Skip to main content
NCBI home page
Infection and Immunity logoLink to Infection and Immunity
. 2011 Jun;79(6):2356–2361. doi: 10.1128/IAI.01349-10

Tryptophan Prototrophy Contributes to Francisella tularensis Evasion of Gamma Interferon-Mediated Host Defense ▿ †

Ping Chu 1, Annette R Rodriguez 1, Bernard P Arulanandam 1, Karl E Klose 1,*
Editor: A J Bäumler
PMCID: PMC3125836  PMID: 21464086

Abstract

Francisella tularensis is able to survive and replicate within host macrophages, a trait that is associated with the high virulence of this bacterium. The trpAB genes encode the enzymes required for the final two steps in tryptophan biosynthesis, with TrpB being responsible for the conversion of indole to tryptophan. Consistent with this function, an F. tularensis subsp. novicida trpB mutant is unable to grow in defined medium in the absence of tryptophan. The trpB mutant is also attenuated for virulence in a mouse pulmonary model of tularemia. However, the trpB mutant remains virulent in gamma interferon receptor-deficient (IFN-γR−/−) mice, demonstrating that IFN-γ-mediated signaling contributes to clearance of the trpB mutant. IFN-γ limits intracellular survival of the trpB mutant within bone marrow-derived macrophages from wild-type but not IFN-γR−/− mice. An F. tularensis subsp. tularensis trpB mutant is also attenuated for virulence in mice and survival within IFN-γ-treated macrophages, indicating that tryptophan prototrophy is also important in a human-virulent F. tularensis subspecies. These results demonstrate that trpB contributes to F. tularensis virulence by enabling intracellular growth under IFN-γ-mediated tryptophan limitation.

INTRODUCTION

Francisella tularensis is a facultative intracellular bacterium that is the causative agent of tularemia. F. tularensis can be acquired by various routes, but inhalation of the bacteria leads to a pulmonary form of the disease which has a high mortality rate, and thus, this organism is considered a potential biological weapon. Different subspecies of F. tularensis exhibit differing levels of virulence in humans, with F. tularensis subsp. tularensis causing the most severe disease and F. tularensis subsp. novicida being avirulent in healthy humans. However, genome analysis has shown that F. tularensis subsp. tularensis and F. tularensis subsp. novicida are closely related (7), and both subspecies are highly virulent in mouse models of tularemia.

When F. tularensis is phagocytosed by host macrophages, it escapes from the phagosome and replicates within the macrophage cytosol to high numbers (8, 15). When inhaled into the lung, the bacteria disseminate to liver, spleen, and other internal organs and cause systemic disease. A number of genes have been identified that contribute to the virulence of F. tularensis (29). The genes clustered within the Francisella pathogenicity island, encoding a secretion system, are essential for phagosome escape and virulence (3, 17, 27). Additional metabolic genes that contribute to F. tularensis virulence include purine biosynthetic (28, 33) and glutathione utilization genes (1); absence of these genes leads to F. tularensis growth defects within macrophages and other host cells.

Gamma interferon (IFN-γ) activates macrophages to increase killing of intracellular bacteria by a number of mechanisms, including the induction of reactive oxygen species (ROS) and reactive nitrogen species (RNS), which are delivered to the bacteria-containing phagosome (16). IFN-γ is known to be an important component of host defense against F. tularensis, and it has been shown to limit the growth of F. tularensis within macrophages (10). While mice deficient in the production of ROS and RNS are more sensitive to F. tularensis infection (23), IFN-γ-treatment of macrophages does not affect the kinetics of F. tularensis phagosome escape and cytosolic bacterial replication is restricted independent of ROS- and RNS-dependent mechanisms (9), suggesting that other IFN-γ-dependent mechanism(s) contribute to limiting cytosolic bacterial replication.

IFN-γ is also known to deplete intracellular tryptophan pools through induction of the tryptophan-degrading enzyme indoleamine 2,3-dioxygenase (IDO) (4), which has been shown to limit intracellular Chlamydia growth. F. tularensis contains genes for tryptophan biosynthesis (18), including trpAB, which encode the enzymes that catalyze the last two steps in tryptophan biosynthesis. TrpA catalyzes the cleavage of indole glycerol 3-phosphate (IGP) to indole, and TrpB then catalyzes the conversion of indole to tryptophan; TrpA and TrpB typically form a tryptophan synthase tetramer with two subunits of each (26).

