Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Jun 30.
Published in final edited form as: Pol J Microbiol. 2010;59(1):61–66.

Analysis of Helicobacter pylori Genotypes in Afghani and Iranian Isolates

Hossein Dabrii 1,2,*, Mehdi Bolfion 1, Akbar Mirsalehian 2, Maryam Rezadehbashi 1, Fereshteh Jafari 1, Leila Shokrzadeh 1, Navid Sahebekhtiari 1, Homayon Zojaji 1, Yoshio Yamaoka 3, Darioush Mirsattari 1, Mohammad Reza Zali 1
PMCID: PMC3126918  NIHMSID: NIHMS305197  PMID: 20568532

Abstract

The geographical variation in Helicobacter pylori genotypes is an observed phenomenon. Cytotoxin associated genes A (cagA) and E (cagE), and vacuolating cytotoxin (vacA) genotypes of H. pylori are associated with peptic ulcer disease (PUD). This study compared the distribution of these genotypes in Iranian and Afghani isolates and their association with clinical outcomes. H. pylori infected patients, as proven by positive culture, were recruited prospectively. A total of 70 patients, 55 Iranian (26 men and 29 women, mean age 48±18 years) and 15 Afghani immigrants (13 men and 2 women, mean age 34.8±11 years) living in Tehran, Iran were enrolled in this study. DNA was extracted from isolated H. pylori and polymerase chain reaction was carried out to determine the cagA and cagE status and vacA alleles. The number of gastric cancer, peptic ulcer and gastritis cases was 11, 23 and 36, respectively. The cagA positive isolates were more common in Iranian (67%) than Afghani isolates (60%). cagE was positive in 53% of Afghani compared to 51% of Iranian isolates. The most common vacA s-region genotype was s1; 80% in Afghani and 67% in Iranian. The s1m1 was a frequently observed genotype in Afghani strains (53%) while s1m2 (47%) was more common in strains isolated from Iranian patients. There is a difference in the H. pylori strains between Iranian and Afghani groups, for instance Iranian isolates were similar to European isolates while Afghani isolates were similar to isolates from India. However, there was no significant association between cagA, cagE and vacA genotypes and clinical outcomes in Iranian and Afghani patients.

Keywords: Afghani and Irani isolates Helicobacter pylori, H. pylori genotypes, virulence factors, clinical outcome

Introduction

Helicobacter pylori genotypes and their geographic distribution are linked to the severity of peptic ulcer disease (PUD) (Van Doorn et al., 1998; Covacci et al., 1999). The H. pylori genome is genetically diverse, as it can be seen in the cag pathogenicity island (PAI) and allelic variation within the vacA gene (Van Doorn et al., 1998a; Covacci et al., 1999; Yamaoka et al., 1999). H. pylori infects the majority of the global population and more than 90% of the Iranian population is reported to be infected with H. pylori (Alborzi et al., 2006). H. pylori infection causes chronic gastritis, PUD, gastric carcinoma (GC) and MALT lymphoma (Marshall and Warren, 1984; Wotherspoon et al., 1991; Parsonnet et al., 1991). Several H. pylori virulent genes contribute to the risk and severity of the disease outcome. These include the cag PAI that encodes a type IV secretion system (Kuipers et al., 1995; Censini et al., 1996). The cytotoxin associated gene A (cagA) has been proposed as a marker for the cag PAI and is associated with more severe clinical outcomes (Van Doorn et al., 1998a; Atherton, 1997). The cag PAI genes contain a cagE gene that encodes a secretory protein that is required for the induction of interleukin IL-8 (Tummuru et al.,1995) and for translocation and phosphorylation of CagA protein (Odenbreit et al., 2000). The presence of the cagE gene has been associated with a severe clinical outcome, especially in developed countries (Fallone et al., 1998).

