Abstract
Wildtype p53-Induced Phosphatase 1 (WIP1) is a serine/threonine phosphatase that dephosphorylates proteins in the ataxia telangiectasia mutated (ATM)-initiated DNA damage response pathway. WIP1 may play a homeostatic role in ATM signaling by returning the cell to a normal pre-stress state following completion of DNA repair. To better understand the effects of WIP1 on ATM signaling, we crossed Atm-deficient mice to Wip1-deficient mice and characterized phenotypes of the double knockout progeny. We hypothesized that the absence of Wip1 might rescue Atm deficiency phenotypes. Atm null mice, like ATM-deficient humans with the inherited syndrome ataxia telangiectasia, exhibit radiation sensitivity, fertility defects, and are T-cell lymphoma prone. Most double knockout mice were largely protected from lymphoma development and had a greatly extended lifespan compared to Atm null mice. Double knockout mice had increased p53 and H2AX phosphorylation and p21 expression compared to their Atm null counterparts, indicating enhanced p53 and DNA damage responses. Additionally, double knockout splenocytes displayed reduced chromosomal instability compared to Atm null mice. Finally, doubly null mice were partially rescued from infertility defects observed in Atm null mice. These results indicate that inhibition of WIP1 may represent a useful strategy for cancer treatment in general and A-T patients in particular.
Keywords: WIP1, PPM1D, ATM, ataxia telangiectasia, p53, thymic lymphoma
Introduction
The capacity of cells to recognize and repair DNA damage is crucial for maintaining genomic stability and preventing cancer. The importance of DNA damage response mechanisms is made obvious when one of its key components is rendered defective in human genetic disorders such as ataxia-telangiectasia (A-T). A-T is a rare autosomal recessive syndrome characterized by progressive neurodegeneration, radiosensitivity, immune dysfunction, cell-cycle checkpoint defects, genomic instability, and an increased predisposition to cancer (Chun and Gatti, 2004). Shiloh and co-workers first cloned the defective gene responsible for A-T, the ataxia telangiectasia mutated (ATM) gene (Savitsky et al., 1995). Most mutations in the ATM gene result in an absence of a full-length, functional protein product (Chun and Gatti, 2004).
ATM is one of six members of the phosphoinositide 3-kinase-related protein kinase (PIKK) family that include other DNA damage response sensors such as ATM and Rad3-related protein (ATR) and DNA dependent protein kinase catalytic subunit (DNA-PKcs). The ATM gene encodes a serine/threonine kinase that is a critical DNA damage sensor that activates cell cycle control and DNA repair pathways (Shiloh, 2003; Lavin, 2008; Abraham, 2001). ATM phosphorylates and activates numerous target proteins involved in initiation and maintenance of cell cycle checkpoints such as CHK2, p53, MDM2, SMC1, and CDC25C (Shiloh, 2003). The phosphorylation of p53 at serine 15 and at serine 20 via activation of CHK2 are important components of ATM signaling, as p53 is a critical modulator of both the G1 and G2/M checkpoints (Appella and Anderson, 2001).
One important tool aiding our understanding of ATM functions has been the development of Atm null mice, which recapitulate many of the phenotypes that are observed in A-T patients (Xu et al., 1996; Barlow et al., 1996; Elson et al., 1996; Herzog et al., 1998). Like A-T patients, Atm null mice are prone to developing T-cell lymphomas. Atm−/− mice usually die between 3-6 months of age (Xu et al., 1996; Barlow et al., 1996; Elson et al., 1996). Additionally, Atm null mice are hypersensitive to radiation, are infertile, have immune system abnormalities, motor coordination defects, and a reduced body size (Barlow et al., 1996; Xu et al., 1996; Rotman and Shiloh, 1998; Westphal et al., 1997; Elson et al., 1996; Herzog et al., 1998).
The ATM-initiated kinase cascade activates cell cycle checkpoints and DNA repair pathways. But once the damage is repaired, how is the cell returned to a pre-stress state? Phosphatases are obvious candidates as homeostatic regulators of ATM-initiated phosphorylations. One such candidate is the Wild-type p53-induced phosphatase 1 (WIP1), a type 2C serine/threonine phosphatase that is induced in response to DNA damage in a p53-dependent manner (Fiscella et al., 1997). WIP1 dephosphorylates multiple proteins in the ATM/ATR DNA damage response pathway, such as CHK1, CHK2, p53, MDM2, and H2AX (Takekawa et al., 2000; Lu et al., 2005a; Lu et al., 2007; Fujimoto et al., 2006; Shreeram et al., 2006a; Macurek et al., 2010; Moon et al., 2010). WIP1 dephosphorylates the same sites (pS/pTQ motifs) that are phosphorylated by ATM and ATR. Moreover, WIP1 dephosphorylates ATM itself and suppresses its activity (Shreeram et al., 2006a). Importantly, WIP1 suppresses p53 by multiple mechanisms, including dephosphorylation of p53 kinases (ATM, CHK1, CHK2) (Lu et al., 2005b; Shreeram et al., 2006b; Fujimoto et al., 2006), p53 itself (at serine 15) (Lu et al., 2005b), and MDM2, which facilitates MDM2-mediated degradation of p53 (Lu et al., 2008). We hypothesize that WIP1 facilitates reversal of the ATM/ATR-initiated kinase cascade and reverts the cell to a pre-stress state following completion of DNA repair (Lu et al., 2008).