Because IFN-γ limits cytosolic F. tularensis replication in host cells and is also known to deplete intracellular tryptophan, we investigated whether tryptophan prototrophy contributes to the virulence of F. tularensis. We found that a trpB F. tularensis strain is attenuated for virulence in wild-type (wt) but not IFN-γ receptor-deficient (IFN-γR−/−) mice and that IFN-γ inhibits the survival of the trpB mutant within macrophages, consistent with tryptophan prototrophy contributing to the ability of F. tularensis to replicate within activated macrophages. Our results are consistent with and extend the recent findings of Peng and Monack (30), who demonstrated the involvement of the tryptophan-degrading enzyme IDO in innate lung defense against F. tularensis.

MATERIALS AND METHODS

Strains and media.

The F. tularensis subsp. novicida strains are isogenic with strain U112, and the F. tularensis subsp. tularensis strain is isogenic with strain SchuhS4. The trpA::Tn and trpB::Tn F. tularensis subsp. novicida strains (tnfn1_pw060328p03q156 and tnfn1_pw060510p03q105) were obtained from the comprehensive F. tularensis subsp. novicida transposon library (14) (www.beiresources.org/). The sites of the Tn insertions in the trpA::Tn and trpB::Tn F. tularensis subsp. novicida strains were confirmed by sequencing to be immediately downstream of nucleotide 308 and nucleotide 363 in the coding sequences of trpA and trpB, respectively. These strains were used in all the experiments described below. A second trpA::Tn F. tularensis subsp. novicida strain (tnfn1_pw060419p03q109; the trpA2 strain) available in the library was determined to have a Tn insertion immediately downstream of nucleotide 510 in the trpA coding sequence, rather than downstream of nucleotide 521, as annotated. This strain was used to confirm the Trp prototrophy phenotype of a trpA strain when grown in Chamberlain's medium (see Fig. S1 in the supplemental material). Construction of the F. tularensis subsp. tularensis mutant strain KKT43 (trpB::ltrB) was performed as previously described (31), with primers designed to allow integration between nucleotides 55 and 56 of the trpB gene, as follows: IBS1/2, AAAACTCGAGATAATTATCCTTACTGGGCCAAGTAGTGCGCCCAGATAGGGTG; EBS1/delta, CAGATTGTACAAATGTGGTGATAACAGATAAGTCCAAGTATTTAACTTACCTTTCTTTGT; and EBS2, TGAACGCAAGTTTCTAATTTCGGTTCCCAGTCGATAGAGGAAAGTGTCT. The plasmid used to complement the trpB strain was constructed by PCR amplification of the trpB gene with primers trpBDnNdeI, GCGCCATATGCCAGTTTGGTAGTCTAAAGCC, and trpBUpNotI, GGATCCGCGGCCGCCTATTTGTCATTAAATCTCTCCC, followed by digestion with NdeI and NotI and ligation into the F. tularensis plasmid pKEK1327 to form pKEK1483. Strains were grown on TSAP broth/agar (24) or Chamberlain's medium (6) supplemented with 40 μg/ml tryptophan, as appropriate.

Intracellular survival.

Bone marrow-derived macrophages (BMM) were prepared from 4-week-old C57BL/6 (wt) or IFN-γR−/− mice as previously described (5). BMM were seeded into 96-well culture plates at a density of 2 × 105 cells per well in 0.2 ml of Dulbecco's modified Eagle's medium (DMEM) plus 10% fetal bovine serum (D-10) 4 h before being infected with 2 × 106 F. tularensis subsp. novicida or F. tularensis subsp. tularensis cells. The plates were incubated for 2 h, washed with DMEM, and then incubated with D-10 containing gentamicin (20 μg/ml) for 1 h to kill any remaining extracellular bacteria. Macrophages were washed with fresh medium and a sample was collected at the 3-h time point; the medium was then replaced with D-10, and additional samples were collected at 24 and 48 h. In IFN-γ activation assay experiments, BMM were seeded at a concentration of 2 × 105 cells and treated with 1 ng/ml of recombinant IFN-γ (rIFN-γ) (eBioscience) for 2 h prior to infection, followed by infection with a multiplicity of infection (MOI) of 10 of bacteria as described above, with IFN-γ present throughout the experiment. Infected BMM were lysed by the addition of 0.2 ml 0.2% deoxycholate in phosphate-buffered saline (PBS), and intracellular bacteria were enumerated by dilution and plate count. Intracellular growth in the J774 macrophage cell line was assayed as previously described (19).