Vacuolating cytotoxin (vacA) is another important virulence factor of H. pylori that is associated with injury to epithelial cells. The vacA gene is virtually present in all H. pylori and has at least two variable parts, the signal or s-region, and the middle or m-region (Atherton et al., 1995). To date, s region and m region can be differentiated to s1a, s1b, s1c, s2 and m1a, m1b, m1c, m2 subtypes respectively. The different combination of s- and m-region allelic types determines the production of the cytotoxin and the pathogenicity of the organism. vacA m1 strains are associated with greater gastric epithelial damage than m2 strains (Atherton et al., 1995). vacA s1m1 strains produce a large quantity of toxins, and s2m2 strains produce very little or no toxins. vacA s1a strains appear to be more pathogenic than s1b or s2 strains (Covacci et al., 1999; Saribasak et al., 2004; Blaser, 1995), although these are not consistent (Mohammadi et al., 2003; Mukhopadhyay et al., 2000; Tan et al., 2005). Respect to geographic variation in the vacA genotypes (Yamaoka et al., 1999; Tan et al., 2005; Van Doorn et al., 1999). It is suggested that such variations may contribute to the different prevalence of gastric diseases in these areas.

Iran and Afghanistan are neighboring countries and there are many Afghani refugees in Iran. Although there are several recent studies examining the relationship between H. pylori virulence factors and clinical outcomes in Iran (Mohammadi et al., 2003; Hussein et al., 2008); however, there is no report about relationship between Iranian and Afghani H. pylori virulence factors. We therefore compared the distribution of vacA alleles, cagA and cagE status in Iranian and Afghanis residing in Tehran, Iran, and their association with clinical outcome.

Experimental

Material and Methods

Studied Population

A total of 70 patients from Iran and Afghanistan living in Tehran, Iran who were subjected to upper endoscopy from February 2007 to May 2008, were enrolled in this study. None of the patients had received non-steroid anti-inflammatory drugs or antibiotics within the previous three months. Informed consent was obtained from all patients, and the protocol was approved by the ethical committee of Research Center for Gastroenterology and Liver Diseases in Shaheed Beheshti University of Medical Science.

Isolation and identification

Three biopsy specimens were taken from the greater curve of the antrum; two were used for histological examination and one for H. pylori culture. Gastric biopsy specimens for culture were kept in transport medium consisting of thioglycolate with 1.3 g/l agar (Merck Co, Homburg, Germany) with 3% yeast extract (Oxoid Ltd., Basingstoke, UK) and were delivered to the laboratory on the day of endoscopy. In each case, the gastric biopsy specimens were cultured on Brucella Agar with 7% sheep blood and supplements with different antibiotics (Merck, Homburg, Germany) and incubated under microaerophilic conditions at 37°C for 3–10 days. The organisms were identified as H. pylori by colony morphology, gram staining results and positive reactions to oxidase, catalase, and urease activities. The identified H. pylori were sub-cultured and single colonies were used for DNA extraction.

Preparation of genomic DNA and Polymerase Chain Reaction (PCR)

DNA from each H. pylori isolate was extracted using a commercially available kit (Qiagen, Hilden, Germany). The genotypes of vacA s-region (s1 or s2) and m-region (m1 or m2), the presence of the cagA, cagE and glmM (ureC) genes were determined by PCR. The glmM (ureC) gene was used as controls for detecting H. pylori DNA. Primers sequences used in this study are listed in Table I. All PCR mixtures were prepared in a volume of 25 µL containing 1×PCR buffer, 500 nM of each primer, 1.5 mM MgCl2; 200 µM each dNTP, 1.5 U Taq DNA polymerase, and 300 ng DNA sample. The products were amplified in an Eppendorf AG 22331 thermo-cycler (Eppendorf, Hamburg, Germany), and visualized by electrophoresis in 1.5% agarose gel, stained with ethidium bromide, and examined under UV illumination. Mixed infection of different genotypes and vacA negative samples were excluded in the analyses.

Table I.

