Skip to main content
Biology of Reproduction logoLink to Biology of Reproduction
. 2011 May 4;85(2):409–416. doi: 10.1095/biolreprod.111.090886

SOX2 Modulates Reprogramming of Gene Expression in Two-Cell Mouse Embryos1

Hua Pan 1, Richard M Schultz 1,2
PMCID: PMC3142263  PMID: 21543769

Abstract

Sox2 is a key gene that controls transcriptional networks required for pluripotency. The role of Sox2 in the developmental transition of a highly differentiated oocyte to totipotent blastomeres of the early preimplantation embryo, however, is not known. We report that Sox2, which is localized in the nucleus, is first zygotically expressed during the 2-cell stage and that its expression dramatically increases between the morula and blastocyst stages. Injecting a cRNA encoding Sox2 into 1-cell embryos resulted in overexpression of SOX2 by approximately 70% and developmental arrest at the 2-cell stage, whereas injecting cRNAs encoding Pou5f1, Myc (also known as c-Myc), or Klf4 has little effect on the ability of 2-cell embryos to cleave to the 4-cell stage. Global transcription assessed by bromo uridine triphosphate incorporation is reduced by approximately 15%, and transcript profiling revealed that approximately 15% of zygotically expressed genes are dramatically repressed in 2-cell embryos overexpressing SOX2. Furthermore, overexpressing a dominant-negative SOX2 perturbs reprogramming of gene expression in 2-cell embryos, though to a much lesser extent than that observed following overexpression of SOX2, and leads to developmental failure after the 2-cell stage but before the 8-cell stage. Results of these experiments implicate Sox2 as a critical transcriptional regulator in the oocyte-to-embryo transition that entails formation of totipotent blastomeres and indicate that the amount of Sox2 is critical for successful execution of this transition.

Keywords: chromatin, early development, embryo, gene expression, transcriptional regulation


Overexpression of SOX2 or a dominant-negative form inhibits embryo development beyond the 2-cell stage by perturbing the reprogramming of gene expression during genome activation that is necessary for continued development.

INTRODUCTION

Following fertilization, the fertilized egg undergoes three rounds of reductive cell division to generate an 8-cell embryo in which the blastomeres appear to be morphologically identical. Nevertheless, transcript profiling reveals two major waves of changes in the pattern of gene expression in the mouse, one that occurs during the 2-cell stage and the other around the 8-cell stage [1–3]. The first wave is called the maternal-to-zygotic transition, in which the developmental program initially directed by maternally inherited proteins and transcripts is replaced by zygotically expressed genes [4]. This transition, which is also called zygotic gene activation or embryonic genome activation, encompasses a dramatic reprogramming in the pattern of gene expression that is required for embryo development beyond the 2-cell stage.

The blastomeres from 2- to 8-cell stage embryos are considered to be totipotent, because they ultimately give rise to all the different cell types in an adult as well as in extraembryonic tissues in pre- and postimplantation embryos [5, 6]. Following compaction during the 8-cell stage, subsequent cell divisions give rise to inner and outer cells of the morula, in which outer cells preferentially give rise to the trophectoderm, a fluid-transporting epithelium, and in which inner cells preferentially give rise to the inner cell mass (ICM), which in turn gives rise to the embryo [7] and from which embryonic stem (ES) cells are derived [8]. ES cells are pluripotent, not totipotent, because they can differentiate into all cell types in an organism except for cells that represent the trophoblast lineage [9]. Expression profiling of a battery of transcription factors present in single blastomeres derived from morulae reveals that outer cells have a high level of Id2 expression (a marker for trophectoderm) and a low level of Sox2 expression (a marker for ICM) but an inverse pattern of expression in inner cells [10]. Thus, cell position-dependent changes in gene expression precede cell fate determination.

Studies using ES cells identified Sox2 (in collaboration with Pou5f1 and Nanog) as a master gene controlling pluripotency [11–13]. Sox2 coexpresses with Pou5f1 in the zygote, cleavage-stage blastomeres, ICM, epiblast, germ cells, and ES cells [14, 15]. Sox2-null embryos die at Embryonic Day 6.5, because the embryo cannot maintain developmental competence of the epiblast [14]. Sox2 can heterodimerize with Pou5f1 by co-occupying HMG and POU motifs on regulatory DNA sequences of target genes in ES cells and transfected somatic cells [13, 16, 17] and contributes to pluripotency, at least in part, by regulating Pou5f1 expression [13]. Expression of Sox2 or Pou5f1 is tightly controlled within narrow limits, and modest increases or decreases in Sox2 or Pou5f1 expression lead to loss of pluripotency and cell differentiation in ES cells [11, 18, 19]. The central role of Sox2 in reprogramming differentiated somatic cells to an undifferentiated state by induced pluripotent stem (iPS) cell technology further highlights the role of Sox2 in pluripotency [20–23].

The role of Sox2 in development of a terminally differentiated oocyte to totipotent blastomeres in preimplantation embryos is not well understood. A previous study assessing Sox2 function in early embryos by a knockout approach was confounded by maternal SOX2 masking earlier functions [14]. A recent study using an RNA interference (RNAi) approach to ablate SOX2 function commencing at the 2-cell stage noted that embryo development did not proceed beyond the morula stage [24]. Although this approach would deplete both maternal and zygotic SOX2 protein, SOX2 protein likely persisted for a period of time beyond the 2-cell stage, again masking any earlier functions.

We report here that injecting 1-cell embryos with a cRNA encoding Sox2 results in expansion of the endogenous SOX2 pool by approximately 70% and developmental arrest, primarily at the 2-cell stage, whereas no developmental arrest is observed following injection of a cRNA encoding Pou5f1, Myc (c-Myc), or Klf4. Global transcription assessed by bromo uridine triphosphate (BrUTP) incorporation is reduced by approximately 15%, and transcript profiling reveals that approximately 15% of the zygotically expressed genes are repressed in 2-cell embryos overexpressing SOX2. Furthermore, overexpressing a dominant-negative SOX2 (SOX2-D) also perturbs reprogramming of gene expression in 2-cell embryos—but to a much lesser extent than that following SOX2 overexpression—and leads to developmental failure after the 2-cell stage but before the 8-cell stage.

