Genomic and Proteomic Analysis of Invertebrate Iridovirus Type 9 ^,

Abstract

Iridoviruses (IV) are nuclear cytoplasmic large DNA viruses that are receiving increasing attention as sublethal pathogens of a range of insects. Invertebrate iridovirus type 9 (IIV-9; Wiseana iridovirus) is a member of the major phylogenetic group of iridoviruses for which there is very limited genomic and proteomic information. The genome is 205,791 bp, has a G+C content of 31%, and contains 191 predicted genes, with approximately 20% of its repeat sequences being located predominantly within coding regions. The repeated sequences include 11 proteins with helix-turn-helix motifs and genes encoding related tandem repeat amino acid sequences. Of the 191 proteins encoded by IIV-9, 108 are most closely related to orthologs in IIV-3 (Chloriridovirus genus), and 114 of the 126 IIV-3 genes have orthologs in IIV-9. In contrast, only 97 of 211 IIV-6 genes have orthologs in IIV-9. There is almost no conservation of gene order between IIV-3, IIV-6, and IIV-9. Phylogenetic analysis using a concatenated sequence of 26 core IV genes confirms that IIV-3 is more closely related to IIV-9 than to IIV-6, despite being from a different genus of the Iridoviridae. An interaction between IIV and small RNA regulatory systems is supported by the prediction of seven putative microRNA (miRNA) sequences combined with XRN exonuclease, RNase III, and double-stranded RNA binding activities encoded on the genome. Proteomic analysis of IIV-9 identified 64 proteins in the virus particle and, when combined with infected cell analysis, confirmed the expression of 94 viral proteins. This study provides the first full-genome and consequent proteomic analysis of group II IIV.

INTRODUCTION

Iridoviruses (IV) are members of the nucleocytoplasmic large DNA viruses (NCLDV) (19). They possess a linear double-stranded DNA (dsDNA) genome with circular permutation and terminal redundancy (6, 13), and replication of the viral genome includes distinct nuclear and cytoplasmic phases (12). The genomes are encapsidated within an icosahedral shell ranging between 120 and 180 nm in diameter and comprised predominantly of a 50-kDa major capsid protein (MCP). The invertebrate iridoviruses (IIV), studied by cryo-electron microscopy, have 2-nm-diameter surface fibrils (23, 42); for invertebrate iridovirus type 6 (IIV-6), these fibrils extend from the 3-fold rotational axis of the 1,460 hexameric capsids found in the virus particle (43). IV are divided into 5 genera (Table 1), with members of three genera infecting poikilothermic vertebrates and members of the Iridovirus and Chloriridovirus genera infecting invertebrates. The Chloriridovirus genus has only one member, IIV-3 (mosquito iridovirus), and the primary defining differences between the Chloriridovirus and Iridovirus genera are particle sizes of approximately 180 and 135 nm, respectively, and the mosquito host range restriction of IIV-3 (4).

Table 1.

Fully sequenced genomes from vertebrate and invertebrate iridoviruses

Genus and virusa	Genome size (bp)	% G+C	ORFb	Coding density (%)	Protein size range (aa)	GenBank accession no.	Reference
Iridovirus
IIV-9	205,791	31	191	90	50–2,051	GQ918152	This study
IIV-6	212,482	29	243c	85	40–2,432	AF303741	Jakob et al. (20)
Chloriridovirus
IIV-3	191,132	48	126	68	60–1,377	DQ643392	Delhon et al. (5)
Lymphocystivirus
LCDV-1	102,653	29	110	82	40–1,199	L63545	Tidona and Darai (35)
LCDV-C	186,250	27	240	67	40–1,193	AY380826	Zhang et al. (46)
Ranavirus
TFV	105,057	55	105	94	40–1,294	AF389451	He et al. (17)
ATV	106,332	54	96	79	32–1,294	AY150217	Jancovich et al. (21)
FV-3	105,903	55	98	80	50–1,293	AY548484	Tan et al. (34)
STIV	105,890	55	105	80	40–1,294	EU627010	Huang et al. (18)
SGIV	140,131	49	162	98	41–1,268	AY521625	Song et al. (32)
GIV	139,793	49	120	83	62–1,268	AY666015	Tsai et al. (36)
Megalocytivirus
ISKNV	111,362	55	124	93	40–1,208	AF371960	He et al. (16)
RBIV	112,080	53	118	86	50–1,253	AY532606	Do et al. (7)
RSIV	112,414	53	93		86–1,309	BD143114	Kurita et al. (25)
OSGIV	112,636	54	121	91	40–1,168	AY894343	Lu et al. (26)

^aIIV-3, invertebrate iridescent virus type 3; IIV-6, invertebrate iridescent virus type 6; LCDV-1, lymphocystis disease virus 1; LCDV-C, lymphocystis disease virus, China strain; TFV, tiger frog virus; ATV, ambystoma tigrinum virus; FV-3, frog virus 3; STIV, soft-shelled turtle iridovirus; SGIV, Singapore grouper iridovirus; GIV, grouper iridovirus; ISKNV, infectious spleen and kidney necrosis virus; RBIV, rock bream iridovirus; RSIV, red sea bream iridovirus; OSGIV, orange spotted grouper iridovirus.

^bEssentially nonoverlapping ORF encoding a minimum length of 40 to 62 aa.

^cRevised annotation of Eaton et al. (8).

The vertebrate IV cause disease in fish, amphibians, and reptiles and have received considerable attention due to their effects upon aquaculture. In contrast, the IIV cause predominantly subpathogenic infections, and their consequently limited utility for pest control has meant that less is known about IIV. Of particular importance has been the recent study of Bromenshenk et al. (3) linking colony collapse disorder in honey bees to coinfection with Nosema and an unidentified iridovirus(es). A strong causal relationship was established; however, the identity of the IV was not established, at least in part due to a lack of IIV genomic information. In addition, the refraction of light by assemblies of IIV particles offers new opportunities in materials development (23, 28) that would benefit from more information on the virus particle and its constituents. The roles of viral proteins, such as the surface fiber, in iridescence are unknown, and the proteins and functional activities associated with the virus particle remain to be elucidated. Central to this is the need for information on IIV genomes and the proteomic analysis of the virus particle.

Fourteen iridovirus species have been fully sequenced (Table 1), with multiple members of the Ranavirus, Lymphocystivirus, and Megalocytivirus genera providing a comprehensive coverage of these vertebrate genera of IV. Vertebrate IV genomes range from 105 kbp for tiger frog virus (17) to 186 kbp for lymphocystis disease virus, China strain (LCDV-C) (46). The Ranavirus and Megalocytivirus species have G+C contents of approximately 50%, while the Lymphocystivirus species have G+C contents of less than 30%. There is a consistent lack of genome colinearity between IV except with very closely related isolates, although all IV sequenced to date possess a core cohort of 26 conserved genes (8). In contrast to the vertebrate IV, the only fully sequenced IIV are IIV-6 (Chilo iridovirus [CIV]) (20) and IIV-3 (mosquito chloriridovirus [MIV]) (5). IIV-6 is the type species of the Iridovirus genus, with a genome of 212 kbp and a G+C content of 29%; however, phylogenetic studies show that IIV-6 belongs in a clade distant from that of most iridoviruses (Fig. 1 A) (38). IIV-3, with a genome of 191 kbp and a G+C content of 48%, represents a different genus that may be more closely related to members of the Iridovirus genus than its placement in a separate genus suggests.