Oligonucleotide primers used in genotyping of H. pylori isolates

Gene Primer
designation		 Sequence PCR product
size (bp)		 Reference
glmM GlmM1-R
GlmM2-F		 GCTTACTTTCTAACACTAACGCGC
GGATAAGCTTTTAGGGGTGTTAGGGG		   296 (Kauser et al., 2005)
vacAs1 and s2 VAIF
VAIXR		 ATGAAAAAAACCCTTTTAC
CGAATTGCAAGTGATGGT		   259 (s1)
  286 (s2)		 (Kauser et al., 2005)
vacA m1 VAG-F
VAGR		 CAATCTGTCCAATCAAGCGAG
GCGTCTAAATAATTCCAAGG		   570 (Yamaoka et al., 1999)
vacA m2 VAG-F
VAG-R		 CAATCTGTCCAATCAAGCGAG
GCGTCTAAATAATTCCAAGG		   645 (Yamaoka et al., 1999)
cagA CagA F1
CagA R1		 AACAGGACAAGTAGCTAGCC
TATTAATGCGTGTGTGGCTG		   349 (Kauser et al., 2005)
cagE picBF
picBR		 TGTTTGGTTTCCCTG
ACGCATTCCTTAACG		 1335 (Tan, et al., 2005)
Open in a new tab

Data Analysis

Chi Square and Fisher’s exact tests were used for analysis of categorical data and ANOVA for continuing data. Analyses were done using Sigma Stat for Windows V2.03 (SPSS, Chicago, IL). A p value less than 0.05 was accepted as statistically significant.

Results

A total of 70 patients, 55 Iranian (26 men and 29 women, mean age 48±18 years) and 15 Afghani immigrants (13 men and 2 woman, mean age 34.8±11 years) living in Tehran, Iran, were enrolled in this study (Table II). Distribution of gastric cancer, peptic ulcer, and gastritis, was 11, 23 and 36, respectively. The cagA positive isolates were more common in Iranian 37 (67%) than Afghani isolates 9 (60%). The cagA gene was present in 62%, 64% and 74% of H. pylori strains isolated from Iranian patients with, PUD, GC and NUD, respectively, while 50% PUD and 61% NUD of Afghani patients were infected with cagA positive H. pylori isolates. The presence of the cagA gene was not statistically correlated with the presence of PUD or GC in both countries. cagE was positive in 53% of Afghani compare to 51% of Iranian isolates. Regardless of ethnic differences, statistically there was no association between cagE status and clinical outcome.

Table II.

Demographic characterization and clinical outcomes in 70 studied patients

Ethnicity Number Sex Mean age Gastritis (NUD) PUD   GC
Male Female Mild Moderate Sever
Iranian 55 26 (47%) 29 (53%) 48 ± 18 7 (13%) 12 (22%) 4 (7%) 21 (38%) 11 (20%)
Afghan 15 13 (87%) 2 (13%) 35 ± 11 5 (34%) 6 (40%) 2 (13%) 2 (13%)   0 (0%)
Total 70 39 (56%) 31 (44%) 46± 18 12 (17%) 18 (26%) 6 (8%)   23 (33%) 11 (16%)
P value – 0.06 – 0.8 0.1     –
Open in a new tab

P value is calculated by comparing demographic characterization and clinical outcomes (NUD, PUD and GC) in two nations.

NUD, Non Ulcer Dyspepsia; PUD, Peptic Ulcer Disease; GC, Gastric Carcinoma.

The most common vacA s-region genotype was s1; the numbers vary from 80% in Afghani to 67% in Iranian isolates. For the vacA m-region, m1 genotype was the most common among Afghani strains (53%), while m2 genotype was the most common (69%) in strains isolated from Iranian patients. The s1m1 (53%) was a genotype frequently observed in Afghani strains while s1m2 (47%) was more common in strains isolated from Iranian patients. In Iranian samples 2 (4%) isolates were s0m2 (with no PCR product for s region) while such genotype was not seen in Afghani isolates. there was no statistically significant association between clinical outcomes and vacA genotypes in each ethnic group, however the allotype distribution of vacA in clinical outcome groups (NUD, PUD and GC) showed a different profile in the two nations (p = 0.08). There was also no significant difference in the prevalence of triple positive (vacA s1, cagA and cagE) strains between PUD and NUD patients.