MATERIALS AND METHODS

Collection and Culture of Oocytes and Preimplantation Embryos

Full-grown, germinal vesicle-intact (GV) oocytes were obtained from equine chorionic gonadotropin-primed, 6-wk-old, CF-1 female mice (Harlan) and freed of attached cumulus cells as previously described [25]. Embryos were obtained from superovulated CF-1 females mated to B6D2 males as previously described [26]. Embryos were cultured in KSOM under mineral oil (Sigma) in an atmosphere of 90% N2/5% O2/5% CO2 at 37°C. All animal experiments were approved by the Institutional Animal Use and Care Committee of the University of Pennsylvania and were consistent with National Institutes of Health (NIH) guidelines.

Cell Culture, Luciferase Reporter Assay, and Sox2-D Construct

Approximately 30 000 NIH 3T3 cells were plated per well (24-well plate) containing 500 μl of Dulbecco modified Eagle medium (Invitrogen) supplemented with 10% fetal bovine serum and 100 μg/ml of antibiotics (penicillin and streptomycin; Invitrogen). The cells were transfected with 500 ng of total DNA per well (pRL-TK plasmid [Promega] was included as an internal control) using Lipofectamine 2000 (Invitrogen) at 2 μl/μg. Forty-eight hours after transfection, the cultured cells were harvested, at which time luciferase activity was measured in triplicate. The experiment was performed three times.

To generate the Sox2-D construct, a DNA fragment encoding amino acids 1–129 of mouse Sox2 was PCR-amplified and the DNA product cloned into a pCR3 vector. The forward primer was taactcgagccaccatgtataacatgatggaga cggagct, and the reverse primer was cgtctagattagggaagcgtgtactt.

RNA Preparation and Microinjection

To prepare cRNAs, plasmids were linearized, and capped mRNAs were generated by in vitro transcription using T7 mMESSAGE mMachine (Ambion) according to the manufacturer's instructions. Following in vitro transcription, cRNA was polyadenylated using the PolyA Tailing Kit (Ambion). Synthesized cRNA was then purified using an RNeasy Mini Kit (Qiagen), extracted with phenol/chloroform, precipitated, redissolved in RNase-free water, and stored at −80°C. Microinjection of preimplantation embryos was performed as previously described [27]. Before pronucleus formation, the embryos were injected with 5 pl of RNA using a Picoliter Injector Microinjection System (Harvard Apparatus); the culture medium was bicarbonate-free Whitten medium [28] containing 0.01% polyvinyl alcohol and 25 mM Hepes (pH 7.3). Following microinjection, the embryos were cultured in KSOM containing amino acids medium as described above. For each sample, more than 20 oocytes/embryos were microinjected, and the experiment was performed at least three times.

In Vitro Transcription Assay

The BrUTP incorporation assays were performed as previously described [29]. Fluorescence was detected using a Leica TCS SP laser-scanning confocal microscope. The intensity of fluorescence was quantified using NIH Image J software as previously described [29]. For each sample, more than 20 oocytes/embryos were used, and the experiment was conducted two times.

Immunocytochemical Staining

Oocytes/embryos were fixed in 2.5% paraformaldehyde/PBS, and immunocytochemistry was conducted as previously described [30]. Primary antibodies were used at the following dilutions: Sox2 (ab59776; Abcam), 1:300; Pou5f1 (sc5279; Santa Cruz Biotechnology), 1:100. Secondary antibodies were used as follows: Cy5-conjugated donkey anti-mouse immunoglobulin (Ig) G (catalog no. 715-175-150; Jackson ImmunoResearch), 1:100; goat anti-mouse IgG1 488-conjugated (catalog no. 1070-02; SouthernBiotech), 1:100. SYTOX Green (1:5000; Invitrogen) was included in the final wash. 4′,6′-Diamidino-2-phenylindole (DAPI; 1.5 μg/ml; Sigma) was added to the mounting medium (Vectashield; Vector Laboratories). Fluorescence was detected using a Leica TCS SP laser-scanning confocal microscope. NIH Image J software was used to quantify the intensity of fluorescence. For each sample, more than 20 oocytes/embryos were used, and the experiment was performed three times.

Quantitative RT–PCR

Twenty oocytes/embryos were used for RNA preparation. To serve as a normalization control, Egfp cRNA was added to the samples, and RNA was extracted using the PicoPure RNA Isolation Kit (Molecular Devices). The cDNA synthesis was performed using random hexamers, and quantitative PCR was performed in a PTC-200 thermocycler (MJ Research). Each reaction was performed in duplicate and repeated on different samples at least twice; a minus-RT and a minus-template reaction served as controls. ABI TaqMan Gene Expression Assays (Applied Biosystems) were used as follows: Mm00488369_s1 (Sox2), Mm00658129_gH (Pou5f1), Mm00456972_m1 (Ubtf), Mm00558925_s1 (Taf7), Mm00505439_m1 (Gtf2f1), Mm03058063_m1 (Ascl1), and Mm00545903_m1 (Arx). Quantification was normalized to Egfp within the log-linear phase of the amplification curve using the comparative cycle threshold method (ABI PRISM 7700 Sequence Detection System, User Bulletin 2).

DNA Replication Assay

Embryos were incubated in medium containing 10 μM bromodeoxyuridine (BrdU) for 18 h. The embryos were then fixed with paraformaldehyde, treated with 2 N HCl at 37°C for 1 h, and then neutralized in 0.1 M borate buffer (pH 8.5) for 15 min. Incorporated BrdU was visualized with an anti-BrdU antibody (1:30; Roche Applied Science) and goat anti-mouse 488-conjugated secondary antibody. For each sample, more than 20 oocytes/embryos were used, and the intensity of fluorescence was quantified using NIH Image J software as previously described [29]. The experiment was performed twice.

Microarray Analysis

For each sample, total RNA was extracted from thirty 2-cell embryos using the PicoPure RNA Isolation Kit and amplified as described previously [3, 30]; for each treatment, four pools of embryos were collected from separate sets of inseminated mice. The final yield of biotinylated cRNA for each replicate was 30–50 μg, and 15 μg were fragmented at pH 8.1 and 94°C for 35 min. The material was submitted to the Penn Microarray Facility, and the cRNA samples were hybridized to MOE430 v2 GeneChips (Affymetrix). Quality-control data for the samples used in these analyses are found in Supplemental Table S1 (all Supplemental Data are available at www.biolreprod.org); one of the samples did not hybridize well and was not included in the analyses.