WIP1 has been shown to be an oncogene and is amplified and overexpressed in several human tumor types (Bulavin et al., 2002; Li et al., 2002; Hirasawa et al., 2003; Saito-Ohara et al., 2003; Ehrbrecht et al., 2006; Castellino et al., 2008; Loukopoulos et al., 2007). On the other hand, mice lacking Wip1 are resistant to spontaneous and oncogene-induced tumors, most likely due to enhanced DNA damage and p53 responses (Nannenga et al., 2006; Choi et al., 2002; Bulavin et al., 2004; Harrison et al., 2004; Shreeram et al., 2006b). WIP1 inhibitors have been shown to reduce tumor cell proliferation, suggesting that inhibition of WIP1 may be a beneficial cancer therapeutic tool (Belova et al., 2005; Rayter et al., 2008; Tan et al., 2009; Yamaguchi et al., 2006; Saito-Ohara et al., 2003; Yoda et al., 2008).
Because of the relationship between ATM/ATR phosphorylation and WIP1 dephosphorylation targets, we hypothesized that ATM deficiency phenotypes resulting from inefficient phosphorylation of normal ATM targets might be rescued by eliminating WIP1 function. Presumably, in ATM deficiency there is some phosphorylation of ATM targets by related PIKKs such as ATR and DNA-PKcs, but this compensatory phosphorylation is inadequate to prevent the ATM deficiency phenotypes. However, the absence of WIP1 might enhance or prolong phosphorylation of some ATM target proteins and rescue some of the ATM deficiency phenotypes. We tested this hypothesis by crossing Atm-deficient mice to Wip1-deficient mice to obtain Atm−/−Wip1−/− double knockout mice. Here, we show that the absence of Wip1 in an Atm null background partially rescues some Atm deficiency phenotypes. Compared to Atm−/− mice, Atm−/−Wip1−/− mice displayed reduced tumorigenesis and dramatically enhanced longevity, as well as partial rescue of chromosomal instability and gametogenesis. Thus, inhibition of WIP1 may represent a viable approach for treating cancer and some phenotypes associated with ATM deficiency.
Results
Absence of Wip1 largely rescues lymphomagenesis in Atm null mice
Atm null mice succumb to thymic lymphomas at 3-6 months of age (Barlow et al., 1996; Elson et al., 1996; Xu et al., 1996; Westphal et al., 1997). Because WIP1 dephosphorylates some of the same targets that ATM phosphorylates, we hypothesized that the absence of Wip1 might rescue some of the deleterious phenotypes in the Atm null mice. To test this hypothesis, Atm+/−Wip1+/+ mice were crossed to Atm+/+Wip1+/− mice, and double heterozygous F1 progeny were re-crossed to obtain F2 Atm+/+Wip1+/+, Atm−/−Wip1+/+, Atm−/−Wip1+/−, and Atm−/−Wip1−/− mice. A minimum of 43 mice for each genotype were monitored over their entire lifespan. As expected, Atm+/+Wip1+/+ mice live relatively normal lifespans of over two years (Fig. 1A). Consistent with previous reports, 95% of Atm−/−Wip1+/+ mice developed thymic lymphomas by 150 days of age, and all are dead by 300 days of age (Fig. 1A). Conversely, only 11% of Atm−/−Wip1−/− mice develop thymic lymphomas by 150 days of age, and rarely developed tumors after 180 days (6 months). The majority of the double knockout mice exhibited dramatically enhanced longevities compared to Atm null mice, with median lifespans of 620 and 110 days, respectively (Fig. 1A). No Wip1 dosage effect was observed, as Atm−/−Wip1+/− mice developed tumors at the same rate as Atm−/−Wip1+/+ mice. Thus, the absence of Wip1 largely rescues tumor susceptibility phenotypes observed in Atm null mice.
Figure 1. Atm−/−Wip1−/− mice exhibit extended survival and protection from thymic lymphomas.
(A) Kaplan-Meier survival plot comparing Atm+/+Wip1+/+ (N=55), Atm−/−Wip1+/+ (N=52), Atm−/−Wip1+/− (N=50), and Atm−/−Wip1−/− (N=43) mouse longevity. Atm−/−Wip1−/− mice are largely protected from developing thymic lymphomas and survive much longer than their Atm−/−Wip1+/+ and Atm−/−Wip1+/− counterparts (P = 2.42 × 10−14). (B-D) Representative hematoxylin and eosin stained sections of thymic lymphomas at 200X magnification from Atm−/−Wip1+/+ (B), Atm−/−Wip1+/− (C), and Atm−/−Wip1−/− (D) mice. No differences in histopathology were observed in the thymic lymphomas from Atm−/−Wip1−/− (N=3) mice when compared to Atm−/−Wip1+/+ (N=3) and Atm−/−Wip1+/− (N=3) littermates.
To determine if there were any differences among the tumors that developed in the Atm−/−Wip1+/+, Atm−/−Wip1+/−, and Atm−/−Wip1−/− mice, tumors were collected from the mice. Gross necropsies revealed only thymic tumors in Atm−/−Wip1+/+, Atm−/−Wip1+/−, and Atm−/−Wip1−/− mice. Analysis of hematoxylin and eosin (H&E) stained tumor sections confirmed that all tumors were thymic lymphomas of likely T-cell origin, and no histopathological differences were observed among the Atm−/−Wip1+/−, Atm−/−Wip1−/− and Atm−/−Wip1+/+ lymphomas (Fig. 1B-D).