We also classified the gastritis cases with no acute inflammation (polymorphonuclear cell infiltration), none to severe chronic inflammation (mononuclear cell infiltration) as well as no gastric atrophy/intestinal metaplasia as “mild to severe gastritis”, and analyzed separately; however the prevalence of the cagA gene in strains isolated from patients with mild gastritis was even higher than those with total gastritis as well as those with PUD and GC, indicating that the cagA gene was not involved in the severity of gastritis in either nationality.

Discussion

This study investigated the cagA, cagE and vacA status of H. pylori isolated from patients from Iran and Afghanistan living in Tehran. All Afghani patients were born in Afghanistan and immigrated to Iran. Because the strains were obtained from symptomatic patients, the results reflect the findings in these groups of patients rather than entire populations. The current study confirms the distinctive difference in H. pylori genotypes in Iranian and Afghani patients even they residing within the same city. This is consistent with other studies from the USA, Malaysia and Kuwait (Tan et al., 2005; Yamaoka et al., 2000; Qabandi et al., 2005). The difference in H. pylori strains among different ethnic groups living in the same area suggests that they were brought by immigrants and have remained in that population for many generations (Dabiri et al., 2009; Tan et al., 2005).

H. pylori vacA s1 was the predominant genotype in both country isolates. The vacA s1m2 genotype was predominant in Iranian strains similar to reports from Western countries (Saribasak et al., 2004). In contrast, s1m1 genotype was predominant in Afghani strains similar to reports from India (Yamaoka et al., 1999; Chattopadhyay et al., 2002). Different pattern of vacA alleles in association with clinical outcomes in each nation is probably suggesting that Iranian and Afghani H. pylori isolates possess different virulence.

The prevalence of the cagA gene has been reported to vary from 26% in Jordan to 100% in India (Nimri et al., 2006; Datta et al., 2003). Such differences were attributed to the genetic diversity and geographic locations (Covacci et al., 1999). cagA presence in Iranian isolates has been reported to vary from 44% to 91% according to different reports (Dabiri et al., 2009; Siavoshi et al., 2005; Talebkhan et al., 2008). In the present study, 67% of the Iranian patients were infected with cagA positive strains similar to an Iranian report (67%) (Dabiri et al., 2009; Jafarzadeh et al., 2007). This is relatively different from studies in Asian countries such as Japan, Korea, China, Hong Kong, Malaysia, Thailand and India where more than 90% of the strains carry the cagA gene, regardless of clinical outcomes (Yamaoka et al., 1999; Tan et al., 2005; Datta et al., 2003; Pan et al., 1998; Wong et al., 2001; Chomvarin et al., 2008). Our results regarding strains isolated from Iranians are rather consistent with studies from Europe and the US where the prevalence of cagA positive strains is between 60–70% (Van Doorn, L.J., et al., 1998a; Miehlke et al., 2000). The prevalence of cagA positive strains in Afghans (60%) is in agreement with previous reports from neighborhood of Afghanistan; Iran (~70%) and Bangladesh (55%) and despite of high prevalence of cagA positive strains (100%) in India (Datta et al., 2003, Talebkhan et al., 2008; Rahman et al., 2003).

The presence of the cagE gene was also reported to vary in different geographic regions and/or ethnic groups (e.g., 64% in the US, 71% in UK, 70% in Malay, 88% in Thailand, 28% in Turkey and 77% [NUD] to 92% [PUD] in India) (Tan et al., 2005; Chomvarin et al., 2008; Podzorski et al., 2003; Kauser et al., 2005; Tiwari et al., 2005; Salih et al., 2007). The prevalence of the cagE gene in studied isolates from both countries was close to each other (51% in Iranian vs. 53% in Afghani isolates) and different with other countries. This finding was different with very limited report on only three Afghani samples (Dabiri et al., 2009).