Analysis of the data was performed as described previously [30]. Briefly, we used gcRMA (GC robust multiarray average) [31] to perform a background adjustment and normalization and Statistical Analysis of Microarrays (SAM) [32] to identify significantly changed probe sets and calculate a false-discovery rate (FDR) for potential multiple-testing problems. An FDR of less than 5% was used. Probe sets that were considered as present in at least three out of four replicates at one condition based on the Affymetrix MAS present/absent call were used for the analyses. We used the Database for Annotation, Visualization, and Integrated Discovery (DAVID) to identify the biological process gene ontology terms [33].

The Sox2-binding site search was performed by the Penn Bioinformatics Core. Briefly, the promoter sequences were downloaded from Biomart, and then the specific sequence was extracted using a Perl script.

RESULTS

Sox2/SOX2 Expression During Oocyte and Preimplantation Development

Consistent with our previous microarray data [3], Sox2 expression, as determined by quantitative RT-PCR (qRT-PCR), was detectable but low from the oocyte to 8-cell/morula stage and then dramatically increased (Fig. 1A). The increase observed at the 2-cell stage is consistent with microarray data indicating that the increase in Sox2 transcript abundance is inhibited by α-amanitin [34]. SOX2 protein was localized in the nucleus during oocyte and preimplantation development (Fig. 1B). Although the antibody was not suitable for immunoblot analysis, the staining was specific, because overexpression of SOX2 in both GV oocytes and 2-cell embryos resulted in an increase in nuclear staining that depended on the amount of Sox2 cRNA that was injected (Supplemental Fig. S1, A and B). The cytoplasmic staining likely was specific, because cytoplasmic staining was not observed when the primary antibody was omitted (Supplemental Fig. S1A). As anticipated, SOX2 was enriched in ICM cells in the blastocyst (Fig. 1B).

FIG. 1.

FIG. 1

Temporal pattern of Sox2/SOX2 expression during oocyte and preimplantation development. A) The relative amount of Sox2 mRNA was quantified by qRT-PCR. Data are expressed relative to the amount detected in oocytes obtained from mice 12 days of age and as the mean ± SEM. B) Immunocytochemical detection of SOX2 in oocytes and preimplantation embryos. DAPI staining for DNA (blue) is shown on the left and staining for SOX2 (green) on the right. 13d GV, oocyte obtained from mouse 13 days-of-age; GV, full-grown germinal vesicle-intact oocyte; MII, metaphase II-arrested egg; 1C, 2C, and 8C; 1-cell, 2-cell, and 8-cell stage embryos, respectively; BL, blastocyst. Original magnification ×80.

SOX2 Overexpression Inhibits Preimplantation Development

We first undertook an overexpression approach to assess the role of Sox2 in the oocyte-to-embryo transition. Essentially all of the 1-cell embryos injected with a Sox2 cRNA (0.1 pg), which resulted in a 70% ± 6.3% (SEM, P < 0.05) increase in the amount of SOX2 relative to the endogenous amount (Supplemental Fig. S1B), divided to the 2-cell stage. However, approximately 80% of the embryos arrested at the 2-cell stage, whereas 70% of control embryos injected with the same amount of a cRNA encoding Egfp developed in vitro to the blastocyst stage after 4 days (Fig. 2, A and B). Furthermore, Sox2 cRNA-injected embryos that developed beyond the 2-cell stage arrested between the 3-cell and 8-cell stages. Injecting 0.5 pg of Sox2 cRNA, which resulted in a 5-fold increase in the amount of SOX2 relative to the endogenous amount (Supplemental Fig. S1B), had a similar inhibitory effect on development beyond the 2-cell stage, whereas when the amount of injected cRNA was reduced to 0.025 pg, the resulting 1-cell embryos developed to the blastocyst stage at an incidence similar to that of the 1-cell embryos injected with Egfp cRNA (Fig. 2A).

FIG. 2.

FIG. 2

Overexpression of SOX2 or SOX2-D inhibits preimplantation development. A) Fraction of embryos at each developmental stage following overexpression of SOX2 or SOX2-D. Overexpression of EGFP, POU5F1, MYC, or KLF4 had little effect on the ability of 2-cell embryos to cleave to the 4-cell stage. For each cRNA, the experiment was conducted at least three times, with development of at least 20 injected embryos monitored each time, for a total of at least 60 embryos assessed. Data are expressed as the mean ± SEM. Sox2 (lo) and Sox2 (hi) refer to embryos injected with 0.1 and 0.5 pg of cRNA, respectively. B) Representative image of developmentally arrested embryo following SOX2 overexpression. C) SOX2 overexpression inhibits development of a 2-cell blastomere. Following SOX2 overexpression in a 2-cell blastomere, the injected blastomere cleaves once and then becomes arrested, whereas the control injected blastomere continues to cleave. In the left panels, green depicts descendents of the injected blastomere, and in the lower portion of the right panels, asterisks demarcate descendents of the injected blastomere. D) SOX2-D overexpression inhibits development. One-cell embryos were injected with a cRNA encoding either H2b-Egfp or Sox2-D-Egfp, and development was assayed on Day 4. Note that the control developed to the blastocyst stage, whereas SOX2-D overexpression led to developmental arrest after the 2-cell stage but before the blastocyst stage. Original magnification ×30 (B–D).

Pou5f1, Myc, and Klf4 are three other factors, besides Sox2, originally identified as being required to generate iPS cells [20]. To ascertain whether overexpression of any of these factors also led to developmental arrest, we next injected 1-cell embryos with 0.5 pg of cRNA encoding Pou5f1, Myc, or Klf4. Embryos injected with either Myc or Klf4 cRNA developed to the blastocyst stage at an incidence similar to that of embryos injected with an Egfp cRNA. In contrast, nearly half of the embryos injected with Pou5f1 cRNA developed to the morula stage but did not reach the blastocyst stage after 4 days of culture in vitro (Fig. 2A). A previous study also reported that overexpressing POU5F1 inhibits development to the blastocyst stage but that the observed inhibition was more severe, because virtually none of the embryos developed to the blastocyst stage [35]. Quantification of the immunocytochemical signal indicated that relative to control, uninjected embryos, injected embryos showed an approximately 3-fold increase in the amount of POU5F1 at the 2-cell stage (Supplemental Fig. S1C).