Fig. 1.

Phylogenetic trees of iridoviruses. (A) Alignment of the genus Iridovirus based upon a partial major capsid protein sequence as described in the work of Webby and Kalmakoff (38). The Chloriridovirus IIV-3 and the Lymphocystivirus LCDV-1 are included. (B) Alignment of representatives of the five iridovirus genera Chloriridovirus (IIV-3), Iridovirus (IIV-6, IIV-9), Lymphocystivirus (LCDV-1), Ranavirus (ISKNV), and Megalocytivirus (SGIV) based upon a concatenated amino acid sequence of the 26 core iridovirus genes. Bootstrap support from 1,000 iterations is indicated for all branches, with at least 70% support.

To date, only limited sequence information is available from members of the major clade of IIV, defined as group II iridoviruses by Williams and Cory (41), and genome analysis of a member of this clade would provide information on the relationships between disparate IIV. IIV-9 (Wiseana iridovirus [WIV]), a representative of the major clade, was isolated in New Zealand from larvae of the pasture pest Wiseana spp. (Lepidoptera: Hepialidae) (9). The mechanism of transmission of this virus is unknown, though the presence of this virus in damp and cryptic habitats is consistent with many other IIV (40), and suggestions of vector transmission have been made, though not confirmed. Like most invertebrate iridoviruses, IIV-9 replicates in larvae of the greater wax moth Galleria mellonella upon injection, and heavily infected larvae display typical iridescence upon accumulation of paracrystalline arrays of virus particles within infected tissues (9). IIV-9 also replicates in Spodoptera frugiperda (Sf9, Sf21) cells, albeit at the restricted temperature of 21°C. IIV-9 is a member of the major clade of IIV, as determined by partial major capsid protein phylogeny (38).

This study presents the complete genomic sequence of IIV-9 and uses this information for proteomic analysis of IIV-9's encoded proteins in purified virus particles and within infected cells. Analysis of the genome indicates that IIV-9 is more closely related to IIV-3 than to IIV-6 and provides the first complete genome from the major clade of invertebrate iridoviruses.

MATERIALS AND METHODS

IIV-9 purification, DNA extraction, and sequencing.

Sf21 cells were grown in SF900II serum-free medium (Invitrogen, Auckland, New Zealand) and infected with dilutions of a field isolate of IIV-9 that had been passaged repeatedly through G. mellonella larvae. Infected cells were incubated for 5 days at 21°C under an agarose overlay and stained with neutral red. Individual plaques were picked and passaged once in cell culture. One plaque isolate was randomly selected, propagated in G. mellonella, and purified on sucrose gradients as described previously (23). Genomic DNA was extracted by phenol-chloroform extraction (37), and 50 μl (100 ng μl⁻¹) of genomic DNA in deionized water was sequenced using the Roche/454 GS FLX High Throughput Sequencing Service provided by the Department of Anatomy and Structural Biology, University of Otago. All contig junctions were determined by sequencing of available restriction fragment clones or by PCR. Briefly, primers were designed near the termini of contigs and used with primers on adjacent contigs to generate PCR products directly from genomic DNA using the Expand high-fidelity PCR kit (Roche Diagnostics, Auckland, New Zealand). The PCR products were either sequenced directly at the Allan Wilson Sequencing Centre, Palmerston North, New Zealand, on an ABI 3730 automated sequencer or cloned into pGEMTeasy (Promega Corp., Madison, WI) prior to sequencing. Sequence conflicts, long repeats, and long runs of single nucleotides were confirmed by PCR and sequencing of the region in question. All ABI 3730-generated sequences were edited in SeqMan (DNAStar) for sequence quality prior to use.

Sequence analysis.

Newbler Assembler software (454 Life Sciences, Branford, CT) was used to assemble data into unordered and unoriented contigs (default settings). The contigs were exported to the SeqMan program in the Lasergene suite of DNA analysis programs (DNAStar, Madison, WI) and reassembled into a draft alignment using the SeqMan assembler (match size, 12; minimum match percentage, 80%; minimum sequence length, 100; maximum number of added gaps per kb in the contig, 70; maximum number of added gaps per kb in the sequence, 70; maximum register shift difference, 70; last group considered, 2; gap penalty, 0.00; gap length penalty, 0.70). All contigs were aligned to generate a draft alignment with a minimum match percentage of 95%. PCR primers were designed using PrimerDesign (DNAStar). An in silico analysis of the restriction profile of the complete genome was performed using GeneQuest (DNAStar), and results were compared to published restriction profiles of IIV-9 genomic DNA as a confirmation of the assembly profile.

Tandem repeats within the IIV-9 genome were identified using Tandem Repeats Finder (2), with parameters set for match and mismatch and indels equal to 2, 7, and 7, respectively. The minimum alignment score was set at 50, with a maximum period size of 2,000 bases. Direct, inverted, and dyad repeats were identified using GeneQuest (DNAStar) with an unlimited loop size. The minimum period sizes set for direct, inverted, and dyad repeats were 25 bp, 25 and 50 bp, and 16 bp, respectively. Dot plot analysis was performed to identify DNA repeat clusters using MegAlign (DNAStar), with a window size of 50 bp and a 75% match.

Open reading frames (ORF) encoding proteins with a minimum size of 50 amino acids (aa) and that contained a start codon were designated using SeqBuilder (DNAStar). All designated ORF were named with “orf” followed by numbers corresponding to their position and a forward/reverse (right [R]/left [L], respectively) designation to indicate their orientation. ORF that fell completely within a larger ORF were excluded. Heavily overlapping open reading frames where the most likely ORF could not be determined were given the same number but different orientations. All designated IIV-9 open reading frames were exported from SeqBuilder (DNAStar) to EditSeq (DNAStar), and BLASTP analysis of the predicted amino acid sequences was performed for each open reading frame. Amino acid identity to the closest BLASTP match was performed using MegAlign (DNAStar). Analysis of IIV-9 ORF function was performed via the ExPASy Proteomics Server and included InterProScan, SignalP, and PredictProtein. Protein repeats were identified using the XSTREAM prediction server (27), and subsequent alignments of protein repeats were generated using MegAlign.

A phylogenetic tree was constructed based on the alignment of the 26 core gene amino acid sequences found in IIV-9, IIV-6, IIV-3, Singapore grouper iridovirus (SGIV), lymphocystis disease virus 1 (LCDV-1), and infectious spleen and kidney necrosis virus (ISKNV) using MegAlign (DNAStar), with bootstrap trials set at 1,000. All core gene-encoded proteins were combined as one continuous amino acid sequence in the same gene order prior to assembly. This was compared to the partial major capsid protein tree as described in the work of Webby and Kalmakoff (38).

The complete genome was scanned for miRNA coding regions using VMir (14, 33) and possible miRNA coding sequences further analyzed by MiPred (22). All images were generated using Microsoft PowerPoint and/or Adobe Photoshop CS4.

MS analysis.