The present study did not reveal any associations of the vacA and cagA status with PUD and NUD in both ethnics. This finding is in agreement with other reports from Iran (Hussein et al., 2008; Talebkhan et al., 2008) but was different from that in many studies in Western countries where vacA s1 and cagA positive strains are more often isolated from patients with PUD than with NUD (Blaser, 1995). The difference in the cagA status and its association with clinical outcomes might be due to large genomic variations in the H. pylori genomes. There may be several distinct forms of the cagA gene with an uneven geographical distribution, and that only some forms of the cagA gene are associated with severe gastroduodenal diseases (Miehlke et al., 1996; Pan et al., 1997; Zhou et al., 2004).

Conclusions

The presented study detected differences between H. pylori isolates from Iranian and Afghani patients. Afghani isolates (in the case of vacA allele) are more similar to Indian isolates while in cag alleles are more similar to Iranian isolates. We could not detect any statically associations of the vacA, cagA and cagE status with clinical outcomes in Iranian and Afghani patients. Therefore, we suggest a different marker of H. pylori as a useful virulence marker for more serious disease in Iran and further studies with large number of samples for Afghanistan.

Acknowledgements

The authors are thankful to Dr M. Molaei and K. Baghaei for their technical helping. This study was supported by a grant from Research Center for Gastroenterology and liver Disease of Shaheed Beheshti University Research Fund, project number 407.