We next examined whether Sox2 overexpression affects blastomere development beyond the 2-cell embryo stage. Because a 2-cell blastomere is approximately 50% the volume of a 1-cell embryo, 0.05 pg of cRNA was injected. Injecting a cRNA encoding H2B-EGFP into one blastomere had no effect on development to the 8-cell stage, in which four blastomeres were labeled and the other four were not (Fig. 2C); these embryos developed to the blastocyst stage following an additional 24 h of culture in vitro. In contrast, a 2-cell blastomere injected with a cRNA encoding EGFP-tagged SOX2 typically reached the 6-cell stage when the control embryos reached the 8-cell stage, and only two blastomeres were labeled. With further culture in vitro, the uninjected blastomere cleaved and formed a smaller morula or blastocyst, and the injected blastomere failed to divide (Fig. 2C). A similar inhibition of cleavage was observed following injection of Sox2 cRNA into a 4-cell blastomere (data not shown). Thus, Sox2 overexpression has a dramatic inhibitory effect on blastomere development, at least before the 8-cell stage.

SOX2-D Overexpression Inhibits Preimplantation Development

We took an RNAi approach to study the effect of loss-of-function of Sox2 on the oocyte-to-embryo transition. Although injecting Sox2 siRNAs into either oocytes or 1-cell embryos resulted in a 90% decrease in Sox2 mRNA, we found little, if any, effect in terms of reducing the amount of SOX2 protein as determined by immunocytochemistry in blastocysts (Supplemental Fig. S2). This finding is consistent with SOX2 protein being quite stable during preimplantation development, because maternal SOX2 protein is readily detected in Sox2−/− blastocysts [14]. The stability of SOX2 compromised an RNAi approach.

To circumvent the ineffectiveness of the RNAi approach to inhibit SOX2 function, we generated a Sox2-D that only encodes its DNA-binding domain [36]. We analyzed the ability of SOX2 and SOX2-D to stimulate transcription of a reporter construct in NIH 3T3 cells; the reporter construct 6×O/S harbors six copies of SOX2-binding sites contained in the Fgf4 promoter. Results of these experiments demonstrated that SOX2 activated the 6×O/S reporter by 6-fold (Supplemental Fig. S3). When plasmid DNAs overexpressing the wild-type Sox2 and the Sox2-D were cotransfected into NIH 3T3 cells, SOX2-D suppressed transcriptional activation by SOX2 in a concentration-dependent manner. NIH 3T3 cells do not express Pou5f1 or Sox2, suggesting that SOX2-D inhibits the transcriptional activity of SOX2 by competitively binding to the SOX2 DNA-binding sequence.

Microinjecting Sox2-D cRNA (1.5 pg) into 1-cell embryos also inhibited cleavage, and few embryos reached the morula stage (Fig. 2A). The effect differed, however, from that observed when SOX2 was overexpressed, because a significantly greater fraction of the embryos developed beyond the 2-cell stage. It was unlikely that this difference could be attributed to a lower level of expression of SOX-D, when compared to SOX2, because relative to control embryos, the amount SOX2-D was approximately 5-fold greater following injection of Sox2-D cRNA (Supplemental Fig. S1B). The molecular basis for this difference in inhibiting development likely resides in differences in the mode of action of the expressed proteins—namely, increased function for SOX2 and inhibition of function for SOX2-D. In addition, like SOX2, overexpression of SOX2-D in a 2-cell blastomere inhibited cleavage of that blastomere (Fig. 2D).

Effects of SOX2 and SOX2-D Overexpression on DNA Synthesis and Global Transcription in 2-Cell Embryos

The high incidence of embryos expressing SOX2 that arrest at the 2-cell stage could have been due to inhibition of DNA replication. It is unlikely that such was the case, however, because essentially all of the 2-cell embryos expressing Sox2, Sox2-D, or Egfp were BrdU positive. Moreover, no difference was found in the extent of BrdU incorporation (data not shown).

Failure to activate the embryonic genome or successfully reprogram the pattern of gene expression that accompanies genome activation would be another source for developmental arrest in embryos overexpressing SOX2 or SOX2-D. Accordingly, we assayed the level of global transcription by BrUTP incorporation, and we observed that BrUTP incorporation was reduced by approximately 15% following SOX2 overexpression when compared to controls that were injected with Egfp cRNA (Fig. 3A). In contrast, no significant decrease in global transcription was found when SOX2-D was overexpressed (Fig. 3A). It was unlikely that the developmental arrest observed following overexpression of SOX2 was due to inhibiting transcription at a global level, because concentrations of α-amanitin that inhibited BrUTP incorporation by approximately 50% did not inhibit development (Fig. 3B). Inhibiting BrUTP incorporation by approximately 70%, however, did inhibit cleavage of 2-cell embryos.

FIG. 3.

FIG. 3

SOX2 overexpression inhibits zygotic genome activation. A) One-cell embryos were injected with a cRNA encoding Egfp, Sox2, or Sox2-D and then cultured to the 2-cell stage, at which time the embryos were subjected to the BrUTP incorporation assay to assess the extent of global transcription. Data are expressed as the mean ± SEM. An asterisk indicates that the difference between controls and Sox2 is significant (P < 0.01). B) One-cell embryos were cultured in the presence of the indicated concentration of α-amanitin and assessed for BrUTP incorporation at the 2-cell stage. Embryos readily developed beyond the 2-cell stage in the presence of either 0.75 or 1.5 μg/ml of α-amanitin, even though BrUTP incorporation was inhibited by approximately 50%, but were arrested at the 2-cell stage in the presence of 3 μg/ml of α-amanitin when BrUTP incorporation was inhibited by approximately 70%. Data are expressed as the mean ± SEM.

The results of the experiments described above suggest that failure of embryos overexpressing SOX2 to develop beyond the 2-cell stage likely reflected a failure to reprogram gene expression correctly. Moreover, the differences in effect on development in embryos overexpressing SOX2 or SOX2-D suggested that each differentially affected gene expression.

