A Novel Gene Cassette, aacA43, in a Plasmid-Borne Class 1 Integron

Abstract

A novel gene cassette, aacA43, was identified in the aadB-aacA43-oxa10-smr2 cassette array in a class 1 integron. Like related aminoglycoside-(6′)-acetyltransferases, AacA43 confers clinically relevant resistance to kanamycin, tobramycin, and some less-used aminoglycosides but not to gentamicin. Although transferable on an IncL/M plasmid, aacA43 was identified in only two different Klebsiella pneumoniae strains (14 isolates), one Escherichia coli strain (2 isolates), and one Enterobacter cloacae strain in a survey of patients in a Sydney intensive care unit in 2004-2005.

TEXT

Aminoglycoside resistance in Gram-negative bacteria is often due to aminoglycoside modification by N-acetyltransferases (encoded by aac genes), O-adenylyltransferases (aad genes, also known as nucleotidyltransferase genes; ant), and O-phosphotransferases (aph genes). These enzymes are further divisible on the basis of the aminoglycoside modification site (e.g., 3′, 6′, and 3′′) and the resistance phenotype conferred (Roman numeral). For example, AAC(6′)-I enzymes acetylate amikacin but not gentamicin, while AAC(6′)-II enzymes acetylate gentamicin but not amikacin (16). Different genes within each class are then distinguished by lowercase letters. However, closely related genes may confer different phenotypes, and newly identified genes may be named only on the basis of homology to known aminoglycoside resistance genes. A simpler nomenclature system, where aacA is equivalent to aac(6′) and aacC to aac(3) but the phenotype conferred is not indicated, is also used.

Over 40 different (<98% identical) aminoglycoside-modifying enzymes are encoded by genes found as part of gene cassettes (13). These small mobile genetic elements consist of a single gene (occasionally two) associated with an attC recombination site and are usually found inserted in integrons. Genes encoding AAC enzymes are the genes most frequently found in clinical isolates (9), and around half of the cassette-borne aminoglycoside resistance genes reported are of the aacA type.

Two clinical isolates of Klebsiella pneumoniae (LT12 isolated in July 2003, SSI2.46 in August 2004) from different patients in the intensive care unit (ICU) of Westmead Hospital, Sydney, Australia, were identified as resistant to gentamicin and tobramycin during a survey of local Enterobacteriaceae resistant to aminoglycosides. Susceptibility profiles to other antibiotics differed slightly (Table 1), and enterobacterial repetitive intergenic consensus (ERIC) PCR (20) (data not shown) indicated no relationship.

Table 1.

Susceptibility profiles of clinical isolates, transconjugants, and transformants carrying aacA43^a

Antibiotic	MIC (μg/ml)
	LT12	LT12 Tx	SSI2.46	SSI2.46 Tx	DH5α(pJILT1) (lacZ)	DH5α(pJILT2) (T7)	DH5α(pGEM-T)	DH5α
Amikacin	16	32	8	64	4	2	0.5	0.5
Gentamicin	32	32	16	64	<0.25	<0.25	<0.25	<0.25
Tobramycin	128	>128	64	>128	8	4	<0.25	<0.25
Apramycin	2				1	1	1	1
Kanamycin	>128				64	8	0.5	0.5
Netilmicin	64				16	8	<0.25	<0.25
Sisomicin	32				4	4	<0.25	<0.25
Streptomycin	2				1	1	1	1
Cephalothin	>16	>16	>16	>16
Cefoxitin	≤4	≤4	>16	8
Cefotaxime	≤2	≤2	≤2	≤2
Ceftazidime	≤0.5	≤0.5	≤0.5	≤0.5
Ampicillin	>16	>16	>16	>16
Amoxicillin/clavulanate	>16/8	>16/8	>16/8	16/8
Ticarcillin/clavulanate	>64/2	>64/2	>64/2	>64/2
Imipenem	≤1	≤1	4	≤1
Aztreonam	≤1	≤1	≤1	≤1
Ciprofloxacin	≤0.5	≤0.5	≤0.5	≤0.5
Trimethoprim/ sulfomethoxazole	>2/38	>2/38	>2/38	≤0.5/9.5

^aAll aminoglycoside MICs were measured in triplicate by broth microdilution in accordance with CLSI guidelines (11). Variation between replicates did not exceed a single 2-fold dilution. MICs of other antibiotics were derived by Phoenix NMIC/ID-101 (Becton Dickinson, Sparks, MD). Tx, transconjugants.