Atm−/−Wip1−/− mice exhibit enhanced p53 and DNA damage responses
The reduced tumor incidence in the Atm−/−Wip1−/− mice compared to Atm null mice is consistent with enhanced DNA damage and p53 responses. To examine this further, Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− eight week old mice were irradiated with 5 Gy of ionizing radiation (IR). Thymi were harvested six hours after IR and analyzed for phosphorylation status of known Wip1 dephosphorylation targets. Lysates from normal thymi and spleens were assessed by Western blot analysis with antibodies to p53 and H2AX as well as phospho-specific antibodies for p53 (pS18) and γ H2AX (pS140). Both of these phosphorylation events are markers for an activated DNA damage response. Basal levels of γ-H2AX and phospho-p53 were low in unirradiated Atm+/+Wip1+/+ lymphoid tissues but were induced to moderate levels six hours after IR treatment (Fig. 2A; Fig. S1). Irradiated Atm+/+Wip1−/− thymi and spleens exhibited increased phosphorylation of H2AX and p53 compared to irradiated Atm+/+Wip1+/+ thymi and spleens. Surprisingly, deletion of Atm did not impair IR-induced phosphorylation of H2AX and p53 and was comparable to Atm+/+Wip1+/+ levels (Fig. 2A-C). This is likely a result of compensatory phosphorylation by other PIKKs. In the presence of IR damage, the Atm−/−Wip1−/− thymi exhibited high phosphorylation levels of H2AX and p53 comparable to Atm+/+Wip1−/− thymi (Fig. 2A-C). In addition, IR treatment resulted in increased p53 protein levels across all four genotypes, as expected. Absence of Wip1 in Atm+/+ and Atm−/− mice conferred modestly increased p53 protein stability after IR compared to wildtype and Atm null mice (Fig. 2A). Finally, irradiation of the different Atm/Wip1 genotype mice resulted in similar patterns of enhanced phosphorylation of Brca1 Ser1423 in the absence of Wip1 (Fig. S2). This Brca1 phosphorylation site, targeted by Atm, is also dephosphorylated by Wip1 (Nguyen and Donehower, unpublished data).
Figure 2. Absence of Wip1 enhances p53 and DNA damage responses in Atm null mice.
(A) DNA damage-induced phosphorylation of p53 and H2AX is enhanced in thymic tissues of mice lacking Wip1. Atm+/+Wip1+/+, Atm−/−Wip1+/+, Atm+/+Wip1−/−, and Atm−/−Wip1−/− mice were treated with 5 Gy of IR. Six hours after radiation, thymus tissue was harvested from each mouse. Protein lysates from individual mouse thymi were subjected to Western blot analysis with antibodies specific for the indicated proteins or their phosphorylated forms. (B) Quantitation of p53 phosphorylation at serine 18 in thymus lysates from untreated and IR-treated Atm+/+Wip1+/+, Atm−/−Wip1+/+, Atm+/+Wip1−/−, and Atm−/−Wip1−/− mice. (C) Quantitation of H2AX phosphorylation (γ-H2AX) at serine 140 in thymus lysates from untreated and IR-treated Atm+/+Wip1+/+, Atm−/−Wip1+/+, Atm+/+Wip1−/−, and Atm−/−Wip1−/− mice. (D) Quantitation of of p21 RNA expression in unirradiated and irradiated Atm+/+Wip1+/+, Atm−/−Wip1+/+, Atm+/+Wip1−/−, and Atm−/−Wip1−/− mouse thymi by real-time PCR. For each of the genotype/radiation cohorts, results were calculated from four different animals and averaged for the graphs. Only two animals for each genotype radiation cohort are shown in Figure 2A, however. Asterisks (**P<0.01, *P<0.05) indicate significant differences in the magnitude of IR-induced increases compared to IR-induced increases in the wildtype mice.
The increased p53 protein levels in irradiated Atm+/+Wip1−/− and Atm−/−Wip1−/− thymi and spleens suggested a corresponding increase in p53 activity. To test this, we measured p21Waf1/Cip1 RNA expression levels in unirradiated and irradiated thymi of all four genotypes by real-time quantitative RT-PCR. The p21 gene is a direct transcriptional target of activated p53 and is a prototypical marker for p53 functional activity (El-Deiry et al., 1993). IR results in a roughly 20-fold increase in p21 RNA expression in Atm+/+Wip1+/+ thymi and this is further increased to a 30-fold induction in Atm+/+Wip1−/− thymocytes (Fig. 2D). Importantly, IR-induced p21 RNA is only induced about 7-fold in Atm−/−Wip1+/+ thymocytes, indicating loss of p53 activity in the absence of Atm. However, this p53 activity loss is partially rescued in double knockout thymi, which exhibit a 16-fold IR-induction of p21 RNA (Fig. 2D). Overall, these results indicate that the absence of Wip1 results in enhanced p53 and DNA damage responses in both Atm+/+Wip1−/− and Atm−/−Wip1−/− tissues.