Transcript Profiling of 2-Cell Embryos Overexpressing SOX2 or SOX2-D

Transcript profiling experiments were conducted to assess the effect of overexpressing SOX2 or SOX2-D on the reprogramming of gene expression that occurs during the 2-cell stage. In each case, a separate experiment was conducted with a separate control in which embryos injected with Egfp cRNA served as controls. The cRNAs were hybridized to Affymetrix Murine Genome Array MOE430 v2 chips that cover most of mouse genome and have more than 45 000 probe sets or 39 000 transcripts and variants (Gene-Spring v7, March 2005).

To validate comparisons between the two experimental data sets, hierarchical cluster analysis did not reveal differences between the two samples; moreover, of the greater than 20 000 transcripts detected, only 22 (0.1%) differed by at least 2-fold. In both cases, the experimental and control groups clustered separately (Fig. 4). Hierarchical clustering divides genes into groups based on their expression patterns and produces groups of genes with a high degree of similarity within each group and a low degree of similarity between groups; therefore, it can identify classes of genes that are up- or down-regulated in a treatment-dependent manner. In embryos overexpressing SOX2, SAM analysis indicated that 3995 transcripts were differentially expressed. Of these, expression of 594 and 47 transcripts was affected by at least 2-and 5-fold, respectively (Supplemental Table S2).

FIG. 4.

FIG. 4

Hierarchical cluster analysis of transcripts in 2-cell embryos following SOX2 or SOX2-D overexpression. Note that although injection of either Sox2 or Sox2-D cRNAs led to clustering separate from embryos injected with Egfp cRNA, the expression profile of embryos injected with Sox2 cRNA differed more than those injected with Sox2-D cRNA.

The aforementioned transcript profiling included transcripts that are products of zygotic gene activation as well as maternally inherited transcripts. Because SOX2 is a transcription factor, we focused our subsequent analyses on zygotically expressed genes for which expression was affected. We previously identified 2033 genes that are zygotically activated based on their sensitivity to α-amanitin [34]. Expression of 312 zygotically activated genes was significantly reduced in embryos overexpressing SOX2 (Supplemental Table S3); DAVID analysis (Supplemental Table S4) revealed that the four most affected processes were translation, RNA processing, ribonucleoprotein complex biogenesis, and ribosome biogenesis. In contrast, expression of 141 genes was significantly increased when SOX2 was overexpressed (Supplemental Table S5); DAVID analysis (Supplemental Table S6) found that the most affected processes were neuron differentiation and gland development. Interestingly, overexpression of SOX2-D perturbed expression of far fewer genes (108), and a reciprocal effect was observed—namely, expression of 34 and 74 zygotically expressed genes either decreased or increased, respectively (Supplemental Tables S7 and S8). The qRT-PCR on five transcripts for which expression was perturbed following SOX2 overexpression revealed changes in relative transcript abundance similar to that observed from the microarray experiments (Supplemental Table S9). These results lend confidence to the idea that changes observed in the microarray data set reflect changes in relative transcript abundance.

To identify α-amanitin-sensitive genes that could be directly regulated by SOX2, we used 5′-C(A/T)TTGT-3′ as a SOX2-binding DNA consensus sequence to search for upstream DNA sequences [37, 38]. The analysis was confined to within −3 kb of the promoter to increase the likelihood of identifying putative SOX2-regulated genes. We found that 91% and 93% of the genes for which expression decreased or increased, respectively, by more than 2-fold following overexpression of SOX2 had a SOX2-binding consensus sequence was within −3 kb of promoter sequences (Supplemental Tables S10 and S11). We also noted that 11 and 35 genes for which expression decreased or increased, respectively, by more than 2-fold following overexpression of SOX2-D had a SOX2-binding consensus sequence was within −3 kb of promoter sequences (Supplemental Tables S12 and S13). Although the small amounts of biological material that can be readily isolated precluded conducting chromatin immunoprecipitation (ChIP) experiments to localize SOX2 to the genome, the results suggest that a substantial fraction of the genes for which expression was affected by SOX2 overexpression likely were direct targets of SOX2.

DISCUSSION

We report here that overexpression of SOX2 or SOX2-D, an inhibitory form of SOX2, in 1-cell embryos results in developmental arrest, with SOX2-expressing embryos arresting at the 2-cell stage and SOX2-D-expressing embryos arresting between the 3-cell and 8-cell stages. SOX2 overexpression has a substantial effect on the reprogramming of gene expression that occurs during the course of zygotic gene activation, affecting approximately 20% of zygotically expressed genes, with approximately 70% of the affected transcripts being down-regulated. In contrast, overexpression of SOX2-D affects expression of a smaller number of zygotically expressed genes (108 vs. 453), a finding consistent with SOX2:POU5F1 inhibition requiring the carboxyl terminus of SOX2, which contains the trans-activation domain [39] and is not present in SOX2-D. Such differences in gene expression likely account for the differences when developmental arrest is observed (i.e., earlier arrest following SOX2 overexpression is due to a more pronounced effect on reprogramming gene expression). Moreover, the dominant effect of SOX2 overexpression is repression of zygotically expressed genes, a situation not observed following overexpression of SOX2-D. These findings are consistent with the small decrease in transcription following overexpression of SOX2, but not SOX2D. In addition, as noted in the Results, the small amounts of biological material preclude ChIP analyses that would support a direct role for SOX2 in regulating expression of the zygotically expressed genes for which expression is perturbed when SOX2 activity is experimentally manipulated. Ascertaining whether the changes in transcript abundance occur in the presence of cycloheximide is a possible way to circumvent this difficulty. We found, however, that the long-term exposure to cycloheximide required to conduct such experiments resulted in nonspecific effects on transcript abundance (data not shown). Nevertheless, that more than 90% of the affected genes contain a SOX2-binding consensus sequence within −3 kb of their promoter provides indirect support for the idea that the affected genes may, indeed, be directly regulated by SOX2.