Literature

  1. Alborzi A, Soltani J, Pourabbas B, Oboodi B, Haghighat M, Hayati M, Rashidi M. Prevalence of Helicobacter pylori infection in children (south of Iran) Diagn. Microbiol. Infect. Dis. 2006;54:259–261. doi: 10.1016/j.diagmicrobio.2005.10.012. [DOI] [PubMed] [Google Scholar]
  2. Atherton JC. The clinical relevance of strain types of Helicobacter pylori. Gut. 1997;40:701–703. doi: 10.1136/gut.40.6.701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Atherton JC, Cao P, Peek RM, Tummuru MKR, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori Association of specific vacA types with cytotoxin production and peptic ulceration. J. Biol. Chem. 1995;270:17771–17767. doi: 10.1074/jbc.270.30.17771. [DOI] [PubMed] [Google Scholar]
  4. Blaser MJ. Intrastrain differences in Helicobacter pylori: a key question in mucosal damage? Ann Med. 1995;27:559–563. doi: 10.3109/07853899509002469. [DOI] [PubMed] [Google Scholar]
  5. Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M, Rappuoli R, Covacci A. Cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors. Proc. Natl. Acad. Sci. 1996;93:14648–14653. doi: 10.1073/pnas.93.25.14648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chattopadhyay S, Datta S, Chowdhury A, Chowdhury S, Mukhopadhyay AK, Rajendran K, Bhattacharya SK, Berg DE, Nair GB. Virulence genes in Helicobacter pylori strains from West Bengal residents with overt H. pylori-associated disease and healthy volunteers. J. Clin. Microbiol. 2002;40:2622–2625. doi: 10.1128/JCM.40.7.2622-2625.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, Tor-Udom S, Vilaichone RK. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int. J. Infect. Dis. 2008;12:30–36. doi: 10.1016/j.ijid.2007.03.012. [DOI] [PubMed] [Google Scholar]
  8. Covacci A, Telford JL, Del Giudice G, Parsonnet J, Rappuoli R. Helicobacter pylori virulence and genetic geography. Science. 1999;284:1328–1333. doi: 10.1126/science.284.5418.1328. [DOI] [PubMed] [Google Scholar]
  9. Dabiri H, Maleknejad P, Yamaoka Y, Feizabadi MM, Jafari F, Rezadehbashi M, Zali MR, Nakhjavani FA, Mirsalehian A. Distribution of Helicobacter pylori cagA, cagE, oipA and vacA in different major ethnic groups in Tehran, Iran. J. Gastroenterol Hepatol. 2009;24:1380–1386. doi: 10.1111/j.1440-1746.2009.05876.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Datta S, Chattopadhyay S, Nair GB, Mukhopadhyay AK, Hembram J, Berg DE, Saha DR, Khan A, Santra A, Bhattacharya SK, et al. Virulence genes and neutral DNA markers of Helicobacter pylori isolates from different ethnic communities of West Bengal, India. J. Clin. Microbiol. 2003;41:3737–3743. doi: 10.1128/JCM.41.8.3737-3743.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fallone CA, Beech R, Barkun A. The H. pylori vacA S1 genotype and the cagE gene are associated with gastroduodenal disease. Gut. 1998;43:19A. [Google Scholar]
  12. Hussein NR, Mohammadi M, Talebkhan Y, Doraghi M, Letley DP, Muhammad MK, Argent RH, Atherton JC. Differences in virulence markers between Helicobacter pylori strains from Iraq and those from Iran: potential importance of regional differences in H. pylori-associated disease. J. Clin. Microbiol. 2008;46:1774–1779. doi: 10.1128/JCM.01737-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Jafarzadeh A, Rezayati MT, Nemati M. Specific serum immunoglobulin G to H. pylori and CagA in healthy children and adults (south-east of Iran) World. J. Gastroenterol. 2007;13:3117–3121. doi: 10.3748/wjg.v13.i22.3117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kauser F, Hussain MA, Ahmed I, Ahmad N, Habeeb A, Khan AA, Ahmed N. Comparing genomes of Helicobacter pylori strains from the high-altitude desert of Ladakh, India. J. Clin. Microbiol. 2005;43:1538–1545. doi: 10.1128/JCM.43.4.1538-1545.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kauser F, Hussain MA, Ahmed I, Srinivas S, Devi SM, Majeed AA, Rao KR, Khan AA, Sechi LA, Ahmed N. Comparative genomics of Helicobacter pylori isolates recovered from ulcer disease patients in England. BMC Microbiol. 2005;5:32. doi: 10.1186/1471-2180-5-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kuipers EJ, Guillermo IP, Meuwissen SGM, Blaser MJ. Helicobacter pylori and atrophic gastritis: importance of the cagA status. J. Natl. Cancer. Inst. 1995;87:1777–1780. doi: 10.1093/jnci/87.23.1777. [DOI] [PubMed] [Google Scholar]