Mouse virulence assays.

Groups of five female C57BL/6 (wt) or IFN-γR−/− mice were inoculated intranasally with F. tularensis subsp. novicida or F. tularensis subsp. tularensis strains in 20 μl PBS (20). The actual bacterial numbers delivered were determined by plate count from the inocula, and an approximate 50% lethal dose (LD50) was determined from the surviving mice. Mice were monitored for survival and weight gain/loss for 30 days after infection. All animal experiments were approved by the University of Texas San Antonio (UTSA) IACUC and carried out in accordance with AAALAC guidelines.

RESULTS

A trpB mutant of F. tularensis subsp. novicida is a tryptophan auxotroph.

The trpBA locus of F. tularensis (FTN_1739/FTT1773 and FTN_1740/FTT1772) encodes proteins with high homology to the TrpB and TrpA proteins from multiple bacteria. TrpA and TrpB are responsible for the last two enzymatic reactions required for tryptophan synthesis: TrpA catalyzes the cleavage of indole glycerol 3-phosphate (IGP) to indole, and TrpB then catalyzes the conversion of indole to tryptophan (26). Because TrpB is required for the final step in tryptophan synthesis, a trpB mutant is predicted to be a tryptophan auxotroph. The wild-type (wt), trpA, and trpB F. tularensis subsp. novicida strains were inoculated into defined medium (Chamberlin's) either without or with added tryptophan and monitored for growth (Fig. 1). The wt and trpA F. tularensis subsp. novicida strains were able to grow both in the absence and presence of tryptophan, whereas the trpB F. tularensis subsp. novicida strain was unable to grow in the absence of tryptophan but grew readily in the presence of tryptophan. The tryptophan auxotrophy phenotype of the trpB mutant confirms the essential role of TrpB in tryptophan biosynthesis in F. tularensis. Complementation of the trpB mutant with a plasmid expressing trpB restored growth in the absence of added tryptophan, confirming that the lack of trpB is the cause of tryptophan auxotrophy in this strain (see Fig. S1 in the supplemental material). An additional trpA F. tularensis subsp. novicida mutant with a different Tn insertion site (the trpA2 strain; see Materials and Methods) was also confirmed to grow in Chamberlain's medium in the absence of added tryptophan, thus demonstrating that only TrpB and not TrpA is required for tryptophan prototrophy. This suggests that F. tularensis may have an alternate pathway for indole synthesis.

Fig. 1.

Fig. 1.

Open in a new tab

The trpB F. tularensis subsp. novicida (Ftn) mutant is a tryptophan auxotroph. The wt, trpA, and trpB F. tularensis subsp. novicida strains were inoculated into Chamberlin's medium without (−) or with (+) 40 μg/ml tryptophan.

A trpB mutant of F. tularensis subsp. novicida is attenuated for virulence in wild-type but not IFN-γR−/− mice.

To evaluate the role that tryptophan prototrophy plays in F. tularensis virulence, the wt, trpA, and trpB F. tularensis subsp. novicida strains were inoculated into wild-type C57BL/6 mice via the intranasal route in inocula of ∼10 CFU. Mice were evaluated for weight loss and mortality (Fig. 2, left panels). The wt F. tularensis subsp. novicida strain caused 100% mortality in all inoculated mice by 7 days postinfection. In contrast, the majority (80%) of the mice inoculated with the trpB strain survived infection with no weight loss, similar to the mock-vaccinated mice. Similar to the wt strain, the trpA mutant strain caused a lethal infection in the majority (80%) of inoculated mice, with only a slight delay in time to death. The single surviving mouse from trpA infection experienced weight loss but regained weight, being similar to the mock-infected mice by 15 days postinfection. We obtained similar results when we infected BALB/c mice with the same strains by the same route at a slightly higher dose (data not shown).

Fig. 2.

Fig. 2.