Consistent with our published microarray data [3, 34], Sox2, based on the increase in transcript abundance between the 1-cell and 2-cell stages, is a zygotically expressed gene. Also consistent with the microarray data is the dramatic increase in Sox2 transcript abundance between the 8-cell/morula and blastocyst stages. Although cytoplasmic staining of SOX2 protein is observed, SOX2 is found in the nucleus at all stages of development, which is consistent with a recent report [24]. In contrast to our finding that SOX2 is localized in both the cytoplasm and the nucleus in oocytes, a previous study reported that SOX2 is primarily localized in the cytoplasm as assessed by immunohistochemistry [14]; those authors did observe a nuclear localization for SOX2 in 2-cell embryos when immunocytochemistry was employed. Our finding that the nuclear fluorescent signal is markedly increased following injection of a cRNA encoding SOX2-EGFP is consistent with SOX2 localizing to the nucleus. The low resolution of immunohistochemistry is a possible explanation for the observed differences.

To date, the function of only a few genes (e.g., Smarca4, Trim24, Ooep, Mater, and Ube2a) has been identified as being required for development beyond the 2-cell stage [40–44]. Of these, only SMARCA4 and TRIM24 are transcription factors for which function in early development was identified by loss-of-function approaches. RNAi-mediated depletion of SOX2 protein was unsuccessful because of the stability of SOX2 protein, a finding consistent with a previous study [14]. The dominant-negative approach, however, did unmask a phenotype that is less severe than that observed when SOX2 is overexpressed. Although SOX2-D can totally suppress SOX2-driven expression of a reporter gene in somatic cells (Supplemental Fig. S2), in the absence of such data in early embryos, it is possible that a more severe phenotype would be observed if higher levels of SOX2-D expression were achieved. Cdkn1a (p21), which inhibits cell-cycle progression [45], is a potential candidate for the observed cleavage arrest between the 3-cell and 8-cell stages, because it is up-regulated in SOX2-D-overexpressing embryos (Supplemental Table S8). Oocyte-specific targeting of Sox2 could, in principle, deplete maternal SOX2 protein and, thereby, provide an opportunity to assess better the consequences of loss of SOX2.

A concern with overexpression studies is that higher concentrations of protein will lead to promiscuous interactions that would not normally occur. For SOX2, such interactions could take the form of binding to weak SOX2-binding sites, squelching effects caused by titrating normal binding partners [46], or changing promoter accessibility as a result of SOX2′s ability to bend DNA [47]. It is very difficult to exclude the contribution from any of these scenarios to the observed compromised embryo development. Nevertheless, the endogenous pool of SOX2 was only expanded by 70%, and a similar inhibition of development was observed when the endogenous pool was expanded by approximately 5-fold. These results minimize the likelihood that the observed affects on development are not the result of the aforementioned scenarios.

The response of ES cells and embryos to SOX2 overexpression is strikingly different. Overexpressing SOX2 in ES cells does not inhibit cell proliferation but, rather, biases differentiation toward neuroectoderm [19, 48], whereas overexpressing SOX2 in embryos results in cleavage arrest at the 2-cell stage. The decrease in expression of the genes Sox2, Pou5f1, and Nanog, the functions of which appear to be critical to stem cell renewal and maintenance of pluripotency [9, 49, 50], following overexpression of SOX2 in ES cells [39] likely contributes to their differentiation; each of these genes is a SOX2:POU5F1 target gene [39]. Although Sox2 expression is increased in SOX2-overexpressing embryos (Supplemental Table S5), no apparent change is observed in expression of Pou5f1 in SOX2-overexpressing embryos (Supplemental Tables S3 and S5), and Nanog, which is not expressed in 2-cell embryos [3], is not precociously expressed. Sox2 maintains Pou5f1 expression in ES cells via Nr5a2 (Lrh1) and Nr2f2 [13]. This pathway, however, appears not to be functional in early embryos, because Nr5a2 and Nr2f2 expression is not affected in SOX2-overexpressing embryos (Supplemental Tables S3 and S5). The pronounced effect on reprogramming gene expression observed in SOX2-overexpressing embryos—namely, expression of approximately 20% of zygotically activated genes is perturbed—likely underlies the inability of SOX2-overexpressing embryos to develop beyond the 2-cell stage. Of note is that depletion of maternal SMARCA4 also results in arrest at the 2-cell stage and misexpression of about one third of the zygotically expressed genes [40].

Why is the major outcome of SOX2 overexpression in early embryos decreased expression of the majority of zygotically expressed genes? In ES cells, binding of SOX2, POU5F1, and NANOG to closely localized sites activates and maintains expression of genes involved in stem cell renewal [51, 52]; NANOG most often colocalizes with SOX2 [38]. In contrast, promoters of genes involved in differentiation and, therefore, not expressed in ES cells tend to be occupied by a single factor [53]. We found at least one consensus SOX2-binding sequence within −3 kb of the promoter in more than 90% of zygotically expressed genes for which expression is perturbed in SOX2-overexpressing embryos. We searched TTTGCATXACAA(A/T)G for adjacent SOX2- and POU5F1-binding sequences within −10 kb of the promoters of the aforementioned genes and noted that this motif was not found in the promoter of any affected gene. This finding, coupled with the absence of NANOG expression in 2-cell embryos, could account for repression of gene expression as a major outcome of SOX2 overexpression.

The ChIP experiments using mouse ES cells identified approximately 1000 genes for which the promoters are occupied by SOX2 [38, 53]. Remarkably, only 25 of the zygotically expressed genes for which expression is perturbed in SOX2-overexpressing embryos are common (Supplemental Table S14), and this may reflect differences in function of pluripotency factors, such as SOX2, during early development. As noted above, these factors are critical for stem cell renewal and maintenance of pluripotency, and presumably, the gene expression profile of these cells is relatively constant, except for changes linked to cell-cycle progression. Blastomeres of the early embryo, however, do not self-renew; rather, this population of cells undergoes a series of reductive cell divisions in which the pattern of gene expression is changing [1–3]. Whether a 2-cell blastomere is truly totipotent or is on a dedifferentiation pathway yet to be completed—the oocyte is a highly differentiated cell—remains an open question. The lack of a substantial set of common genes between ES cells and 2-cell embryos that could potentially be directly regulated by SOX2 is consistent with the concept of 2-cell blastomeres being an intermediate stage on the path to totipotency. Alternatively, this difference in gene expression could reflect distinctions between the totipotent (blastomere) and pluripotent (ES cell) states or indicate that several patterns of gene expression are compatible with a totipotent or pluripotent state.