Purified IIV-9 virions or infected Sf21 cells harvested 24 h postinfection were denatured in SDS-PAGE sample buffer, and proteins were separated on individual 10% SDS-PAGE gels using standard techniques. The gels were stained with Coomassie G250 and protein lanes cut into five (for liquid chromatography coupled with electrospray ionization linear ion trap [LC-ESI LTQ] Orbitrap tandem mass spectrometry [MS/MS] analyses of IIV-9 virions and infected Sf21 cells) or eight (for LC–matrix-assisted laser desorption ionization–tandem time of flight [MALDI TOF/TOF] analysis of IIV-9 virions) equally sized fractions. Fractions were subjected to in-gel protein digestion with trypsin essentially by following the protocol of Shevchenko et al. (30), using a liquid handling robotic workstation (DigestPro MSi; Intavis AG, Cologne, Germany). Each digested fraction was concentrated using a centrifugal vacuum concentrator and reconstituted in a 10-μl aqueous solution of 2% (vol/vol) acetonitrile (ACN) supplemented with either 0.1% (vol/vol) trifluoroacetic acid (TFA) for LC-MALDI TOF/TOF analyses or 0.2% formic acid for LC-ESI LTQ Orbitrap analyses.

Structural proteins from purified IIV-9 virions were analyzed by LC-MALDI TOF/TOF MS and LC-ESI LTQ Orbitrap MS/MS, and proteins from infected Sf21 cells were analyzed by LC-ESI LTQ Orbitrap MS/MS according to the details of methods described in the supplemental material.

Peak lists were processed through the 4000 series Explorer software (Applied Biosystems, MA) for MALDI TOF/TOF data and the Proteome Discoverer 1.1 software (Thermo Scientific, San Jose, CA) for all ESI LTQ Orbitrap data using the software's default settings. All peak lists were then searched with an in-house Mascot server (version 2.1.0; Matrix Science) against an amino acid sequence database combining all predicted and translated IIV-9 ORF and all entries from the NCBI nonredundant sequence database, matching the taxa Lepidoptera and Drosophila melanogaster (downloaded January 2011; 355,290 sequence entries). Mascot search settings allowed for full tryptic peptides with up to 3 missed cleavage sites and variable modifications of carbamidomethyl (C), oxidation (M), and pyroglutamic acid (E, Q). The precursor and fragment mass tolerances were set to ±10 ppm and 0.8 Da for LTQ Orbitrap data and 75 ppm and 0.4 Da for TOF/TOF data. To evaluate the false-discovery rate (FDR), all peak lists were searched against a decoy database using identical search settings. The decoy database was built using the decoy database tool at the Trans-Proteomic Pipeline (TPP; Seattle Proteome Center), comprising the reversed sequence entries of the aforementioned combined database. The FDR was calculated by determining the number of false-positive peptide hits from the decoy search versus the number of peptide identifications from the true search using the same Mascot score as a significance threshold.

Only peptide hits with an individual ion score of >40 (Mascot significance threshold at a P of <0.05) were accepted as significant identifications. This resulted in an FDR of <0.02 for all searches. A significant protein identification required at least two significant peptide hits covering different sequences of the protein. In addition, a protein that was identified by a single peptide-based protein identification in one experiment (IIV-9 particles analyzed by LC-MALDI TOF/TOF or LC-ESI LTQ Orbitrap MS/MS or infected cells analyzed by LC-ESI LTQ Orbitrap MS/MS) that was also confirmed by a different peptide identification covering another sequence stretch in one of the other experiments was considered a significant multipeptide identification.

Nucleotide sequence accession number.

The IIV-9 genome has been deposited in GenBank under accession number GQ918152.

RESULTS AND DISCUSSION

Genome assembly and properties.

Sequencing of the IIV-9 genome using a 454 FLX sequencer generated 20,734 sequences totaling 5,597,884 bases of sequence with 50.4% and 49.6% sequence orientation biases, for an average coverage of 27-fold. The initial Newbler assembly generated 3 large and 10 small contigs that were subsequently assembled into a single contiguous sequence by targeted PCR-based cloning and sequencing. The initial contig boundaries were defined by repeat sequences that the assembler was unable to resolve. The genome was shown to be 205,791 bp in size, with a G+C content of 31% (Table 1). This genome size compares to estimates of 192.5 and 222.6 kbp, as estimated by restriction profiles using standard (37) and pulsed-field gel (39) electrophoresis, respectively. Based upon an estimated 4.7% terminal redundancy in the IIV-9 genome (39), this equates to approximately 9.7 kbp of redundant sequence. Due to the high A+T content in the genome and the challenge of resolving long single base runs using 454 technology, a total of 34 PCR-based clones were generated to resolve 57 potential base conflicts. All base calls were inspected visually and resolved as necessary. In silico restriction endonuclease profiles were compared to experimentally derived restriction endonuclease profiles (37) to confirm correct global assembly of the genomic sequence (data not shown).

Genome analysis identified a range of complex repeat sequences, including tandem, direct, dyad, and inverted repeats. The percentage of repeat sequences in the genome is dependent upon the stringency of parameters employed and ranges from 20 to 23% of the genome. The largest repeat identified is 3.4 copies of a 1,002-bp repeat between nucleotides 69621 and 73024, with a 75% consensus match. Identification of repeat sequences on the genome is illustrated by dot plot analysis (Fig. 2 A). The repeats highlighted in the boxed region of the genome shown in Fig. 2A represented 10 of the contigs generated in the initial sequence assembly.

Fig. 2.

Sequence repeats and IIV-9 versus IIV-3 gene parity plot analysis. (A) The IIV-9 genome was compared against itself by dot plot analysis to identify repeats within the IIV-9 genome. The major clusters of sequence repeats are boxed. (B) The IIV-9 and IIV-3 gene orders were compared by parity plot analysis. Where three or more genes are contiguous in both genomes, regardless of orientation, they have been boxed. Numbers on the x and y axes represent ORF numbers.

IIV-9 ORF and their predicted protein products.

Analysis of the complete genome predicted 191 predominantly nonoverlapping ORF encoding proteins of 50 aa or more in length with an AUG start codon, with the genome displaying a coding density of 90% (Fig. 3). The genome shows a bias in that 63% of genes were oriented in the reverse direction. In conjunction with the genome analysis, we conducted a proteomic analysis, first to confirm expressed ORF and second to establish the first profile of expressed IIV-9 ORF in both isolated virions and infected insect cells. Of the total of 191 ORF, 94 were identified in either isolated virions (64 ORF detected) or infected insect cells (72 ORF detected), with 42 being expressed in both (Table 2; see also Tables S1 to S3 in the supplemental material). The number of expressed proteins in isolated virions roughly correlates with 44 identified proteins in a previous proteomic study of SGIV particles (31). Open reading frames that are discussed in the following paragraph are marked with a superscript “p” if their expression has been confirmed by proteomics of isolated virions or with a superscript “i” if they were confirmed to be protein products in infected insect cells.

Fig. 3.

Open reading frame map of the IIV-9 genome. The 205,791-bp IIV-9 genome is represented as a solid line, and predicted open reading frames are indicated with arrows. Arrows representing genes in the forward (right) direction are stippled, and those in the reverse (left) direction are open. The 26 core IV genes are indicated with bold ORF numbering. Arrows with a bold outline are HTH 7 domain-containing orthologs of orf091L of IIV-3, and those with a broken outline are orthologs of IIV-6 468L. orf061R/L and -139R/L are almost fully overlapping genes facing in opposite directions and have been represented as both R and L forms.