Absence of Wip1 reduces chromosomal instability in Atm null splenocytes
Previously, spectral karyotyping (SKY) analysis revealed that both murine Atm null fibroblasts and A-T cells from humans display increased chromosomal instability (Barlow et al., 1996; Chun and Gatti, 2004). Since the Atm−/−Wip1−/− mice have enhanced DNA damage responses, we hypothesized that cells from these mice might also have reduced chromosomal instability. To test this, splenocytes from Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− eight week old mice were isolated, mitogen-activated, and subjected to SKY analysis. No aberrations were detected in metaphase chromosomes from 12-20 metaphase profiles prepared from each of four Atm+/+Wip1+/+ and four Atm+/+Wip1−/− mice (Fig. 3A,B). SKY analysis of splenocyte metaphase spreads from six Atm−/−Wip1+/+ mice revealed multiple chromosomal aberrations, including translocations, chromosome losses, and chromosome gains (Fig. 3C,D). Conversely, metaphase spreads from splenocytes of five Atm−/−Wip1−/− mice averaged fewer chromosomal abnormalities than those from Atm−/−Wip1+/+ mice (Fig. 3E,F). Overall, Atm null splenocytes averaged 18.3 chromosomal aberrations per mouse analyzed, whereas Atm−/−Wip1−/− splenocytes averaged 6.8 chromosomal aberrations per mouse (Fig. 3G). This difference was statistically significant (P = 0.009). Atm−/−Wip1+/+ mice averaged 1.42 chromosomal aberrations per individual metaphase, while Atm−/−Wip1−/− mice averaged 0.59 chromosomal aberrations per individual metaphase, which was statistically significant (P = 0.03) (Fig. 3H). Thus, the absence of Wip1 significantly decreases the genomic instability of Atm null cells.
Figure 3. Absence of Wip1 increases genomic stability of Atm null splenocytes.
(A-F) SKY analysis of Atm+/+Wip1+/+ (N=4) (A), Atm+/+Wip1−/− (N=4) (B), Atm−/−Wip1+/+ (N=6) (C,D), and Atm−/−Wip1−/− (N=5) (E,F) splenocytes. Aberrant chromosomes (either non-diploid numbers or translocations) are indicated by red boxes. Atm−/−Wip1−/− splenocytes have decreased genomic instability compared to Atm−/−Wip1+/+ splenocytes. (G) Graph comparing the average number of chromosomal aberrations observed per mouse (12-20 metaphase profiles analyzed per mouse and normalized) using SKY analysis. Atm−/−Wip1−/− splenocytes have a decreased number of chromosomal aberrations per mouse compared to Atm−/−Wip1+/+ splenocytes. **P = 0.009. (H) Graph comparing the average number of chromosomal aberrations per cell for each genotype. Atm−/−Wip1−/− splenocytes have a reduced number of chromosomal aberrations per cell observed compared to Atm−/−Wip1+/+ splenocytes. *P = 0.03.
Absence of Wip1 results in partial rescue of gamete formation in Atm null mice
Both A-T patients and Atm null mice are infertile (Chun and Gatti, 2004). Testes and ovaries of Atm null mice exhibit a disorganized architecture and complete absence of mature gametes (Barlow et al., 1996; Xu et al., 1996; Elson et al., 1996). To test if Atm−/−Wip1−/− mice were rescued from defects in gametogenesis, hematoxylin and eosin staining of tissue sections from testes and ovaries of Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− eight week old mice was performed. As expected, testes of Atm+/+Wip1+/+ males display a normal seminiferous tubule architecture (Fig. 4A). Testes of the Atm+/+Wip1−/− males revealed reduced numbers of maturing spermatocytes, spermatids, and mature sperm (Fig. 4B), as shown previously (Choi et al., 2002; Nannenga et al., 2006). Testes of Atm−/−Wip1+/+ males displayed diffuse hypoplasia of seminiferous tubules with multifocal degeneration of seminiferous tubule epithelium and no spermatogenesis (Fig. 4C). Interestingly, testes from four out of nine Atm−/−Wip1−/− males showed partial restoration of normal seminiferous tubule architecture and maturing spermatocytes, spermatids, and mature sperm similar to those seen in the Atm+/+Wip1−/− testes (Fig. 4D). The other five Atm−/−Wip1−/− males had complete disruption of seminiferous tubule organization and spermatogenesis, evidenced by the absence of spermatids and spermatozoa that was similar to the Atm null testes (Fig. 4E).
Figure 4. Atm−/−Wip1−/− mice exhibit partial restoration of mature gamete formation.
(A-E) Representative hematoxylin and eosin (H&E) stained sections of testes from Atm+/+Wip1+/+ (N=4) (A), Atm+/+Wip1−/− (N=4) (B), Atm−/−Wip1+/+ (N=6) (C), and Atm−/−Wip1−/− (N=9) (D & E) mice at 200X magnification. Some testes from Atm−/−Wip1−/− mice show a partial rescue of spermatogenesis similar to that observed in testes from Atm+/+Wip1−/− mice. (F-J) H&E stained sections of ovaries from Atm+/+Wip1+/+ (N=4) (F), Atm+/+Wip1−/− (N=5) (G), Atm−/−Wip1+/+ (N=4) (H), and Atm−/−Wip1−/− (N=3) (I & J) mice at 40X magnification. Some Atm−/−Wip1−/− ovaries show a partial rescue of oogenesis similar to that observed in Atm+/+Wip1−/− ovaries.