ACKNOWLEDGMENTS

We thank Pengpeng Ma, Jun Ma, Paula Stein, and Karen Schindler for help and fruitful discussions. The Pou5f1, Sox2, and Klf4 cDNAs were a gift from Hitoshi Niwa. The p6XOS luciferase plasmid was a gift from Lisa Dailey. We also thank John Tobias and Shilpa Rao for assistance with the bioinformatics analyses.

Footnotes

1

Supported by a grant from the NIH (HD022681) to R.M.S. and funds from the Institute for Regenerative Medicine, University of Pennsylvania.

REFERENCES

  1. Hamatani T, Carter MG, Sharov AA, Ko MS. Dynamics of global gene expression changes during mouse preimplantation development. Dev Cell 2004; 6: 117 131. [DOI] [PubMed] [Google Scholar]
  2. Wang QT, Piotrowska K, Ciemerych MA, Milenkovic L, Scott MP, Davis RW, Zernicka-Goetz M. A genome-wide study of gene activity reveals developmental signaling pathways in the preimplantation mouse embryo. Dev Cell 2004; 6: 133 144. [DOI] [PubMed] [Google Scholar]
  3. Zeng F, Baldwin DA, Schultz RM. Transcript profiling during preimplantation mouse development. Dev Biol 2004; 272: 483 496. [DOI] [PubMed] [Google Scholar]
  4. Schultz RM. The molecular foundations of the maternal to zygotic transition in the preimplantation embryo. Hum Reprod Update 2002; 8: 323 331. [DOI] [PubMed] [Google Scholar]
  5. Tarkowski AK. Experiments on the development of isolated blastomeres of mouse eggs. Nature 1959; 184: 1286 1287. [DOI] [PubMed] [Google Scholar]
  6. Rossant J. Postimplantation development of blastomeres isolated from 4- and 8-cell mouse eggs. J Embryol Exp Morphol 1976; 36: 283 290. [PubMed] [Google Scholar]
  7. Morris SA, Teo RT, Li H, Robson P, Glover DM, Zernicka-Goetz M. Origin and formation of the first two distinct cell types of the inner cell mass in the mouse embryo. Proc Natl Acad Sci U S A 2010; 107: 6364 6369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Yu J, Thomson JA. Pluripotent stem cell lines. Genes Dev 2008; 22: 1987 1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Do JT, Scholer HR. Regulatory circuits underlying pluripotency and reprogramming. Trends Pharmacol Sci 2009; 30: 296 302. [DOI] [PubMed] [Google Scholar]
  10. Guo G, Huss M, Tong GQ, Wang C, Li Sun L, Clarke ND, Robson P. Resolution of cell fate decisions revealed by single-cell gene expression analysis from zygote to blastocyst. Dev Cell 2010; 18: 675 685. [DOI] [PubMed] [Google Scholar]
  11. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 2000; 24: 372 376. [DOI] [PubMed] [Google Scholar]
  12. Chambers I, Silva J, Colby D, Nichols J, Nijmeijer B, Robertson M, Vrana J, Jones K, Grotewold L, Smith A. Nanog safeguards pluripotency and mediates germline development. Nature 2007; 450: 1230 1234. [DOI] [PubMed] [Google Scholar]
  13. Masui S, Nakatake Y, Toyooka Y, Shimosato D, Yagi R, Takahashi K, Okochi H, Okuda A, Matoba R, Sharov AA, Ko MS, Niwa H. Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nat Cell Biol 2007; 9: 625 635. [DOI] [PubMed] [Google Scholar]
  14. Avilion AA, Nicolis SK, Pevny LH, Perez L, Vivian N, Lovell-Badge R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev 2003; 17: 126 140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Scholer HR, Dressler GR, Balling R, Rohdewohld H, Gruss P. Oct-4: a germline-specific transcription factor mapping to the mouse t-complex. EMBO J 1990; 9: 2185 2195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ambrosetti DC, Basilico C, Dailey L. Synergistic activation of the fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends on protein-protein interactions facilitated by a specific spatial arrangement of factor binding sites. Mol Cell Biol 1997; 17: 6321 6329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Rodda DJ, Chew JL, Lim LH, Loh YH, Wang B, Ng HH, Robson P. Transcriptional regulation of nanog by OCT4 and SOX2. J Biol Chem 2005; 280: 24731 24737. [DOI] [PubMed] [Google Scholar]
  18. Fong H, Hohenstein KA, Donovan PJ. Regulation of self-renewal and pluripotency by Sox2 in human embryonic stem cells. Stem Cells 2008; 26: 1931 1938. [DOI] [PubMed] [Google Scholar]
  19. Kopp JL, Ormsbee BD, Desler M, Rizzino A. Small increases in the level of Sox2 trigger the differentiation of mouse embryonic stem cells. Stem Cells 2008; 26: 903 911. [DOI] [PubMed] [Google Scholar]
  20. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006; 126: 663 676. [DOI] [PubMed] [Google Scholar]
  21. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R. Slukvin II, Thomson JA. Induced pluripotent stem cell lines derived from human somatic cells. Science 2007; 318: 1917 1920. [DOI] [PubMed] [Google Scholar]
  22. Nakagawa M, Koyanagi M, Tanabe K, Takahashi K, Ichisaka T, Aoi T, Okita K, Mochiduki Y, Takizawa N, Yamanaka S. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Biotechnol 2008; 26: 101 106. [DOI] [PubMed] [Google Scholar]
  23. Wernig M, Lengner CJ, Hanna J, Lodato MA, Steine E, Foreman R, Staerk J, Markoulaki S, Jaenisch R. A drug-inducible transgenic system for direct reprogramming of multiple somatic cell types. Nat Biotechnol 2008; 26: 916 924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Keramari M, Razavi J, Ingman KA, Patsch C, Edenhofer F, Ward CM, Kimber SJ. Sox2 is essential for formation of trophectoderm in the preimplantation embryo. PLoS One 2010; 5: e13952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Schultz RM, Montgomery RR, Belanoff JR. Regulation of mouse oocyte maturation: implication of a decrease in oocyte cAMP and protein dephosphorylation in commitment to resume meiosis. Dev Biol 1983; 97: 264 273. [DOI] [PubMed] [Google Scholar]
  26. Manejwala F, Kaji E, Schultz RM. Development of activatable adenylate cyclase in the preimplantation mouse embryo and a role for cyclic AMP in blastocoel formation. Cell 1986; 46: 95 103. [DOI] [PubMed] [Google Scholar]