Table 2.

IIV-9 predicted open reading frames

IIV-9 ORFa	Nucleotide positions	Length (aa)	Best match(es)b				Predicted motif and/or functione
			IIV protein(s)c	GenBank accession no.	BLASTP score	% aa identityd
001R	30–1223	397	IIV-3 004R; IIV-6 067R	YP_654576	466	62.6
002R	1238–1516	92					Signal peptide
003R	1741–1980	79
004L	2999–2037	320	IIV-3 005L	YP_654577	62	31.7	Signal peptide, RING finger
005R	3158–4705	515	IIV-3 006R; IIV-6 118L	YP_654578	582	56.9	NCLDV membrane protein
006L	6016–4757	419	IIV-6 468L*	NP_149463	285	44.9	Helix-turn-helix 7 motif
007R	6133–6459	108	IIV-6 248R; PBCV N288R	NP_149711	70	44.1	Transmembrane
008R	6587–7456	289	IIV-6 404L	NP_149867	102	32.5
009Lf	8013–7519	164	IIV-22 15.9 kDa; IIV-3 15R	P25097	134	48.6	15.9-kDa protein, 5′ MCP gene
010R	8235–9689	484	IIV-9-MCP; IIV-1 MCP; IIV-3 014L; IIV-6 274L	O39163	987	100.0	MCP
011L	9967–9782	61
012R	10245–11540	431	MAR 344; IIV-6 273R	NP_149736	108	47.0
013R	11545–11865	106					Transmembrane
014L	12780–11935	281	IIV-6 219L; IIV-3 036R,091L	NP_149682	239	51.8
015R	13053–13316	87	IIV-3 013L	YP_654585	84	55.8	Signal peptide
016R	13458–16700	1080	IIV-3 035R; IIV-6 179R	YP_654607	1154	51.2	Tyr protein kinase-like domain
017R	16743–17156	137	IIV-3 055R; IIV-6 349L	YP_654627	148	54.1	TF IIS C-terminal domain
018R	17457–17726	89	IIV-3 019R	YP_654591	55	52.8	Bro-N domain
019L	19158–17881	425	IIV-3 069L; IIV-6 198R	YP_654641	389	49.9
020R	19213–20130	305	Yersinia ruckeri chitinase	ZP_04617184	352	57.2	Chitinase, family 18 glycohydrolase
021R	20183–20626	147	IIV-3 057L	YP_654629	44	25.6
022R	20680–21762	360	IIV-3 056L; IIV-6 287R; MAR 339	YP_654628	301	44.7	Putative phosphodiesterase
023L	23370–21841	509	IIV-6 380R; IIV-3 010L,011L	NP_149843	367	45.0	Serine/threonine protein kinase
024R	23480–23920	146	IIV-6 293R	NP_149756	123	44.9
025R	24044–25165	373	IIV-3 012R; IIV-6 302L	YP_654584	322	47.6	C2H2 Zn finger
026R	25236–26552	438	IIV-6 468L*; IIV-3 093	NP_149463	306	44.9	Helix-turn-helix 7 motif
027L	26619–27086	155	IIV-3 085L; IIV-6 325L	YP_654657	188	58.4	Signal peptide
028R	27029–27229	66					Transmembrane
029R	27260–28093	277	IIV-3 054L	YP_654626	243	48.0
030Rf	28156–28518	120	IIV-3 102R; IIV-6 122R	YP_654674	119	55.0
031R	28627–29910	427	IIV-3 047R; IIV-6 337L	YP_654619	446	66.3	Transmembrane
032Lf	31068–30394	224	IIV-3 021L	YP_654593	194	55.6	C3HC4 RING finger/BIR
033L	31730–31113	205	IIV-3 022L	YP_654594	142	45.4	Transmembrane
034L	32649–31816	277	IIV-3 101R; IIV-6 142R	YP_654673	430	75.8	RNase III
035L	34117–32813	434	IIV-6 468L*	NP_149463	295	43.8	Helix-turn-helix 7 motif
036Lf	34736–34176	186	IIV-3 104L; IIV-6 355R	YP_654676	271	66.7	Phosphatase
037R	34846–35577	243	IIV-3 105R; IIV-6 359L	YP_654677	330	65.3
038L	37133–35655	492	IIV-6 159L,219L,261R,443R; IIV-3 091L,36R	NP_149622	135	33.3
039L	38695–37220	491	IIV-6 159L,219L,261R,443R; IIV-3 091L	NP_149622	151	36.1
040R	38826–40250	474	IIV-3 106R; IIV-6 030L	YP_654678	629	63.9	ATP-dependent exo-DNase α subunit
041R	40283–41143	286					Transmembrane
042L	41817–41188	209	IIV-3-071L; IIV-6 259R	YP_654643	285	68.4	Transmembrane
043R	42393–42890	165	IIV-3 020R; IIV-6 196R	YP_654592	195	59.9	Thioredoxin domain/isomerase
044L	43528–42923	201	IIV-3 097L; IIV-6 170L; MAR 216	YP_654669	228	55.0	Holliday junction resolvase
045Rf	43660–44226	188	PBCV N269L	XP_973701	137	44.4	Putative dUTPase
046R	44338–45663	441	IIV-6 468L*; IIV-3 093L	NP_149463	294	42.0	Helix-turn-helix 7 motif
047L	45971–45708	87					Transmembrane
048R	46162–47862	566	IIV-3 059L; IIV-6 012L	YP_654631	729	63.9	XRN 5′–3′ exonuclease
049R	48016–48504	162
050R	48602–49111	169	IIV-3 032R	YP_654604	43	31.2
051L	49744–49310	144	IIV-3 058R, IIV-6 391R	YP_654630	200	65.3
052L	50273–49851	140	IIV-6 413R; IIV-3 021L				RING/U box motif
053R	50475–51242	255	IIV-3 060L; PBCV A193L	YP_654632	254	56.0	Proliferating cell nuclear antigen
054R	51304–52656	450	IIV-6 468L*	NP_149463	303	45.4	Helix-turn-helix 7 motif
055L	55623–52687	978	IIV-3 087L; IIV-6 022L	YP_654659	1258	63.5	DEAD/H motif/putative NTPase
056R	55805–56563	252	IIV-3 070L; IIV-6 306R	YP_654642	240	59.7	SWIB/MDM2 domain
057R	56642–57964	440	Acanthamoeba polyphaga mimivirus L12	YP_142366	152	26.7
058L	59618–58074	514	IIV-3 098L; IIV-6 493L	YP_654670	627	60.9	Serine/threonine protein kinase
059R	59726–61090	454	IIV-3 039R; IIV-6 393L	YP_654611	501	55.3