As expected, ovaries of Atm+/+Wip1+/+ females exhibited normal structures (Fig. 4F). Ovaries of Atm+/+Wip1−/− females revealed a reduced number of primordial follicles, oocytes, and developing follicles when compared to Atm+/+Wip1+/+ mice (Fig. 4G). Ovaries from Atm−/−Wip1+/+ females were devoid of maturing follicles and oocytes (Fig. 4H). However, ovaries from two of four Atm−/−Wip1−/− females displayed formation of primordial follicles, oocytes, and developing follicles similar in number to those seen in the ovaries of the Wip1 null females (Fig. 4I). Two of the Atm−/−Wip1−/− females had ovaries with no follicles, similar to what is observed in Atm null females (Fig. 4J). These results suggest that the absence of Wip1 partially restores gamete formation in Atm null mice, but this is an incompletely penetrant phenotype. Moreover, despite apparent partial rescue of gametogenesis in some Atm−/−Wip1−/− animals, these mice never produced offspring in continuous mating with wildtype mice, suggesting that absence of Wip1 was unable to functionally rescue reproductive capacity in Atm null mice.
Absence of Wip1 increases IR sensitivity of Atm null mice
Both A-T patients and Atm null mice are hypersensitive to IR (Westphal et al., 1997; Barlow et al., 1996; Chun and Gatti, 2004). To test if Atm−/−Wip1−/− mice were rescued from this phenotype, Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− six week old mice were subjected to a lethal dose of 8 Gy IR and monitored for survival. Atm+/+Wip1+/+ mice died between days 13-30 after IR (Fig. 5A). Atm+/+Wip1−/− mice died between days 11-17 after IR, suggesting a slightly enhanced sensitivity to IR compared to their wildtype counterparts. As anticipated, Atm−/−Wip1+/+ mice died more rapidly, between days 4-16. Likewise, Atm−/−Wip1−/− mice died between days 4-10 after IR. Thus, at the 8 Gy dosage, Atm−/−Wip1−/− mice were not rescued from the IR hypersensitivity phenotype of Atm null mice. We used a normally sublethal dosage of 4 Gy IR to determine if there were IR sensitivity differences among Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− six week old mice. All Atm+/+Wip1+/+, Atm+/+Wip1−/−, and Atm−/−Wip1+/+ mice were monitored for 50 days, and all survived 4 Gy treatment (Fig. 5B). However, 7 of 11 (64%) of the Atm−/−Wip1−/− mice died between days 14 and 30 after 4 Gy IR (Fig. 5B). Thus, rather than rescue IR hypersensitivity, absence of Wip1 further increases the IR sensitivity of Atm null mice.
Figure 5. Atm−/−Wip1−/− mice are more sensitive to IR than Atm−/−Wip1+/+ mice.
(A) Survival plot comparing survival of Atm+/+Wip1+/+ (N=4), Atm+/+Wip1−/− (N=6), Atm−/−Wip1+/+ (N=5), and Atm−/−Wip1−/− (N=7) mice after whole body IR with 8 Gy. Atm−/−Wip1+/+ and Atm−/−Wip1−/− mice are more sensitive to IR compared to Atm+/+Wip1+/+ mice. This difference approached significance (P = 0.06). (B) Survival plot comparing survival of Atm+/+Wip1+/+ (N=5), Atm+/+Wip1−/− (N=6), Atm−/−Wip1+/+ (N=10), and Atm−/−Wip1−/− (N=11) mice after whole body IR with 4 Gy. Atm−/−Wip1−/− mice are significantly more sensitive to IR compared to their Atm−/−Wip1+/+ counterparts (P = 0.002). (C) Representative H&E stained sections of small intestines of Atm+/+Wip1+/+ (N=3), Atm+/+Wip1−/− (N=3), Atm−/−Wip1+/+ (N=3), and Atm−/−Wip1−/− (N=3) mice after whole body IR with 4 Gy or unirradiated and collected 2, 3, and 4 days after treatment. The small intestines of the Atm−/−Wip1−/− mice display an enhanced radiation toxicity phenotype compared to other genotypes.
Atm null mice are hypersensitive to IR and die due to severe radiation toxicity of the GI tract (Barlow et al., 1996). To determine if GI tracts of the double knockout mice exhibited enhanced radiation toxicity effects, Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− six week old mice were subjected to the sub-lethal dose of 4 Gy IR and the small intestines were collected 2, 3, and 4 days after treatment and tissue histopathology was performed. The small intestines of Atm+/+Wip1+/+ and Atm+/+Wip1−/− mice appeared largely healthy, whether irradiated or not (Fig. 5C). Atm−/−Wip1+/+ mice displayed mild necrosis of the columnar epithelium with an infiltrate of mixed inflammatory cells by the third day post IR. However, small intestines of Atm−/−Wip1−/− mice exhibited a more pronounced radiation toxicity phenotype with moderate to marked loss and shortening of villi with dilatation of glandular crypts accompanied by a slight increase in mitotic figures, and evidence of increased cell death as well as depletion of lymphocytes in the lamina propria (Fig. 5C). Though the small intestines of Atm−/−Wip1−/− mice had a significant radiation toxicity phenotype, it is unclear whether this particular toxicity was responsible for the animals’ deaths. We hypothesized that the radiation toxicity phenotype in the Atm−/−Wip1−/− mice may have resulted from enhanced rates of cell apoptosis, but this appears unlikely as thymic tissues from irradiated Atm−/−Wip1−/− mice showed no increase increased in apoptotic markers compared to Atm−/−Wip1+/+ or Atm+/+Wip1−/− mice (Fig. S3).