Open in a new tab

The trpB F. tularensis subsp. novicida mutant is attenuated for virulence in wt but not IFN-γR−/− mice. Groups of C57BL/6 wild-type (left panels) and IFN-γR−/− (right panels) mice (5 mice/group) were inoculated intranasally with ∼10 CFU wt, trpA, or trpB F. tularensis subsp. novicida cells in PBS or mock inoculated (PBS). The inocula were also quantitated by plate count (wt, 9 CFU; trpA strain, 17 CFU; and trpB strain, 12 CFU). Mice were monitored daily for survival (top panels) and weight loss (bottom panels). The differences in survival between C57BL/6 mice inoculated with trpB F. tularensis subsp. novicida and with wt or trpA F. tularensis subsp. novicida were significant at P values of <0.05 (Kaplan-Meier).

IFN-γ-mediated signaling has been shown to inhibit the growth of Chlamydia spp. trp mutants by reducing available tryptophan within cells (4). In order to determine whether IFN-γ signaling likewise contributes to the attenuated virulence of the F. tularensis subsp. novicida trpB mutant, we also infected mice lacking the IFN-γ receptor (C57BL/6 IFN-γR−/−) with the wt, trpA, and trpB F. tularensis subsp. novicida strains via the intranasal route at the same time and with the same inocula used to infect the wild-type C57BL/6 mice (Fig. 2, right panels). The trpB F. tularensis subsp. novicida mutant exhibited no attenuated virulence in IFN-γR−/− mice, with 100% mortality of mice infected with this strain. This result demonstrates that IFN-γ signaling within the host is required for the attenuated virulence phenotype of the tryptophan-auxotrophic trpB F. tularensis subsp. novicida strain. The wt and trpA F. tularensis subsp. novicida strains behaved similarly in the IFN-γR−/− mice as in the wt mice, with both strains causing 100% mortality in infected animals.

IFN-γ signaling inhibits growth of the trpB F. tularensis subsp. novicida mutant in macrophages.

F. tularensis replicates inside macrophages, and intramacrophage growth is limited by activation of the macrophage with IFN-γ (2, 13, 22) To determine whether tryptophan prototrophy contributes to the virulence of F. tularensis within activated macrophages, we infected BMM from wt C57BL/6 mice with the wt, trpA, and trpB F. tularensis subsp. novicida strains and measured intracellular growth in the presence and absence of IFN-γ treatment. In the absence of IFN-γ treatment, the wt F. tularensis subsp. novicida strain replicates to high levels within the macrophage over a 48-h period, whereas IFN-γ treatment limits wt F. tularensis subsp. novicida intramacrophage replication (Fig. 3, top panel, open bars), as has been shown previously. In contrast, the trpA and trpB F. tularensis subsp. novicida mutants were restricted for intramacrophage growth even in the absence of IFN-γ treatment, and IFN-γ treatment restricted their intramacrophage growth even further (Fig. 3, top panel, gray and black bars). The most notable differences were observed at 48 h postinfection, when the wt F. tularensis subsp. novicida strain was recovered at ∼100-fold-higher levels than the trpA and trpB strains in unactivated macrophages. Most importantly, however, the recovery of the F. tularensis subsp. novicida strains within IFN-γ-treated macrophages at 48 h reflected the relative virulence of these strains within wt mice: the wt and trpA F. tularensis subsp. novicida strains were recovered at low but detectable and similar levels, whereas the recovery of the trpB F. tularensis subsp. novicida mutant was significantly less than that of the other two strains (P = 0.01). These results confirm that IFN-γ-mediated signaling preferentially limits intramacrophage replication of the tryptophan-auxotrophic trpB F. tularensis subsp. novicida strain. Complementation of the trpB F. tularensis subsp. novicida mutant with trpB expressed from a plasmid restored wild-type levels of recovery from IFN-γ-treated BMM (see Fig. S1 in the supplemental material), confirming that the lack of TrpB specifically leads to this observed defect in intracellular recovery.

Fig. 3.

Fig. 3.

Open in a new tab

IFN-γ treatment inhibits growth of the trpB F. tularensis subsp. novicida mutant in macrophages. Bone marrow-derived primary macrophages (2 × 105/well) from C57BL/6 (top panel) or IFN-γR−/−] (bottom panel) mice were infected (MOI of 10) with the wt or trpA or trpB mutant F. tularensis subsp. novicida strain in the absence (−) or presence (+) of 1 ng/ml of rIFN-γ, and intracellular bacteria were enumerated at the time points indicated. The results are expressed as the averages of the values for three wells. Error bars show standard deviations. *, differences in recovery of trpB F. tularensis subsp. novicida and wt or trpA F. tularensis subsp. novicida strains in IFN-γ-treated macrophages at the 48-h time point were significant at P values of 0.01 (Student's 2-tailed t test).