A multiplex PCR for detection of class 1, 2, and 3 integron integrase genes (3) identified intI1 only in both isolates. A 2.8-kb cassette array PCR amplicon (Table 2) was obtained from both isolates. The array from LT12 was sequenced, and the aadB, bla_OXA-10, and smr2 gene cassettes were identified (100% sequence identity to the GenBank entries under accession no. L06418, U37105, and AY260546, respectively), along with a previously unknown cassette between aadB and bla_OXA-10, with an attC site of 100 bp.

Table 2.

Primers used for PCR

Primer	Sequence (5′–3′)	Purpose	Source or reference
hep58	TCATGGCTTGTTATGACTGT	Amplification of cassette arrays in class 1 integrons	22
hep59	GTAGGGCTTATTATGCACGC
aac6in-F	ACTCAGGTGTTAGCCAGAC	Amplification of aacA43 and RBS for cloning	This work
aac6in-R	CGTAAGCAAGAACCGTGAC
pUC/M13-F	GTTTTCCCAGTCACGAC	Checking orientation/size of cloned inserts	Promega
pUC/M13-R	CAGGAAACAGCTATGAC
aac6LT-F	ACAAGGAAGACGCTGCAC	Internal aacA43 primers for screening	This work
aac6LT-R	CCACATCCAAATGTCAGGTT

This cassette contains a 564-bp open reading frame, an ATG start codon with a putative ribosome binding site (RBS; GAGGA) 6 bp upstream, and the predicted 187 amino acid protein is most closely related to several cassette-encoded AacA enzymes. All known aacA gene cassettes were listed in a recent review (13), but the sequences of aac(6′)-Iaf (GenBank accession no. AB462903) (8) and aac(6′)-33 (GenBank accession no. GQ337064) (21) have since become available. In accordance with the nomenclature suggested in this review, and using the next available numbers, aac(6′)-Iaf and aac(6′)-33 have been designated aacA41 and aacA42, respectively, and the cassette identified here has been designated aacA43.

aacA genes, including those designated both aac(6′)-I and aac(6)-II, can be divided into three subgroups on the basis of predicted protein sequences (6, 16, 18). AacA43 belongs to a subgroup including AAC(6′)-Ii, encoded by a chromosomal gene of Enterococcus faecium (2), and the cassette-encoded enzymes AacA1 [AAC(6′)-Ia], AacA16 [AAC(6′)-1p, also called AAC(6′)-Im or AAC(6′)-1l] (6), AacA17 [AAC(6′)-1q] (1), AacA28 [AAC(6′)-Iae] (15), and AacA41 [AAC(6′)-Iaf] (8). BLAST searches identified two additional cassette-encoded enzymes, AacA30 [AAC(6′)-I30; GenBank accession no. AY289608] (10) and AacA39 [AAC(6′)-Iai; GenBank accession no. EU886977], that also appear to be part of this subgroup.

Sequence analysis of all 10 enzymes in this subgroup (Fig. 1) reveals several sets of closely related proteins, while AacA1, AacA43, and AAC(6′)-Ii are less closely related to the others. The aacA16, aacA17, and aacA41 genes are >95% identical, and the associated attC sites are also closely related (Fig. 2), suggesting that these cassettes are derived from a common ancestor (14). Similarly, the aacA30 and aacA42 cassettes include genes that are 93% identical and closely related attC sites. The aacA28 and aacA39 genes are less closely related (84% identical), and their attC sites are of quite different lengths, although their core site regions are almost identical. The aacA1 and aacA43 genes are not closely related to any other aacA genes, and aacA1 has previously been found only in a cassette that also includes gcuG (orfG). BLASTn searches revealed some similarity between the aacA1-gcuG and aacA39 attC sites (Fig. 2), but the aacA43 attC site is not related to any other known attC site.

Fig. 1.