Absence of Wip1 fails to rescue other Atm deficiency phenotypes
Several other Atm deficiency phenotypes were tested for rescue by the absence of Wip1. These included adult body mass (reduced in Atm null mice), motor coordination (reduced in Atm null mice), lymphocyte numbers (reduced in Atm null mice), and T cell maturation (defective in Atm null mice). As shown in Figure 6, Atm−/−Wip1−/− mice were comparable to Atm−/− mice in mean body mass at 8 weeks of age (Fig. 6A), length of time maintaining balance on a spinning rota rod (a test of motor coordination) (Fig. 6B), total splenocyte and thymocyte numbers (Fig. 6C), and numbers of CD4+ CD8+ double positive (higher numbers in Atm null mice are indicative of defective T cell maturation) and single positive CD4+ thymic T lymphocytes (Fig. 6D). Thus, not all phenotypes associated with Atm deficiency could be rescued or partially rescued by the absence of Wip1.
Figure 6. Absence of Wip1 does not rescue somatic growth, motor coordination defects, or immunologic abnormalities in Atm null mice.
(A) Absence of Wip1 does not rescue somatic growth. Male and female Atm+/+Wip1+/+ (N=16 males, 8 females), Atm+/+Wip1−/− (N=10 males, 7 females), Atm−/−Wip1+/+ (N=9 males, 13 females), and Atm−/−Wip1−/− (N=7 males, 11 females) mice were weighed at 8 weeks of age. Atm−/−Wip1+/+ and Atm−/−Wip1−/− males and females exhibited a significantly reduced bodyweight compared to Atm+/+Wip1+/+ mice. (B) Absence of Wip1 does not rescue motor coordination defects. Using the rota-rod treadmill test, Atm−/−Wip1+/+ (N=12) and Atm−/−Wip1−/− (N=10) mice exhibit significant motor coordination defects compared to their Atm+/+Wip1+/+ (N=12) and Atm+/+Wip1−/− (N=14) counterparts. (C) Absence of Wip1 does not rescue lymphoid cell depletion. Thymocytes and splenocytes were collected from Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− mice at 8 weeks of age, (N=10 for all genotypes) and counted. The Atm−/−Wip1−/− mice have significantly decreased numbers of both splenocytes and thymocytes compared to Atm+/+Wip1+/+ mice but not compared to Atm−/−Wip1+/+ mice. (D) Absence of Wip1 does not rescue defective thymocyte maturation. Thymocytes were collected from Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− mice at 8 weeks of age, (N=10 for all genotypes). Thymocyte expression of CD3, CD4, and CD8 was examined using flow cytometry. Atm−/−Wip1−/− thymocytes show a decrease in mature T cells similar to Atm−/−Wip1+/+ thymocytes. Also, both Atm−/−Wip1+/+ and Atm−/−Wip1−/− thymocytes show a decrease in the CD4 single positive population compared to Atm+/+Wip1+/+. Asterisks in panels A, C, and D represent a significant difference between the indicated population and the control Atm+/+Wip1+/+ mice as measured by t test. *P < 0.05 and **P < 0.01.
Discussion
WIP1 dephosphorylates many of the same targets that ATM phosphorylates (Lu et al., 2008; Le and Bulavin, 2009). In addition, Shreeram et al. (2006a) have demonstrated that Wip1 directly desphorylates ATM at Ser1981 and is critical for resetting ATM phosphorylation as cells repaired damaged DNA. Because of this antagonistic relationship between ATM and WIP1, we hypothesized that mice lacking Atm, which exhibit many deleterious phenotypes, might benefit from the absence of Wip1. Our hypothesized mechanism for Wip1 rescue was that, despite some compensatory phosphorylation by other PIKKs such as Atr and DNA-PK, many Atm targets would be hypophosphorylated in the absence of Atm. Therefore, the absence of Wip1 would likely increase and prolong the phosphorylation state of hypophosphorylated Atm targets, ultimately restoring a more normal DNA damage response (Fig. 7). If Wip1 absence or inhibition could benefit Atm null mice, this could have important implications for A-T patients, as there is currently no effective treatment for these individuals. WIP1 small molecule inhibitors have recently been developed as potential cancer therapeutic drugs (Yamaguchi et al., 2006; Belova et al., 2005; Rayter et al., 2008), so it is possible such drugs might alleviate some A-T patient symptoms.
Figure 7. Model showing how Wip1 may compensate for Atm deficiency to partially rescue A-T-associated tumor phenotypes.
(A) In Atm+/+Wip1+/+ animals, DNA damage activates Atm, which phosphorylates many targets, including p53, to activate the DNA damage response and prevent genomic instability. Normal Wip1 activity then modulates and reduces phosphorylation of p53 and other Atm targets. This overall robust DNA damage response protects against tumor formation. (B) In Atm+/+Wip1−/− animals, phosphorylation of Atm targets is increased by absence of Wip1, resulting in an augmented DNA damage response, enhanced genomic stability, and virtually no tumors. (C) In Atm−/−Wip1+/+ animals, phosphorylation of Atm targets is decreased and only partially compensated by other PIKKs such as Atr and DNA-PK, resulting in genomic instability and a high rate of cancers. (D) In Atm−/−Wip1−/− animals, compensatory phosphorylation of Atm targets by Atr and DNA-PK is increased and prolonged by absence of Wip1, allowing for an enhanced DNA damage response, partial restoration of genomic stability, and fewer tumors than in the Atm−/−Wip1+/+ animals.