To confirm that this preferential inhibition of trpB intramacrophage replication was due to IFN-γ-mediated signaling, the intramacrophage replication experiment was repeated with BMM derived from IFN-γR−/− mice (Fig. 3, lower panel). In the IFN-γR−/− macrophages, the wt, trpA, and trpB F. tularensis subsp. novicida strains showed a pattern of replication similar to their pattern in the untreated macrophages from wt mice, i.e., the wt F. tularensis subsp. novicida strain replicated to high levels, whereas the trpA and trpB mutants were restricted for intramacrophage growth. However, the addition of IFN-γ had no effect on the ability of these strains to survive and replicate within the IFN-γR−/− macrophages, demonstrating that the specific defect of the trpB F. tularensis subsp. novicida strain for survival within activated macrophages is due to IFN-γ-mediated signaling through the IFN-γR.

A trpB mutant of F. tularensis subsp. tularensis is attenuated for virulence in wild-type but not IFN-γR−/− mice.

Because the Francisella attenuated-virulence phenotype associated with tryptophan auxotrophy established above was characterized in F. tularensis subsp. novicida, which has low virulence for humans, we wished to determine whether tryptophan prototrophy is also important for the virulence of F. tularensis subsp. tularensis, which has high virulence for humans. We constructed a trpB mutant of F. tularensis subsp. tularensis strain SchuhS4 by utilizing targetron technology (31). The resulting trpB F. tularensis subsp. tularensis strain, KKT43, is a tryptophan auxotroph like the trpB F. tularensis subsp. novicida strain, as expected (Fig. 4 A). The wt and trpB F. tularensis subsp. tularensis strains were then inoculated into wild-type C57BL/6 mice via the intranasal route in inocula of ∼10 CFU. Mice were evaluated for weight loss and mortality (Fig. 4B, left panels). The wt F. tularensis subsp. tularensis strain caused 100% mortality in all inoculated mice by 8 days postinfection. In contrast, the majority (60%) of the mice inoculated with the trpB F. tularensis subsp. tularensis strain survived infection. The surviving mice exhibited no weight loss, similar to the mock-vaccinated mice. In order to determine whether IFN-γ signaling contributes to the attenuated virulence of the F. tularensis subsp. tularensis trpB mutant, we also infected mice lacking the IFN-γ receptor (C57BL/6 IFN-γR−/−) with the wt and trpB F. tularensis subsp. tularensis strains via the intranasal route at the same time and with the same inocula used to infect the wild-type C57BL/6 mice (Fig. 4B, right panels). The trpB F. tularensis subsp. tularensis mutant exhibited no attenuated virulence in IFN-γR−/− mice, with 100% mortality of mice infected with this strain. This result demonstrates that IFN-γ signaling within the host is required for the attenuated virulence phenotype of the tryptophan-auxotrophic trpB F. tularensis subsp. tularensis strain, as was seen with the trpB F. tularensis subsp. novicida strain.

Fig. 4.

Fig. 4.

Open in a new tab

The trpB F. tularensis subsp. tularensis mutant is attenuated for virulence in wt but not IFN-γR−/− mice. (A) The wt and trpB F. tularensis subsp. tularensis (Ftt) strains were inoculated into Chamberlin's medium without (−) or with (+) 40 μg/ml tryptophan. (B) Groups of C57BL/6 wild-type (left panels) and IFN-γR−/− (right panels) mice (5 mice/group) were inoculated intranasally with ∼10 CFU wt, trpA, or trpB F. tularensis subsp. novicida cells in PBS or mock inoculated (PBS). The inocula were also quantitated by plate count (wt, 21 CFU, and trpB strain, 15 CFU). Mice were monitored daily for survival (top panels) and weight loss (bottom panels). The difference in survival between C57BL/6 mice inoculated with wt and trpB F. tularensis subsp. tularensis was significant at a P value of <0.05 (Kaplan Meier).