(A) Phylogenetic tree showing relationships between members of the AAC-(6′)-Ia (AacA1) subfamily generated using MegAlign (Lasergene; DNAStar) and the Clustal W method. (B) Amino acid sequence alignment of gene cassette-encoded proteins of the AacA1 subfamily generated using MegAlign and BioEdit (5). The sequences were obtained from the GenBank entries under the following accession numbers: AacA1, AF047479; AacA16 [AAC(6′)-Ip], Z54241; AacA17 [AAC(6′)-Iq], AF047556; AacA28 [AAC(6′)-Iae], AB104852; AacA30 [AAC(6′)-I30], AY289608; AacA39 [AAC(6′)-Iai], EU886977; AacA41, [AAC(6′)-Iaf], AB462903; AacA42 [AAC(6′)-33], GQ337064; AAC(6′)-Ii, L12710; and AacA43, this work. The AacA16 sequence used in alignments in the original paper (6) and the most recent alignment of this subgroup (8) starts at an ATG codon giving a sequence that is shorter than other proteins in this subgroup. A TTG start codon with a potential RBS upstream that corresponds to the ATG start codon of other proteins in this group and to the TTG start codons proposed for AacA17 (1) and demonstrated for AacA41 (8) was used here. GCN5-related N-acetyltransferase (GNAT) motifs C, D, A, and B (4, 12) are indicated.

Fig. 2.

Relationships between attC sites of gene cassettes in the aacA1 subgroup. Similar attC sequences are grouped, and nucleotides that differ between closely related sequences are shaded in gray. Core sites are underlined. The aacA1 gene has been found only as part of a fused cassette that also includes gcuG (orfG) but only one attC site. Sequences were obtained from the GenBank entries listed in the legend to Fig. 1.

The AAC(6′)-I group of acetyltransferases were originally defined by their ability to confer resistance to aminoglycosides including amikacin, tobramycin, dibekacin, netilmicin, and sisomicin (16). Cloned copies of aacA1 (17), aacA16 (6), aacA17 (1), aacA28 (15), aacA41 (8), and aac(6′)-Ii (2) all gave consistent resistance patterns. A cloned copy of the oxa53-aacA30 array also gave the expected phenotype (10), while that conferred by aacA42 alone has not been reported and only the sequence of aacA39 is currently available. As the aadB cassette preceding aacA43 confers resistance to gentamicin, tobramycin, and kanamycin, a PCR-amplified fragment (Table 2) containing the aacA43 gene and the proposed RBS was cloned into pGEM-T Easy (Promega, Madison, WI). Transformants in Escherichia coli DH5α selected on nutrient agar containing ampicillin (100 μg/ml), X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside; 40 μg/ml), and IPTG (isopropyl-β-d-thiogalactopyranoside; 250 μg/ml) were confirmed to carry aacA43 under the control of the P_lac (pJILT1) or T7 (pJILT2) promoter by PCR (Table 2) and sequencing. Cloned aacA43 conferred increased resistance to kanamycin, tobramycin, amikacin, and sisomycin (Table 1), consistent with the aac(6′)-I profile, the most significant being the kanamycin and tobramycin phenotypes.

Transconjugants (Tx) obtained by filter mating (19) of either LT12 or SSI2.46 with E. coli DH5αRf (23) and selection on gentamicin (10 μg/ml) and rifampin (80 μg/ml) contained the aadB-aacA43-oxa10-smr2 array and an IncL/M plasmid replicon only by PCR-based replicon typing (7). PCR screening (Table 2) of E. coli (n = 38) and Klebsiella/Enterobacter (n = 106) isolates obtained from perineal swabs or endotracheal aspirates from Westmead ICU patients from April 2004 to July 2005 and resistant to ticarcillin-clavulanic acid and/or gentamicin identified aacA43 in 12 additional K. pneumoniae strains, 1 E. cloacae strain, and 2 E. coli strains collected from June to November 2004. The 2 E. coli isolates appeared the same by ERIC PCR, and all 12 K. pneumoniae isolates were indistinguishable from SSI2.46 (data not shown). All 15 isolates yielded a cassette array PCR amplicon consistent with the aadB-aacA43-oxa10-smr2 array. An IncL/M plasmid replicon was detected in all isolates, with an additional IncFIB replicon in the E. coli isolates only. Gentamicin was the most widely prescribed aminoglycoside in this ICU during this period and has remained so since, tobramycin and amikacin being rarely employed. Although the sample set is imperfect, these results suggest limited spread of an IncL/M plasmid with aadB-aacA43-oxa10-smr2, mostly in a single K. pneumoniae strain.

Nucleotide sequence accession number.

The nucleotide sequence of the cassette array containing the aacA43 gene cassette from LT12 has been submitted to GenBank under accession no. HQ247816.