060Rf	61210–61602	130	Ixodes scapularis RNA-binding protein; IIV-6 340R	EEC17992	53	26.7	dsRNA binding protein
061L	61781–61599	60
061R	61662–61832	56
062R	61866–62225	119	IIV-3 041R; IIV-6 453L	YP_654613	152	59.7	Thioredoxin domain
063R	62315–63559	414	IIV-6 420R*	NP_149883	204	33.9
064Lf	64363–63656	235					Transmembrane
065R	64427–66082	551	IIV-3 038R; IIV-6 098R	YP_654610	589	53.2
066L	66388–66197	63	IIV-3 043R; IIV-6 010R	YP_654615	101	67.2	Transmembrane
067L	69088–66401	894	IIV-3 091L; IIV-6 443R,261R,396L	YP_654663	447	43.0
068L	75310–69158	2050	IIV-3 091L; IIV-6 443R,261R	YP_654663	256	33.9	Transmembrane
069R	75461–77572	703	IIV-3 074L; IIV-6 268L	YP_654646	617	50.5
070R	77864–80311	815	IIV-16-RNR; IIV-3 065R; IIV-6 085L	AAY24450.1	559	71.4	RNR large-chain precursor/intein
071R	80408–81727	439	IIV-6 468L*; IIV-3 093L	NP_149463	289	43.7	Helix-turn-helix 7 motif
072L	82690–81764	308	IIV-3 091L,036R,008L; IIV-6 219L,443R	YP_654663	114	40.0
073Lf	83243–82767	158	IIV-3 042R; IIV-6 136R	YP_654614	192	59.2
074L	84548–83364	394	IIV-3 079L; IIV-6 282R	YP_654651	535	69.8	Poxvirus very late transcription factor
075R	84711–85385	224	IIV-3 080R	YP_654652	181	43.8	NUDIX hydrolase domain
076R	85649–86833	394	Mimivirus L5, L12, R821, R865, L754, R433 protein	YP_142359	151	30.3	Bro domain
077R	86853–87038	61
078L	87331–87053	92					Signal peptide
079R	87349–88107	252	IIV 3088R; IIV-6 075L	YP_654660	410	77.9	NTPase domain
080L	88717–88181	178	Histones	Q27443	55	17.5	H4 and H3 histone domains
081R	88803–89180	125	Pseudoalteromonas haloplanktis TAC125	YP_339369	92	48.0	GIY-YIG endonuclease
082L	90202–89231	323	IIV-3 044L	YP_654616	333	51.7	Protein kinase domain
083R	90412–90696	94	IIV-3 045R	YP_654617	127	70.0
084R	90821–92098	425	IIV-6 229L; IIV-3 046R	NP_149692	389	47.6
085R	92175–92822	215	IIV-6 378R,232R; IIV-3 100L	NP_149841	216	69.4	2-Cys adaptor domain
086L	93855–92863	330	IIV-3 099R; IIV-6 329R	YP_654671	249	48.0
087R	94000–95811	603	IIV-3 019R; IIV-6 420R	YP_654591	318	56.4	Bro-N domain
088L	96116–95925	63					Transmembrane
089R	96461–99868	1135	IIV-3 086L; IIV-6 045L	YP_654658	1401	62.0	DNA topoisomerase II
090R	99858–100511	217	IIV-3 064L	YP_654636	88	27.2
091L	101269–100583	228	IIV-3 063R; IIV-6 309L	YP_654635	170	47.6
092R	101417–102835	472	IIV-6 420R*; IIV-3 019R,093L	NP_149883	283	40.8
093L	103109–102885	74
094L	104606–103173	477	IIV-3 061R; IIV-6 467R	YP_654633	346	39.5
095R	104681–105583	300	Bombyx mori thymidylate synthase	XP_001033394	322	52.8	Thymidylate synthase
096R	105651–107114	487	IIV-3 019R,093R; IIV-6 420R*	YP_654591	248	39.5
097R	107167–108060	297	IIV-3 028R	YP_654600	191	39.7
098R	108107–108679	190	IIV-3 029R; IIV-6 143R	YP_654601	231	55.0	Deoxyribonucleoside kinase
099L	109129–108725	134	IIV-3 030L	YP_654602	109	42.3
100R	109185–109688	167	IIV-3 031R: IIV-6 115R	YP_654603	84	32.4
101R	109843–110592	249	IIV-3 032R	YP_654604	139	33.5
102R	110660–110956	98	Macaca mulatta regulatory subunit	XP_001097695	60	35.4	Protein phosphatase 1C binding
103R	110998–112287	429	IIV-6 468L*; IIV-3 093L	NP_149463	288	43.6	Helix-turn-helix 7 motif
104L	112901–112320	193	IIV-3 033L: IIV-6 307L	YP_654605	222	61.5	Signal peptide, transmembrane
105Rf	113487–114305	272	IIV-3 034R; IIV-6 077L	YP_654606	164	38.6	C3H1 Zinc finger
106R	114438–116879	813	IIV-3 094L; IIV-6 050L	YP_654666	509	34.9
107R	117308–117733	141	IIV-3 053L	YP_654625	143	51.1
108L	118009–117770	79
109R	118083–119972	629	IIV-3 052L; IIV-6 205R	YP_654624	387	41.3	NAD-dependent DNA ligase
110R	120070–121347	425	IIV-3 007R	YP_654579	415	52.6
111L	121746–121513	77					Signal peptide
112L	123866–121758	702	IIV-3 091L; IIV-6 443R,261R,396L,219L,159L	YP_654663	226	43.1
113R	123945–127328	1127	IIV-3 009R; IIV-6 428L	YP_654581	1801	77.2	DNA-dependent RNA Pol subunit 2
114R	127384–127998	204	IIV-6 404L	NP_149867	238	60.5
115L	129575–128067	502	IIV-3 051L; IIV-6 213R	YP_654623	141	46.3
116Rf	129723–133142	1139	IIV-3 120R; IIV-6 037L	YP_654692	1503	66.1	DNA polymerase
117R	133208–133576	122	IIV-6 049L	NP_149512	88	41.5	Transmembrane
118R	133691–135031	446	IIV-6 468L*	NP_149463	277	39.7	Helix-turn-helix 7 motif
119R	135057–135410	117
120R	135520–138408	962	IIV-3 121R; IIV-6 184R	YP_654693	1342	69.2	Helicase/primase
121R	138595–138990	131	Amsacta moorei entomopoxvirus AMV-075	NP_064857	107	45.8
122L	139310–139029	93	IIV-3 126R	YP_654698	91	48.4	Transmembrane
123L	140261–139410	283	IIV-3 125R	YP_654697	271	49.5