  17. Marshall BJ, Warren JR. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet. 1984;1:1311–1315. doi: 10.1016/s0140-6736(84)91816-6. [DOI] [PubMed] [Google Scholar]
  18. Miehlke S, Kirsch C, Agha-Amiri K, Günther T, Lehn N, Malfertheiner P, Stolte M, Ehninger G, Bayerdörffer E. The Helicobacter pylorivacA s1, m1 genotype and cagA is associated with gastric carcinoma in Germany. Int. J. Cancer. 2000;87:322–327. [PubMed] [Google Scholar]
  19. Miehlke S, Kibler K, Kim JG, Figura N, Small SM, Graham DY, Go MF. Allelic variation in the cagA gene of Helicobacter pylori obtained from Korea compared to the United States. Am. J. Gastroenterol. 1996;91:1322–1325. [PubMed] [Google Scholar]
  20. Mohammadi M, Oghalaie A, Mohajerani N, Massarrat S, Nasiri M, Bennedsen M, Colding H, Andersen LP. Prevalence of Helicobacter pylori vacuolating cytotoxin and its allelic mosaicism as a predictive marker for Iranian dyspeptic patients. Bull. Soc. Pathol. Exot. 2003;96:3–5. [PubMed] [Google Scholar]
  21. Mukhopadhyay AK, Kersulyte D, Jeong J, Datta S, Ito Y, Chowdhury A, Chowdhury S, Santra A, Bhattacharya SK, Azuma T, et al. Distinctiveness of genotypes of Helicobacter pylori in Calcutta, India. J. Bacteriol. 2000;182:3219–3227. doi: 10.1128/jb.182.11.3219-3227.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Nimri LF, Matalka I, Hani KB, Ibrahim M. Helicobacter pylori genotypes identified in gastric biopsy specimens from Jordanian patients. BMC Gastroenterol. 2006;6:27. doi: 10.1186/1471-230X-6-27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Odenbreit S, Püls J, Sedlmaier B, Gerland E, Fischer W, Haas R. Translocation of Helicobacter pylori CagA into gastric epithelial cells by type IV secretion. Science. 2000;287:1497–1500. doi: 10.1126/science.287.5457.1497. [DOI] [PubMed] [Google Scholar]
  24. Pan ZJ, Berg DE, Van Der Hulst RWM, Su WW, Raudonikiene A, Xiao SD, Dankert J, Tytgat GNJ, Van Der Ende A. Prevalence of vacuolating cytotoxin production and distribution of distinct vacA alleles in Helicobacter pylori from China. J. Infect. Dis. 1998;178:220–226. doi: 10.1086/515601. [DOI] [PubMed] [Google Scholar]
  25. Pan ZJ, Van Der Hulst RW, Feller M, Xiao SD, Tytgat GN, Dankert J, Van Der Ende A. Equally high prevalence of infection with cagA-positive Helicobacter pylori in Chinese patients with peptic ulcer disease and those with chronic gastritis-associated dyspepsia. J. Clin. Microbiol. 1997;35:1344–1347. doi: 10.1128/jcm.35.6.1344-1347.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, Sibley RK. Helicobacter pylori infection and the risk of gastric carcinoma. N. Engl. J. Med. 1991;325:1127–1131. doi: 10.1056/NEJM199110173251603. [DOI] [PubMed] [Google Scholar]
  27. Podzorski RP, Podzorski DS, Wuerth A, Tolia V. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagn. Microbiol. Infect. Dis. 2003;46:83–88. doi: 10.1016/s0732-8893(03)00034-8. [DOI] [PubMed] [Google Scholar]
  28. Qabandi AA, Mustafa AS, Siddique I, Khajah AK, Madda JP, Junaid TA. Distribution of vacA and cagA genotypes of Helicobacter pylori in Kuwait. Acta. Trop. 2005;93:283–288. doi: 10.1016/j.actatropica.2005.01.004. [DOI] [PubMed] [Google Scholar]
  29. Rahman M, Mukhopadhyay AK, Nahar S, Datta S, Mashhud Ahmad M, Sarker S, Masud IM, Engstrand L, Albert MJ, Nair GB. DNA-level characterization of Helicobacter pylori strains from patients with overt disease and with benign infections in Bangladesh. J. Clin. Microbiol. 2003;41:2008–2014. doi: 10.1128/JCM.41.5.2008-2014.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Salih BA, Abasiyanik MF, Ahmed N. A preliminary study on the genetic profile of cag pathogenicity-island and other virulent gene loci of Helicobacter pylori strains from Turkey. Infect. Genet. Evol. 2007;7:509–512. doi: 10.1016/j.meegid.2007.03.002. [DOI] [PubMed] [Google Scholar]