We additionally measured the ability of the wt and trpB F. tularensis subsp. tularensis strains to replicate within BMM from wt C57BL/6 mice either in the presence or absence of IFN-γ. As was seen previously with F. tularensis subsp. novicida, the wt F. tularensis subsp. tularensis strain is able to replicate within macrophages to high numbers in the absence of IFN-γ, whereas in the presence of IFN-γ, intramacrophage replication is inhibited (Fig. 5). In contrast to the F. tularensis subsp. novicida trpB mutant (Fig. 3), the F. tularensis subsp. tularensis trpB mutant was able to replicate within unactivated macrophages and was recovered at levels similar to the levels of the wt F. tularensis subsp. tularensis strain at 24 h (Fig. 5). However, the F. tularensis subsp. tularensis trpB mutant in IFN-γ-treated macrophages was recovered in significantly smaller amounts than the wt F. tularensis subsp. tularensis strain after 48 h (P = 0.01). The results with the F. tularensis subsp. tularensis trpB mutant were thus consistent with those obtained with the F. tularensis subsp. novicida trpB mutant and cumulatively demonstrate that tryptophan prototrophy contributes to F. tularensis evasion of IFN-γ-mediated host defense.

Fig. 5.

Fig. 5.

Open in a new tab

IFN-γ treatment inhibits growth of the trpB F. tularensis subsp. tularensis mutant in macrophages. Bone marrow-derived primary macrophages (2 × 105/well) from C57BL/6 mice were infected (MOI of 10) with the wt or trpB mutant F. tularensis subsp. tularensis strain in the absence (−) or presence (+) of 1 ng/ml of rIFN-γ, and intracellular bacteria were enumerated at the time points indicated. The results are expressed as the averages of the values for three wells. Error bars show standard deviations. *, difference in recovery of wt and trpB F. tularensis subsp. tularensis strains in IFN-γ-treated macrophages at the 48-h time point was significant at a P value of 0.01 (Student's 2-tailed t test).

DISCUSSION

F. tularensis is capable of replicating within host cells and evading host immune mechanism(s) to cause disease. One critical virulence attribute is the presence of the secretion system within the Francisella pathogenicity island (3, 27), which allows the bacteria to escape the phagosome and replicate within the host cell cytosol. Other bacterial factors also contribute to the successful pathogenic strategies employed by F. tularensis, including surface factors encoded by capsule, lipoprotein, pilus, and lipopolysaccharide genes (12, 21, 32, 34). Metabolic capabilities are also critical for pathogens replicating within host tissues, and F. tularensis mutants incapable of purine or aromatic amino acid biosynthesis or cysteine acquisition have been shown to be attenuated for virulence (1, 25, 28).

In the present study, we have shown that tryptophan prototrophy also contributes to the virulence of F. tularensis. Tryptophan auxotrophs (trpB mutants) of both F. tularensis subsp. novicida and F. tularensis subsp. tularensis are attenuated for virulence in mice. The attenuated phenotype of tryptophan auxotrophs was dependent on IFN-γ-mediated signaling, since the trpB mutants were fully virulent in IFN-γR−/− mice. Further analysis revealed that IFN-γ treatment of macrophages preferentially inhibited intramacrophage replication of the tryptophan auxotrophs, thus demonstrating that tryptophan prototrophy contributes to resisting IFN-γ-mediated host defense. Tryptophan prototrophy has similarly been shown to contribute to the ability of Chlamydia spp. to resist IFN-γ-mediated host defense (4). IFN-γ reduces intracellular tryptophan pools, and thus, tryptophan auxotrophs essentially starve within these cells.

Our results are consistent with and extend the studies of Peng and Monack (30), who also observed the attenuated virulence of tryptophan auxotrophs of F. tularensis subsp. novicida. Their study demonstrated the induction of the tryptophan-degrading enzyme indoleamine 2,3-dioxygenase (IDO) in the lungs of F. tularensis subsp. novicida-infected mice and the reduced competitiveness of F. tularensis subsp. novicida Trp auxotrophs in this environment. Our studies highlight the involvement of host IFN-γ in this process and demonstrate that the enhanced virulence fitness of Trp prototrophs extends across F. tularensis subspecies.

Chlamydia spp. are obligate intracellular pathogens, whereas F. tularensis can also be found extracellularly within infected animals (11, 35). This probably accounts for the relatively low level of attenuation of the trpB mutant F. tularensis subsp. novicida and F. tularensis subsp. tularensis strains, in contrast with the strong attenuation seen in Chlamydia Trp mutants. Still, the contribution of tryptophan prototrophy to the virulence of both F. tularensis and Chlamydia spp. suggests that this may be a common property among pathogens with a significant intracellular location during infection. Thus, tryptophan auxotrophy may be a useful attenuating mutation when designing live vaccine strains for intracellular pathogens.