As described here, removal of Wip1 from Atm null mice partially rescued a number of Atm deficiency phenotypes. The most dramatic rescue was the reduction in thymic lymphoma incidence in double knockout mice compared to their Atm null counterparts. The mechanisms by which the absence of Wip1 reduced thymic lymphomas are likely to be related to enhanced DNA damage responses observed in the thymic tissues of the double knockout mice compared to Atm null mice (Fig. 2A). The ATM/ATR-initiated DNA damage response has been shown to be an important failsafe mechanism that prevents progression of precancerous lesions (Bartkova et al., 2005; Halazonetis et al., 2008). In particular, H2AX and p53 showed increased phosphorylation in IR-treated double null mice compared to Atm null mice. The increased phosphorylation of H2AX may be associated with more efficient DNA double strand break repair, consistent with our finding that reduction of Wip1 enhances this type of repair (Moon et al., 2010). In addition, the p53 response was elevated in IR-treated double knockout mice compared to Atm null mice as measured by p53 protein levels, p53 serine 18 phosphorylation, and induction of the p21Waf1/Cip1 gene. This increased p53 activity in the double null mice is likely a key component of their resistance to thymic lymphomas relative to Atm null mice.
Enhanced DNA damage responses and reduced lymphomagenesis in the double knockout mice is consistent with the reduced chromosomal instability observed in their splenocytes. ATM deficiency has been shown to be associated with increased aneuploidy and other types of chromosomal aberrations, and this has been linked to both reduced p21 and p53 expression (Shen et al., 2005; Li et al., 2010). The mechanisms by which absence of WIP1 promotes chromosomal stability may be multiple, beginning with augmented and prolonged phosphorylation of ATM targets involved in maintaining genomic stability. Reduction of WIP1 levels enhances the enforcement of intra-S and G2/M checkpoints (Lu et al., 2005a), and an enhanced G2/M checkpoint would likely reduce aneuploidy.
Atm null mice structural disorganization in both testes and ovaries (Xu et al., 1996). This phenocopies A-T patients, who also exhibit gonadal abnormalities, such as ovaries without follicle development in females and histological abnormalities and reduced spermatogenesis in males (Sedgwick and Boder, 1991). We have shown that Wip1 null mice had modestly reduced male fertility and reduced spermatogenesis as well as moderate disorganization of seminiferous tubules (Choi et al., 2002). Thus, it was surprising that absence of Wip1 was able to rescue both testicular and ovarian gametogenesis to some extent in the double knockout mice. However, the rescue of gametogenesis was variably penetrant in the double knockout mice and the reasons for this remain unclear. Wip1 is highly expressed in the testes with its highest level of expression correlating with the final stages of meiosis, suggesting that Wip1 plays a role in regulating meiosis I and II divisions to inhibit further cell cycles and maintain the haploid state (Choi et al., 2002). The mechanism of rescue in the double knockout mice may involve restoration of near normal phosphorylation to meiotic proteins targeted by both Atm and Wip1.
Atm null mice and A-T patients exhibit a profound hypersensitivity to ionizing radiation (Abraham, 2001; Lavin, 2008). Not only did absence of Wip1 not rescue this particular phenotype, but it accentuated it in double knockout mice. When we examined the radiation-sensitive intestinal villi, double knockout villi showed higher levels of degeneration and disorganization, suggesting higher levels of cell death. However, examination of apoptosis markers in thymus, spleen, and intestine did not reveal increased apoptosis levels in the double knockout tissues (Fig. S3 and data not shown), as might be expected from other contexts (Demidov et al., 2007; Xia et al., 2009). Instead, non-apoptotic mechanisms of cell death may be responsible. Nevertheless, the increased hypersensitivity of double knockout mice suggest a possible synthetic lethality between Atm and Wip1 deficiency, reminiscent of synthetic lethalities between Atm and other molecules (Gurley and Kemp, 2001; Jiang et al., 2009; Williamson et al., 2010).
In summary, we have shown that removing Wip1 from an Atm null mouse background reduced tumorigenesis, enhanced longevity, augmented the DNA damage response, decreased genomic instability, and partially rescued gametogenesis. Combined with studies showing that Wip1 null mice are resistant to both spontaneous and oncogene-induced tumors (Nannenga et al., 2006; Bulavin et al., 2004), it is increasingly evident that reducing Wip1 levels can diminish cancer susceptibility. Thus, the development of Wip1 inhibitors may be beneficial in cancer treatment. Moreover, the results described here suggest that application of Wip1 inhibitors to A-T patients may be efficacious both in a preventative and therapeutic context.
Materials and Methods
Mice
Atm+/− mice (Borghesani et al., 2000) were crossed with Wip1+/− mice (Choi et al., 2002) to obtain Atm+/−Wip1+/− F1 offspring. Wip1-deficient mice were of mixed C57BL/6 × 129/Sv background, but all mice were backcrossed at least three generations into C57BL/6. The double heterozygotes were then crossed to obtain F2 offspring of all possible Atm/Wip1 genotypes. Genotyping of mice for Atm and Wip1 mutant alleles was performed by tail DNA PCR (Moon et al., 2010). Mice were allowed to age naturally and monitored for tumor formation throughout their lifespan. All tumors identified were harvested and fixed in 10% neutral buffered formalin. Severely moribund mice were sacrificed and all major organs analyzed by visual examination and histopathology. The SPSS 14.0 program was used to construct Kaplan-Meier tumor free survival plots. All animals were handled in strict accordance with good animal practice as defined by the Institutional Animal Care and Use Committee for Baylor College of Medicine and Affiliates.