124L	144216–140356	1286	IIV-6 443R,261R,396L; IIV-3 091L	NP_149906	587	47.5
125L	144906–144316	196	IIV-3 124R	YP_654696	112	42.3
126R	144925–145308	127	IIV-3 123L	YP_654695	80	39.5
127L	145500–145342	52					Transmembrane
128R	145520–145729	69	IIV-3 117L	YP_654689	35	34.4
129R	145818–148631	936	IIV-1 L96; IIV-3 084L; IIV-6 232R	P22856	927	70.0	OTU-like cysteine protease
130R	148675–149193	172	IIV-3 083L; IIV-6 358L	YP_654655	95	34.7
131R	149308–150282	324	IIV-6 420R*	NP_149883	179	36.5
132R	150254–150514	86
133R	150722–151150	142	IIV-3 082L	YP_654654	82	34.5
134L	151813–151349	154	IIV-3 096R; IIV-6 347L	YP_654668	108	40.5	ErvI/Alr sulfhydryl oxidase domain
135R	151908–152948	346	Acyrthosiohon pisum metalloprotein; IIV-3 095L	XP_001945941	189	38.5	Matrix metalloproteinase
136L	154120–153011	369	IIV-3 091L,036R,008L; IIV-6 443R,219L,317L	YP_654663	132	34.0
137L	154906–154187	239	IIV-3 067L; IIV-6 197R	YP_654639	264	54.0	Protein tyrosine phosphatase
138R	155025–156068	347	IIV-3 078R; IIV-6 244L	YP_654650	402	56.4	Phosphodiesterase domain
139L	156398–156222	58
139R	156283–156492	69
140L	157089–156538	183	IIV-3 073R, IIV-6 234R	YP_654645	134	48.0	Transmembrane
141R	157589–158050	153	IIV-3 072L; IIV-6 374R	YP_654644	188	60.1
142R	158110–159399	429	IIV-6 468L*; IIV-3 093L	NP_149463	333	48.0	Homeodomain
143L	162815–159438	1125	IIV-3 016R; IIV-6 295L	YP_654588	1079	49.9
144R	162892–164241	449	IIV-6 468L*	NP_149463	308	45.2	Homeodomain
145Rf	164430–165746	438	IIV-6 161L; IIV-3 109L,108L	NP_149624	342	44.0	Helicase
146R	165859–166065	68	IIV-6 212L,211L	NP_149675	40	39.7
147R	166109–166318	69	IIV-6 388R*; IIV-3 093L	NP_149851	43	42.9
148L	167577–166534	347
149L	168222–167611	203	IIV-3 066L; IIV-6 357R	YP_654638	102	30.9	Transmembrane
150R	168376–170697	773	IIV-3 113L; IIV-6 155L,149L	YP_654685	809	53.7
151L	171154–170834	106	IIV-3 112R; IIV-6 466R	YP_654684	101	48.1	Transmembrane
152L	171684–171214	156	IIV-3 111R, IIV-6 414L	YP_654683	203	63.7	NUDIX hydrolase domain
153R	171761–172324	187	IIV-3 001R; IIV-6 395R	YP_654573	104	47.3
154L	173033–172515	172	IIV-3 092R; IIV-6 454R	YP_654664	206	61.9	RPB5 domain
155L	173580–173080	166	Burkholderia oklahomensis EO147; MAR 217	ZP_02357920	80	31.9	dNMP kinase
156L	174825–173689	378	Dictyostelium discoideum AX4	XP_636066	88	24.3
157R	175059–175748	229	IIV-3 032R	YP_654604	94	32.3
158R	175933–176637	234	Ixodes scapularis E3 UBQ ligase	EEC07169	48	24.7	RING finger
159R	176791–177318	175	IIV-3 018L; IIV-6 415R	YP_654590	157	50.6
160R	177923–179023	366	IIV-3 076L; IIV-6 369L	YP_654648	372	52.2	XPG-like protein (excision repair)
161R	179110–179382	90
162R	179441–179710	89
163L	180006–179749	85
164L	181405–180044	453	A. polyphaga mimivirus L5,L12	YP_142359	176	30.6	Bro-N domain
165R	181529–185557	1342	IIV-3 090L; IIV-6 176R	YP_654662	1964	72.3	DNA-depependent RNA Pol II large subunit
166L	186055–185801	84	IIV-3 089L	YP_654661	44	48.8
167L	186230–186060	56					Transmembrane
168R	186298–187545	415	IIV-6 420R*	NP_149883	181	33.8
169L	188173–187583	196	IIV-3 068R; IIV-6 401R	YP_654640	343	84.7	HMG box
170Rf	188324–188803	159	Apis mellifera	XP_624869	121	43.4	Dual-specificity phosphatase
171R	188941–189651	236	IIV-3 116R	YP_654688	46	20.2
172L	190186–189704	160	IIV-3 119R	YP_654691	73	48.0
173R	190308–190547	79	IIV-6 420R,200R	NP_149883	55	40.5
174L	190957–190700	85	IIV-3 115R; IIV-6 342R	YP_654687	97	64.5
175R	191065–191487	140	IIV-3 114L	YP_654686	51	27.2	Signal peptide
176R	191553–192140	195	IIV-3 081L	YP_654653	97	34.7	FasI domain
177R	192245–193678	477	IIV-3 024R; IIV-6 361L,224L	YP_654596	539	56.3	Cathepsin
178R	193729–194130	133
179R	194134–194400	88
180L	195002–194424	192	CfDEF NPV 110; Eppo NPV 102	NP_932719	182	46.1
181R	195132–196025	297	IIV-3 017R; IIV-6 335L	YP_654589	320	60.4
182R	196333–197700	455	IIV-6 468L*	NP_149463	282	40.0	Helix-turn-helix 7, homeodomain
183R	197801–198733	310	IIV-3 107R; IIV-6 117L	YP_654679	232	54.4	Transmembrane
184L	199094–198795	99	IIV-3 023R	YP_654595	145	68.4
185R	199157–199636	159	IIV-3 050L	YP_654622	162	63.6
186L	202115–199674	813	IIV-3 049R	YP_654621	95	18.0
187R	202220–203323	367	IIV-3 048L; IIV-6 376L	YP_654620	581	72.2	RNR small subunit
188R	203536–204051	171	IIV-3 025R; IIV-6 111R	YP_654597	87	33.5	Transmembrane
189R	204093–204767	224	IIV-3 026R; IIV-6 350L	YP_654598	296	67.6
190R	204824–205276	150	IIV- 027R; IIV-6 157L	YP_654599	73	31.8	C3HC4 RING finger
191L	205760–205347	137