Supplementary Material

[Supplemental material]
supp_79_6_2356__index.html (1KB, html)

ACKNOWLEDGMENTS

This project has been funded in part with federal funds from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Humans Services, under contract no. HHSN266200500040C and AI53586.

Footnotes

†

Supplemental material for this article may be found at http://iai.asm.org/.

▿

Published ahead of print on 4 April 2011.

REFERENCES

  • 1. Alkhuder K., Meibom K. L., Dubail I., Dupuis M., Charbit A. 2009. Glutathione provides a source of cysteine essential for intracellular multiplication of Francisella tularensis. PLoS Pathog. 5:e1000284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Anthony L. S., Morrissey P. J., Nano F. E. 1992. Growth inhibition of Francisella tularensis live vaccine strain by IFN-gamma-activated macrophages is mediated by reactive nitrogen intermediates derived from L-arginine metabolism. J. Immunol. 148:1829–1834 [PubMed] [Google Scholar]
  • 3. Barker J. R., et al. 2009. The Francisella tularensis pathogenicity island encodes a secretion system that is required for phagosome escape and virulence. Mol. Microbiol. 74:1459–1470 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Beatty W. L., Belanger T. A., Desai A. A., Morrison R. P., Byrne G. I. 1994. Tryptophan depletion as a mechanism of gamma interferon-mediated chlamydial persistence. Infect. Immun. 62:3705–3711 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bosio C. M., Elkins K. L. 2001. Susceptibility to secondary Francisella tularensis live vaccine strain infection in B-cell-deficient mice is associated with neutrophilia but not with defects in specific T-cell-mediated immunity. Infect. Immun. 69:194–203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Chamberlain R. E. 1965. Evaluation of live tularemia vaccine prepared in a chemically defined medium. Appl. Microbiol. 13:232–235 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Champion M. D., et al. 2009. Comparative genomic characterization of Francisella tularensis strains belonging to low and high virulence subspecies. PLoS Pathog. 5:31000459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Checroun C., Wehrly T. D., Fischer E. R., Hayes S. F., Celli J. 2006. Autophagy-mediated reentry of Francisella tularensis into the endocytic compartment after cytoplasmic replication. Proc. Natl. Acad. Sci. U. S. A. 103:14578–14583 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Edwards J. A., Rockx-Brouwer D., Nair V., Celli J. 2010. Restricted cytosolic growth of Francisella tularensis subsp. tularensis by IFN-g activation of macrophages. Microbiol. 156:327–339 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Elkins K. L., Cowley S. C., Bosio C. M. 2003. Innate and adaptive immune responses to an intracellular bacterium, Francisella tularensis live vaccine strain. Microbes Infect. 5:132–142 [DOI] [PubMed] [Google Scholar]
  • 11. Forestal C. A., et al. 2007. Francisella tularensis has a significant extracellular phase in infected mice. J. Infect. Dis. 196:134–137 [DOI] [PubMed] [Google Scholar]
  • 12. Forslund A. L., et al. 2006. Direct repeat-mediated deletion of a type IV pilin gene results in major virulence attenuation of Francisella tularensis. Mol. Microbiol. 59:1818–1830 [DOI] [PubMed] [Google Scholar]
  • 13. Fortier A. H., Polsinelli T., Green S. J., Nacy C. A. 1992. Activation of macrophages for destruction of Francisella tularensis: identification of cytokines, effector cells, and effector molecules. Infect. Immun. 60:817–825 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Gallagher L. A., et al. 2007. A comprehensive transposon mutant library of Francisella novicida, a bioweapon surrogate. Proc. Natl. Acad. Sci. U. S. A. 104:1009–1014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Golovliov I., Baranov V., Krocova Z., Kovarova H., Sjostedt A. 2003. An attenuated strain of the facultative intracellular bacterium Francisella tularensis can escape the phagosome of monocytic cells. Infect. Immun. 71:5940–5950 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Hu X., Chakravarty S. D., Ivashkiv L. B. 2008. Regulation of interferon and Toll-like receptor signaling during macrophage activation by opposing feedforward and feedback inhibition mechanisms. Immunol. Rev. 226:41–56 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Lai X. H., Golovliov I., Sjostedt A. 2004. Expression of IglC is necessary for intracellular growth and induction of apoptosis in murine macrophages by Francisella tularensis. Microb. Pathog. 37:225–230 [DOI] [PubMed] [Google Scholar]