  31. Saribasak H, Salih BA, Yamaoka Y, Sander E. Analysis of Helicobacter pylori genotypes and correlation with clinical outcome in Turkey. J. Clin. Microbiol. 2004;42:1648–1651. doi: 10.1128/JCM.42.4.1648-1651.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Siavoshi F, Malekzadeh R, Daneshmand M, Ashktorab H. Helicobacter pylori endemic and gastric disease. Dig. Dis. Sci. 2005;50:2075–2080. doi: 10.1007/s10620-005-3010-1. [DOI] [PubMed] [Google Scholar]
  33. Talebkhan Y, Mohammadi M, Mohagheghi MA, Vaziri HR, Hosseini ME, Mohajerani N, Oghalaei A, Esmaeili M, Zamaninia L. CagA gene and protein status among Iranian Helicobacter pylori strains. Dig. Dis. Sci. 2008;53:925–932. doi: 10.1007/s10620-007-9978-y. [DOI] [PubMed] [Google Scholar]
  34. Tan HJ, Rizal AM, Rosmadi MY, Goh KL. Distribution of Helicobacter pylori cagA, cagE and vacA in different ethnic groups in Kuala Lumpur, Malaysia. J. Gastroenterol. Hepatol. 2005;20:589–594. doi: 10.1111/j.1440-1746.2005.03783.x. [DOI] [PubMed] [Google Scholar]
  35. Tiwari SK, Khan AA, Ahmed KS, Ali SM, Ahmed I, Habeeb A, Kauser F, Hussain MA, Ahmed N, Habibullah CM. Polymerase chain reaction based analysis of the cytotoxin associated gene pathogenicity island of Helicobacter pylori from saliva: an approach for rapid molecular genotyping in relation to disease status. J. Gastroenterol. Hepatol. 2005;20:1560–1566. doi: 10.1111/j.1440-1746.2005.03955.x. [DOI] [PubMed] [Google Scholar]
  36. Tummuru MK, Sharma SA, Blaser MJ. Helicobacter pylori picB, a homologue of the Bordetella pertussis toxin secretion protein, is required for induction of IL-8 in gastric epithelial cells. Mol. Microbiol. 1995;18:867–876. doi: 10.1111/j.1365-2958.1995.18050867.x. [DOI] [PubMed] [Google Scholar]
  37. Van Doorn LJ, Figueiredo C, Mégraud F, Pena S, Midolo P, Queiroz DM, Carneiro F, Vanderborght B, Pegado MD, Sanna R, et al. Geographic distribution of vacA allelic types of Helicobacter pylori. Gastroenterology. 1999;116:823–830. doi: 10.1016/s0016-5085(99)70065-x. [DOI] [PubMed] [Google Scholar]
  38. Van Doorn LJ, Figueiredo C, Rossau R, Jannes G, van Asbroeck M, Sousa JC, Carneiro F, Quint WGV. Typing of Helicobacter pylori vacA gene and detection of cagA gene by PCR and reverse hybridization. J. Clin. Microbiol. 1998;36:1271–1276. doi: 10.1128/jcm.36.5.1271-1276.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schneeberger P, Boer Wd, Quint W. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology. 1998a;115:58–66. doi: 10.1016/s0016-5085(98)70365-8. [DOI] [PubMed] [Google Scholar]
  40. Wong BCY, Yin Y, Berg DE, Xia HHX, Zhang JZ, Wang WH, Wong WM, Huang XR, Tang VSY, Lam SK. Distribution of distinct vacA, cagA and iceA alleles in Helicobacter pylori in Hong Kong. Helicobacter. 2001;6:317–324. doi: 10.1046/j.1523-5378.2001.00040.x. [DOI] [PubMed] [Google Scholar]
  41. Wotherspoon AC, Ortiz-Hidalgo C, Falzon MR, Isaacson PG. Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet. 1991;338:1175–1176. doi: 10.1016/0140-6736(91)92035-z. [DOI] [PubMed] [Google Scholar]
  42. Yamaoka Y, Malaty HM, Osato MS, Graham DY. Conservation of Helicobacter pylori genotypes in different ethnic groups in Houston, Texas. J. Infect. Dis. 2000;181:2083–2086. doi: 10.1086/315486. [DOI] [PubMed] [Google Scholar]
  43. Yamaoka Y, Kodama T, Gutierrez O, Kim JG, Kashima K, Graham DY. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J. Clin. Microbiol. 1999;37:2274–2279. doi: 10.1128/jcm.37.7.2274-2279.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhou J, Zhang J, Xu C, He L. CagA genotype and variants in Chinese Helicobacter pylori strains and relationship to gastroduodenal diseases. J. Med. Microbiol. 2004;53:231–235. doi: 10.1099/jmm.0.05366-0. [DOI] [PubMed] [Google Scholar]

RESOURCES