^aIIV-9 open reading frame number. Proteins identified by the proteomic experiments are indicated by bold ORF numbers for the purified IIV-9 particles and by underlined ORF numbers for infected cells. Note that the protein products of 071R and 182R were identified by the same set of peptides and can therefore not be distinguished unambiguously by the proteomic analysis.

^bMost closely related gene by BLASTP analysis.

^cMatching IIV proteins, with the first-listed protein being the most closely related. Non-IIV proteins with a high similarity score to an IIV-9 protein by BLASTP analysis are indicated. NCLDV species abbreviations are PBCV, Paramecium bursaria chlorella virus, and MAR, Marseilles virus. CfDEF NPV, Choristoneura fumiferana nucleopolyhedrovirus; Eppo NPV, Epiphyas postvittana nucleopolyhedrovirus.

^dAmino acid percent identity for most closely related protein. * indicates similarity to the cluster of proteins encoded by IIV-6 468L and its homologous genes in IIV-6.

^eTF IIS, transcription factor IIS; BIR, baculovirus inhibitor of apoptosis protein repeat; Bro, baculovirus repeated ORF; NUDIX, nucleoside diphosphate linked.

^fProtein identified by a single peptide hit.

The genome orientation and gene designation were defined by the start codon of the IIV-9 orf001R ortholog of the first conserved iridovirus core gene in mosquito IIV-3 (orf004R [5]). Four short ORF (orf007, -088, -061, -139) that were represented by dual heavily overlapping ORF in opposite orientations could not be resolved as forward or reverse by bioinformatics analysis alone. orf007 and -088 were subsequently designated orf007R^p and -088L^p based on the identification of their protein products by the proteomic analysis (Table 2; see also Table S1 in the supplemental material). The remaining two ORF could not be resolved, and hence, both overlapping ORF were designated orf061R and -061L or -139R and -139L, respectively.

The majority of IIV ORF have no predicted function. However, a wide range of predicted proteins showed similarity to proteins involved in nucleotide metabolism and DNA replication. These include enzymes required for deoxyribonucleotide synthesis, such as thymidylate synthase (095R), dUTPase (045R), deoxyribonucleoside kinase (098R), and both the large and small subunits of ribonucleotide reductase (070Rⁱ, 187Rⁱ). The last two have been confirmed as expressed proteins in infected cells. There are two putative NUDIX hydrolase proteins (075R and 152L), and these may play an important role in regulating nucleotides in the host cell. Delhon et al. (5) postulated that the IIV-3 ortholog of 075R (IIV-3 080R) might act similarly to the vaccinia virus NUDIX ortholog (with a D10R mutation) and function as a repressor of transcription and translation. The reported presence of an intein in the large subunit of ribonucleotide reductase (orf070Rⁱ) was confirmed (10).

Forty-four genes that could be postulated to have a role in DNA metabolism or DNA replication were identified. These include viral DNA ligase (109R), DNA polymerase (116R), helicase/primase (120R,145R), PCNA (053R), endonuclease (081R), DNA exonuclease (040R), topoisomerase II (089Rⁱ), and phosphodiesterase (022Rⁱ) genes. However, only topoisomerase II (089Rⁱ) and phosphodiesterase (022Rⁱ) have been identified in infected cells. Genes encoding putative chromatin-binding regions, such as SWID/MDM2 (056R^pi) and HMG box domains (169L^pi), are also present. Although it is not known if these affect the host or viral genome structure, the identification of both proteins in isolated virions suggests a possible association with the viral genome.

This study is the first to identify a putative chitinase gene (020Rⁱ) in an IIV. Analysis of this chitinase indicates that it is a member of the family 18 glycohydrolases (exochitinases) and is most closely related to the chitinase of a bacterial pathogen of fish, Yersinia ruckeri (57% identity), and to the chitinases of other bacteria and slime molds. Baculovirus chitinases, along with cathepsin, have been shown to be important in facilitating the release of virus from the host (15). Despite the IIV-9 chitinase displaying less than 20% identity to baculovirus chitinases, the presence of a viral cathepsin (177R^pi) in IIV-9 may reflect similar roles of chitinase and cathepsin, acting in concert to degrade the insect, thereby facilitating viral release and dissemination from the host insect (15). Both enzymes were identified in IIV-9-infected insect cells by our proteomic analysis.

Expressed orf180L^pi also encodes a protein with strong similarity to baculovirus genes, possessing 46% identity and 66% similarity to orf110 of Choristoneura fumiferana nucleopolyhedrovirus (CfDEF NPV). A related gene is also present in IIV-6 (422L), and alignment of CfDEF NPV orf110, Epiphyas postvittana NPV orf102, and the IIV-9 and IIV-6 proteins shows the presence of a highly conserved pan-caspase DEVD cleavage site. It is not known if this exploits caspase activity for processing or if it might regulate apoptosis. A further enzyme identified in IIV-9 is a putative ErvI/augmenter of liver regeneration (ALR) sulfhydryl oxidase (134L^p). This protein is common in large cytoplasmic DNA viruses (29), and in common with poxviruses, this was found in the IIV-9 virus particle. The role of this enzyme activity is unclear but has been postulated to work in concert with glutaredoxin or thioredoxin systems for regulating cytoplasmic disulfide bonds and protein folding. IIV-9 encodes two proteins with putative thioredoxin domains, 043R^p and 062R^pi, both of which were identified in the virus particle.

The repeat sequences identified in the genome are located predominantly in coding regions. This is reflected in the presence of multiple copies of closely related genes on the genome (see Fig. S1 and S3 in the supplemental material). IIV-9 orf006L^pi, -026R, -035L, -046Rⁱ, -054Rⁱ, -071Rⁱ, -103R, -118R, -142R, -144Rⁱ, and -182Rⁱ form one cluster of paralogs, as reflected in amino acid identities ranging from 60 to 84% between the encoded proteins (see Fig. S1 in the supplemental material). With InterProScan, all of these proteins were predicted to contain helix-turn-helix 7 (HTH 7 [Pfam 02796]) motifs and/or the more stable homeodomain motifs that are involved in DNA binding, with a wide spectrum of roles, ranging from transcription regulation to DNA repair (1). These proteins may have a role in the regulation of viral gene expression or viral genome replication, with an array of closely related proteins being involved in sequence-specific fine-tuning of the viral gene cascade. An alternative role could be in the resolution of the branched complexes generated during IV genome replication, although it is not clear why so many copies would be required.

In addition, IIV-9 orf063R, -131R, and -168R (53 to 79% identity) form a less well conserved cluster of proteins (Fig. 3; see also Fig. S2 in the supplemental material) whose genes display some motif conservation to orf092R and -096R (46% identical). No motifs or predicted functions were identified for this cluster of repeated genes, but by BLAST analysis, they were distantly related to the same helix-turn-helix cluster of genes identified above.

Analysis of the protein of orf068L^p, which is indicated by the double-boxed repeat highlighted in Fig. 2A, using the XSTREAM protein tandem repeat finder (27) identified 4.8 copies of a 131-aa repeat at aa 104 to 731 (Fig. 4 A) and an immediately adjacent repeat consisting of 14.4 copies of an 84-aa repeat at aa 714 to 1922 (Fig. 4B). The respective C- and N-terminal flanks of the repeats overlap. The orf067L^pi protein possesses a repeat related to that illustrated in Fig. 4A (Fig. 4C). Both proteins have a high level of predicted β-sheet composition, and both were identified in the virus particle. The high β-sheet structure is similar to what is found in a range of fiber structures, such as bacteriophage fibers and tubulin. BLAST analysis of a single copy of the 131-aa repeat identified a very weak match between a short sequence located around the conserved PDATT motif and bacteriophage fiber proteins (data not shown). However, the location of orf067L^pi and orf068L^p in the particle is unknown, and hence a possible role in the surface fibril cannot be confirmed. An ortholog of this protein is in IIV-3 (091L) and IIV-6 (443R) but is not conserved in vertebrate IV, which would be consistent with the lack of surface fibrils on the vertebrate IV.

Fig. 4.

Tandem protein repeats in the proteins of orf068L and -067L. The repeat regions from aa 104 to 731 (A) and 714 to 1922 (B) of the orf068L protein are shown with residues matching the consensus (shaded). Underlined residues are the same amino acids. (C) The repeat sequence within the orf067L protein is shown aligned with the orf068L protein repeat shown in panel A (boxed underneath). The starred Y's are the same residue (to orient the 068L and 067L repeats).

Relationship to other viruses.