  • 18. Larsson P., et al. 2005. The complete genome sequence of Francisella tularensis, the causative agent of tularemia. Nat. Genet. 37:153–159 [DOI] [PubMed] [Google Scholar]
  • 19. Lauriano C. M., Barker J. R., Nano F. E., Arulanandam B. P., Klose K. E. 2003. Allelic exchange in Francisella tularensis using PCR products. FEMS Microbiol. Lett. 229:195–202 [DOI] [PubMed] [Google Scholar]
  • 20. Lauriano C. M., et al. 2004. MglA regulates transcription of virulence factors necessary for Francisella tularensis intra-amoebae and intra-macrophage survival. Proc. Natl. Acad. Sci. U. S. A. 101:4246–4249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Li J., et al. 2007. Attenuation and protective efficacy of an O-antigen-deficient mutant of Francisella tularensis LVS. Microbiol. 153:3141–3153 [DOI] [PubMed] [Google Scholar]
  • 22. Lindgren H., et al. 2007. Resistance of Francisella tularensis strains against reactive nitrogen and oxygen species with special reference to the role of KatG. Infect. Immun. 75:1303–1309 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Lindgren H., Stenmark S., Chen W., Tarnvik A., Sjostedt A. 2004. Distinct roles of reactive nitrogen and oxygen species to control infection with the facultative intracellular bacterium Francisella tularensis. Infect. Immun. 72:7172–7182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Liu J., Zogaj X., Barker J. R., Klose K. E. 2007. Construction of targeted insertion mutations in Francisella tularensis subsp. novicida. Biotechniques 43:487–490 [DOI] [PubMed] [Google Scholar]
  • 25. Maier T. M., Pechous R. D., Casey M., Zahrt T. C., Frank D. W. 2006. In vivo himar1-based transposon mutagenesis of Francisella tularensis. Appl. Environ. Microbiol. 72:1878–1885 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Miles E. W. 1991. Structural basis for catalysis by tryptophan synthase. Adv. Enzymol. Relat. Areas Mol. Biol. 64:93–172 [DOI] [PubMed] [Google Scholar]
  • 27. Nano F. E., et al. 2004. A Francisella tularensis pathogenicity island required for intramacrophage growth. J. Bacteriol. 186:6430–6436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Pechous R. D., et al. 2008. A Francisella tularensis SchuS4 purine auxotroph is highly attenuated in mice but offers limited protection against homologous intranasal challenge. PLoS One 3:e2487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Pechous R. D., McCarthy T. R., Zahrt T. C. 2009. Working toward the future: insights into Francisella tularensis pathogenesis and vaccine development. Microbiol. Mol. Biol. Rev. 73:684–711 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Peng K., Monack D. M. 2010. Indoleamine 2,3-dioxygenase 1 is a lung-specific immune defense mechanism that inhibits Francisella tularensis tryptophan auxotrophs. Infect. Immun. 78:2723–2733 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Rodriguez S. A., Yu J.-J., Davis G., Arulanandam B. P., Klose K. E. 2008. Targeted inactivation of Francisella tularensis genes by group II introns. Appl. Environ. Microbiol. 74:2619–2626 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Sandstrom G., Lofgren S., Tarnvik A. 1988. A capsule-deficient mutant of Francisella tularensis LVS exhibits enhanced sensitivity to killing by serum but diminished sensitivity to killing by polymorphonuclear leukocytes. Infect. Immun. 56:1194–1202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Santiago A. E., et al. 2009. Characterization of rationally attenuated Francisella tularensis vaccine strains that harbor deletions in the guaA and guaB genes. Vaccine 27:2426–2436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Twine S., et al. 2005. A mutant of Francisella tularensis strain Schu S4 lacking the ability to express a 58-kilodalton protein is attenuated for virulence and is an effective live vaccine. Infect. Immun. 73:8345–8352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Yu J.-J., et al. 2008. The presence of infectious extracellular Francisella tularensis subsp. novicida in murine plasma after pulmonary challenge. Eur. J. Clin. Microbiol. Infect. Dis. 27:323–325 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]
supp_79_6_2356__index.html (1KB, html)
supp_79_6_2356__ChuFigS1.zip (1.4MB, zip)

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES