10.1016/j.febslet.2008.09.061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Dunham SU, Lippard SJ. DNA sequence context and protein composition modulate HMG-domain protein recognition of cisplatin-modified DNA. Biochemistry. 1997;36:11428–11436. doi: 10.1021/bi9709452. [DOI] [PubMed] [Google Scholar]
  • 39.Bianchi ME, Manfredi AA. High-mobility group box 1 (HMGB1) protein at the crossroads between innate and adaptive immunity. Immunol. Rev. 2007;220:35–46. doi: 10.1111/j.1600-065X.2007.00574.x. [DOI] [PubMed] [Google Scholar]
  • 40.Scaffidi P, Misteli T, Bianchi ME. Release of chromatin protein HMGB1 by necrotic cells triggers inflammation. Nature. 2002;418:191–195. doi: 10.1038/nature00858. [DOI] [PubMed] [Google Scholar]
  • 41.He Q, Ohndorf UM, Lippard SJ. Intercalating residues determine the mode of HMG1 domains A and B binding to cisplatin-modified DNA. Biochemistry. 2000;39:14426–14435. doi: 10.1021/bi001700j. [DOI] [PubMed] [Google Scholar]
  • 42.Tammam SD, Rochet JC, Fraser ME. Identification of the cysteine residue exposed by the conformational change in pig heart succinyl-CoA : 3-ketoacid coenzyme A transferase on binding coenzyme A. Biochemistry. 2007;46:10852–10863. doi: 10.1021/bi700828h. [DOI] [PubMed] [Google Scholar]
  • 43.Schuman B, Persson M, Landry RC, Polakowski R, Weadge JT, Seto NOL, Borisova SN, Palcic MM, Evans SV. Cysteine-to-serine mutants dramatically reorder the active site of human ABO(H) blood group B glycosyltransferase without affecting activity: structural insights into cooperative substrate binding. J. Mol. Biol. 2010;402:399–411. doi: 10.1016/j.jmb.2010.07.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Jaiswal R, Panda D. Cysteine 155 plays an important role in the assembly of Mycobacterium tuberculosis FtsZ. Protein Science. 2008;17:846–854. doi: 10.1110/ps.083452008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Greaves J, Prescott GR, Fukata Y, Fukata M, Salaun C, Chamberlain LH. The hydrophobic cysteine-rich domain of SNAP25 couples with downstream residues to mediate membrane interactions and recognition by DHHC palmitoyl transferases. Mol. Biol. Cell. 2009;20:1845–1854. doi: 10.1091/mbc.E08-09-0944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hardman CH, Broadhurst RW, Raine ARC, Grasser KD, Thomas JO, Laue ED. Structure of the A-domain of HMG1 and its interaction with DNA as studied by heteronuclear three- and four-dimensional NMR spectroscopy. Biochemistry. 1995;34:16596–16607. doi: 10.1021/bi00051a007. [DOI] [PubMed] [Google Scholar]
  • 47.Hogg PJ. Disulfide bonds as switches for protein function. Trends Biochem. Sci. 2003;28:210–214. doi: 10.1016/S0968-0004(03)00057-4. [DOI] [PubMed] [Google Scholar]
  • 48.Maret W. Oxidative metal release from metallothionein via zinc-thiol/disulfide interchange. Proc. Natl. Acad. Sci. U. S. A. 1994;91:237–241. doi: 10.1073/pnas.91.1.237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Schafer FQ, Buettner GR. Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple. Free Radic. Biol. Med. 2001;30:1191–1212. doi: 10.1016/s0891-5849(01)00480-4. [DOI] [PubMed] [Google Scholar]
  • 50.Menon SG, Goswami PC. A redox cycle within the cell cycle: ring in the old with the new. Oncogene. 2007;26:1101–1109. doi: 10.1038/sj.onc.1209895. [DOI] [PubMed] [Google Scholar]
  • 51.Seyedin SM, Kistler WS. Levels of chromosomal protein high mobility group 2 parallel the proliferative activity of testis, skeletal muscle, and other organs. J. Biol. Chem. 1979;254:11264–11271. [PubMed] [Google Scholar]
  • 52.Arioka H, Nishio K, Ishida T, Fukumoto H, Fukuoka K, Nomoto T, Kurokawa H, Yokote H, Abe S, Saijo N. Enhancement of cisplatin sensitivity in high mobility group 2 cDNA-transfected human lung cancer cells. Jpn. J. Cancer Res. 1999;90:108–115. doi: 10.1111/j.1349-7006.1999.tb00673.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Catena R, Escoffier E, Caron C, Khochbin S, Martianov I, Davidson I. HMGB4, a novel member of the HMGB family, is preferentially expressed in the mouse testis and localizes to the basal pole of elongating spermatids. Biol. Reprod. 2009;80:358–366. doi: 10.1095/biolreprod.108.070243. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Info

RESOURCES