  27. Kurasawa S, Schultz RM, Kopf GS. Egg-induced modifications of the zona pellucida of mouse eggs: effects of microinjected inositol 1,4,5-trisphosphate. Dev Biol 1989; 133: 295 304. [DOI] [PubMed] [Google Scholar]
  28. Whitten WK. Nutrient requirements for the culture of preimplantation mouse embryo in vitro. Adv Biosci 1971; 6: 129 139. [Google Scholar]
  29. Aoki F, Worrad DM, Schultz RM. Regulation of transcriptional activity during the first and second cell cycles in the preimplantation mouse embryo. Dev Biol 1997; 181: 296 307. [DOI] [PubMed] [Google Scholar]
  30. Pan H, O'Brien MJ, Wigglesworth K, Eppig JJ, Schultz RM. Transcript profiling during mouse oocyte development and the effect of gonadotropin priming and development in vitro. Dev Biol 2005; 286: 493 506. [DOI] [PubMed] [Google Scholar]
  31. Wu Z, Irizarry RA, Gentleman R, Murillo FM, Spencer F. A model based background adjustment for oligonucleotide expression arrays. J Am Stat Assoc 2004; 99: 909 917. [Google Scholar]
  32. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 2001; 98: 5116 5121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 2009; 4: 44 57. [DOI] [PubMed] [Google Scholar]
  34. Zeng F, Schultz RM. RNA transcript profiling during zygotic gene activation in the preimplantation mouse embryo. Dev Biol 2005; 283: 40 57. [DOI] [PubMed] [Google Scholar]
  35. Foygel K, Choi B, Jun S, Leong DE, Lee A, Wong CC, Zuo E, Eckart M. Reijo Pera RA, Wong WH, Yao MW. A novel and critical role for Oct4 as a regulator of the maternal-embryonic transition. PLoS One 2008; 3: e4109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ambrosetti DC, Scholer HR, Dailey L, Basilico C. Modulation of the activity of multiple transcriptional activation domains by the DNA binding domains mediates the synergistic action of Sox2 and Oct-3 on the fibroblast growth factor-4 enhancer. J Biol Chem 2000; 275: 23387 23397. [DOI] [PubMed] [Google Scholar]
  37. Maruyama M, Ichisaka T, Nakagawa M, Yamanaka S. Differential roles for Sox15 and Sox2 in transcriptional control in mouse embryonic stem cells. J Biol Chem 2005; 280: 24371 24379. [DOI] [PubMed] [Google Scholar]
  38. Chen X, Xu H, Yuan P, Fang F, Huss M, Vega VB, Wong E, Orlov YL, Zhang W, Jiang J, Loh YH, Yeo HC, et al. Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. Cell 2008; 133: 1106 1117. [DOI] [PubMed] [Google Scholar]
  39. Boer B, Kopp J, Mallanna S, Desler M, Chakravarthy H, Wilder PJ, Bernadt C, Rizzino A. Elevating the levels of Sox2 in embryonal carcinoma cells and embryonic stem cells inhibits the expression of Sox2:Oct-3/4 target genes. Nucleic Acids Res 2007; 35: 1773 1786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Bultman SJ, Gebuhr TC, Pan H, Svoboda P, Schultz RM, Magnuson T. Maternal BRG1 regulates zygotic genome activation in the mouse. Genes Dev 2006; 20: 1744 1754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Torres-Padilla ME, Zernicka-Goetz M. Role of TIF1alpha as a modulator of embryonic transcription in the mouse zygote. J Cell Biol 2006; 174: 329 338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Li L, Baibakov B, Dean J. A subcortical maternal complex essential for preimplantation mouse embryogenesis. Dev Cell 2008; 15: 416 425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tong ZB, Gold L, Pfeifer KE, Dorward H, Lee E, Bondy CA, Dean J, Nelson LM. Mater, a maternal effect gene required for early embryonic development in mice. Nat Genet 2000; 26: 267 268. [DOI] [PubMed] [Google Scholar]
  44. Roest HP, Baarends WM, de Wit J, van Klaveren JW, Wassenaar E, Hoogerbrugge JW, van Cappellen WA, Hoeijmakers JH, Grootegoed JA. The ubiquitin-conjugating DNA repair enzyme HR6A is a maternal factor essential for early embryonic development in mice. Mol Cell Biol 2004; 24: 5485 5495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Abbas T, Dutta A. p21 In cancer: intricate networks and multiple activities. Nat Rev Cancer 2009; 9: 400 414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Gill G, Ptashne M. Negative effect of the transcriptional activator GAL4. Nature 1988; 334: 721 724. [DOI] [PubMed] [Google Scholar]
  47. Scaffidi P, Bianchi ME. Spatially precise DNA bending is an essential activity of the sox2 transcription factor. J Biol Chem 2001; 276: 47296 47302. [DOI] [PubMed] [Google Scholar]
  48. Zhao S, Nichols J, Smith AG, Li M. SoxB transcription factors specify neuroectodermal lineage choice in ES cells. Mol Cell Neurosci 2004; 27: 332 342. [DOI] [PubMed] [Google Scholar]
  49. Chambers I, Tomlinson SR. The transcriptional foundation of pluripotency. Development 2009; 136: 2311 2322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Kashyap V, Rezende NC, Scotland KB, Shaffer SM, Persson JL, Gudas LJ, Mongan NP. Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription factors with polycomb repressive complexes and stem cell microRNAs. Stem Cells Dev 2009; 18: 1093 1108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, Zucker JP, Guenther MG, Kumar RM, Murray HL, Jenner RG, Gifford DK, Melton DA, et al. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 2005; 122: 947 956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Loh YH, Wu Q, Chew JL, Vega VB, Zhang W, Chen X, Bourque G, George J, Leong B, Liu J, Wong KY, Sung KW, et al. The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat Genet 2006; 38: 431 440. [DOI] [PubMed] [Google Scholar]
  53. Kim J, Chu J, Shen X, Wang J, Orkin SH. An extended transcriptional network for pluripotency of embryonic stem cells. Cell 2008; 132: 1049 1061. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Biology of Reproduction are provided here courtesy of Oxford University Press

RESOURCES