Of the 191 ORF predicted in IIV-9, 108 were most closely related to IIV-3 ORF (Table 2), indicating that IIV-9 is more closely related to the chloriridovirus IIV-3 than to IIV-6. Analysis of IIV-3 shows that 114 of the 126 ORF in IIV-3 (5) were identified as having an ortholog in IIV-9. In contrast, IIV-6 (Iridovirus genus) has 211 ORF, as defined by Eaton et al. (8), of which only 97 have orthologs in IIV-9. A total of 88 ORF are common to all 3 fully sequenced IIV. Interestingly, of the 45 ORF without an ortholog in other IV, 23 encoded proteins that were smaller than 100 amino acids, of which four (002R, 088L, 093L, 111L) were confirmed as expressed proteins by the proteomic analysis. In contrast to the high level of conserved genes between IIV genomes, there is a very low level of conservation in gene order. Comparison to IIV-3 with a gene parity plot (Fig. 2B) indicates only 5 clusters of 3 or more genes, with the largest conservation of gene order and orientation being a cluster of 5 genes represented by IIV-9 097R,101R and IIV-3 028R,032R (Table 2). IIV-9 and IIV-6 genomes possess no more than two genes that are conserved in order in any one cluster.

The 26 core genes previously identified as being conserved in all iridoviruses (8) were identified in IIV-9, and consistently with other genes in the genome, no conservation of gene order was apparent for these conserved genes. Phylogenetic analysis of the coding sequences for all 26 genes collated as a concatenated protein sequence for each of IIV-9, IIV-6, IIV-3, SGIV, LCDV-1, and ISKNV (Fig. 1B) shows the clear separation of the vertebrate and invertebrate IV. In addition, the core set provides strong evidence for the main features of the phylogenetic trees established for the partial MCP sequence (Fig. 1A) (38), with IIV-6 being in a separate clade and IIV-3 being more closely related to the major clade of IIV than its current taxonomic position in a separate genus suggests.

There were 36 NCLDV genes identified in the genome, including nine conserved orthologs found in all NCLDV (19) and seven that were present in all four families but that are missing from some lineages within those families. IIV-9 057R, 076R, and 164L were most closely related to predicted proteins of unknown function from Acanthamoeba polyphaga mimivirus.

miRNA coding prediction.

The analysis of miRNA shows an increasing complexity of viral interactions with this posttranscriptional control system, including the control of host and viral genes. Roles have included the establishment of latency and the avoidance of mammalian immune responses, as well as manipulation of the cellular environment to facilitate replication. Examples of viral miRNA to date have predominantly focused upon viruses that are relatively slow in their replication, such as the herpesviruses, and upon the role of virally encoded miRNA in latency. Because IIV have a nuclear replication phase, are relatively slow growing, and often have a range of sublethal effects upon their host insect, they are potential candidates for encoding miRNA.

Combined analysis for pre-miRNA sequences using VMir and MiPred generated seven possible pre-miRNAs (Table 3). All were located within open reading frames of unknown function, and five had no predicted motifs observable. Three putative pre-miRNAs were identified in the same orientation as the associated ORF, and four were in the opposite orientation. The absence of host cell sequence information makes identification of potential host target genes unfeasible. An XRN exonuclease gene (048R) is predicted on the genome of IIV-9, with orthologs in IIV-3 and IIV-6. This enzyme has a role in the processing of miRNA, in particular, the degradation of mature miRNA (24); hence, even if IIV genomes do not encode miRNAs, there is a strong likelihood that IIV interact with small noncoding RNA systems within the cells that they infect.

Table 3.

Predicted pre-miRNA sequences in the IIV-9 genome^c

miRNAa	Start siteb	Apex nucleotide	Sequence (5′–3′) (length [bp])	VMir score	% G+C	MiPred MFE	P value	MiPred % conf
MR171	11099	1134	CAAAGUCGACUCUUCCACUCGGAAAUGUGAAUGGUUUCCGAGUAAAAGCUGAAGAAAUGACUUUG (65)	130	42	−23.6	0.001	63
MR529	31179	31212	AAUGGGGUGUGUGAUGGAAUUGGAUUACCCACCCUUAUUUUAGGGUGGGUAAUUUUGUAUUACACUUUUGA (71)	181	38	−31	0.001	75
MR598	35790	35822	GGGUUGUGGGAGAGCCAACUGGAUCUACAUAUGUAGAUCCAGCUUGGGAUACAUCUACAGC (61)	127	48	−27.9	0.001	66
MD653	37793	37835	UGAGUAUUAUCAGCUUUUACCAAAGAUGCUGGAUCUACAAUUAACGUUGGACUAGCACCAGCUGAUAAACUUAAA (75)	127	36	−21.6	0.001	63
MR1469	89360	89395	UUUGGUAUUAUGUUGCACUUUUUAACCUUGAUGAAAUAUCCUUUUUUACGAGAAGAAGAAGUGCUCGAGUAUCA (74)	150	32	−20.2	0.005	63
MD2135	128453	128488	GGUGAUGUAAUCUGUGGAAUAACUCUGUUUAGUUUUUUUAGACAUUUGUUCAACAAAGAUUAAAUCGUCACCGU (74)	141	34	−22.9	0.001	69
MR2250	135129	135164	CGCCAUUAUAAUCAUUUUUAUAGUGGAUAGACUCCAAACUAUCAUUGUUCAAAUGAUUAUAAGAACCGG (69)	148	30	−18.6	0.001	64

^aR indicates that pre-miRNA is derived from the reverse genomic strand, and D indicates the direct genomic strand. The number refers to the pre-miRNA identified from the initial screen of the entire genomic sequence by VMir.

^bFirst nucleotide position of the pre-miRNA in the IIV-9 genome.

^cThe minimum free energy (MFE), P value, and percent confidence (conf) were determined by MiPred.

The presence of an RNase III gene (orf034L) that has also been identified in IIV-3, IIV-6, and vertebrate IV (45), and a dsRNA binding protein (060R; IIV-6 340R), supports a role for noncoding RNA in IV replication. RNase III was identified in purified virus particles and infected cells by our proteomic experiments (Table 2; see also Tables S1 and S3 in the supplemental material) and was previously identified in particles of SGIV (31), confirming that this protein is produced and, hence, likely to have a role in IV replication. miRNA has also been predicted for soft-shelled turtle iridovirus (STIV) (18), and the presence of miRNAs has recently been confirmed for SGIV (44).

Conclusions.

IIV-9 is a member of the major IIV (group II) clade, and the complete genome provides insight into the relationships within and between IIV genera. The apparent close relationship to IIV-3, a virus from a separate genus, and the more distant relationship to IIV-6 have been confirmed through full-genome analysis. The genome encodes a wide range of proteins for which there is no functional prediction, and many of these are found in the complex virus particle. The presence of paralog proteins on the genome is a major contributor to the high incidence of repeat sequences associated with the genome, unlike with IIV-3, where the repeats are more likely to be in noncoding regions (5). The clustering of repeats within predominantly the β-sheet proteins suggests that these proteins may form filamentous structures that are associated with the virus particle and, as such, are candidates for the surface fibrils identified on IIV-9 particles. As for other IV, a large number of proteins are predicted to be involved in nucleotide regulation and genome replication, consistent with a life cycle that includes DNA replication in both the cytoplasm and nucleus and the branched concatemeric replication strategy of IV, which requires resolution of complex genome structures (11).