Histopathological analysis of tissues and tumors
Thymic lymphomas, thymi, spleens, testes, ovaries, and small intestines were collected and placed in 10% buffered formalin. Fixed tissues were embedded in paraffin blocks, sectioned, and hematoxylin and eosin staining was performed using standard methods. Sections were examined and images were obtained with an Olympus BX50 microscope, an Olympus 40x and 200x objective, and an Olympus DP11 camera.
Western blot analysis of DNA damage response proteins in mouse lymphoid tissues
Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− eight week old male and female mice were treated with 5 Gy whole body irradiation with a 137Cs source (MDS Nordion GammaCell Exactor). Six hours after IR, spleen and thymus tissues were harvested, homogenized, and lysed as previously described (Nannenga et al., 2006). Lysates (20 μg) were mixed with 2× Laemmli sample buffer, boiled and loaded on 10% polyacrylamide gels. Proteins were transferred to PVDF membrane and detected using the indicated primary antibody to the protein or protein phosphorylation site along with an appropriate secondary antibody. Anti-p53(p15S) (cat#9284), anti-p53 (cat#2524), and anti-H2AX (cat#2595) antibodies were purchased from Cell Signaling Technology. Anti-γ-H2AX (catalog #07-164) was purchased from Millipore. Anti-GAPDH protein antibody was purchased from Santa Cruz Biotechnology (cat#sc-25778). Anti-p53(p15S), anti-H2AX, anti-γ-H2AX, and anti-GAPDH antibodies were all used at 1:1000 dilution. Anti-p53 antibody was used at 1:500 dilution.
Real-time PCR
Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− eight week old male and female mice were treated with 5 Gy whole body γ-irradiation as described above. Six hours after γ-irradiation, thymi were harvested and total mRNA was extracted using TRIZOL (Invitrogen). cDNA was then synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and real-time PCR was performed with RT-300 equipment (Corbett Research) with iQ SYBR Green Super Mix (Bio-Rad) using gene-specific primers for mouse p21 and β-actin. The primer sequences used were: p21F: CCATGAGCGCATCGCAATC, p21R: CCTGGTGATGTCCGACCTG, β-actinF: GACCTCTATGCCAACACAGT, β-actinR: AGTACTTGCGCTCAGGAGGA. Real-time PCR was done in duplicate for each sample, and p21 expression was normalized to β-actin levels.
Spectral karyotyping of mouse thymic lymphocytes
Spleens from Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− eight week old male and female mice were harvested and single cell suspensions were made in RPMI media containing 10% FBS. Cells were plated at 4 million cells/ml on 60 mm dishes with 5 μg/ml of Concanavalin A. After 72 hours, the cells were split and plated at 0.5 million cells/ml on 60 mm dishes with 100 IU/ml of IL-2 and 50% Concanavalin A conditioned media. 24 hours later the cells were prepared for spectral karyotyping (SKY) as previously described (Rao et al., 1998). For SKY, the cocktail of mouse chromosome paints was obtained from Applied Spectral Imaging (ASI, Vista, CA). Hybridization and detection were carried out according to manufacturer protocol, with slight modifications. Chromosomes were counterstained with DAPI. For each mouse, 12-20 metaphases were analyzed by SKY. Images were acquired with a SD300H Spectra cube (ASI) mounted on a Zeiss Axioplan II microscope using a custom designed optical filter (SKY-1) (Chroma Technology, Brattleboro, VT), and analyzed using SKY View 2.1.1 software (ASI, Vista, CA).
Rota-rod treadmill test
Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− eight week old littermate male and female mice were tested for motor coordination using a rotating rod (UGO BASILE) in which the speed increases linearly over time as previously described (Moretti et al., 2005). Mice were placed on the rota-rod that accelerates from 4-40 rpm for a maximum of 5 minutes. Four trials/day/mouse were performed for 3 consecutive days with an inter-trial interval of 30 minutes. Mice were monitored during the trial for loss of control, where the mouse holds onto the rod without walking on top or falling off, and this time was recorded.
Flow cytometric analysis of lymphocytes
Cells were prepared from thymi and spleens of Atm+/+Wip1+/+, Atm+/+Wip1−/−, Atm−/−Wip1+/+, and Atm−/−Wip1−/− eight week old male and female mice, stained with fluorescent antibodies, fixed with 0.1% paraformaldehyde (PFA)/PBS solution, and data was collected using a CantoII flow cytometer. Thymocytes were incubated with antibodies for PE-Cy5 anti-mouse CD3e (cat#15-0031-81), FITC anti-mouse CD4 (cat#11-0041-82), and PE anti-mouse CD8a (cat#12-0081-81) from eBioscience. All antibodies were used at 4 μg/ml concentrations.
Statistical analysis
The results shown are means ± standard error. Statistical significance for most assays was assessed using the Student’s t-test. Statistical significance for survival curves was assessed by Kaplan-Meier analyses.
Supplementary Material
Acknowledgments
We thank Corrine Spencer and Yi-Jue Zhao for technical assistance. This work was supported by NIH grants (R01 CA100420) to L.A.D. and (R01 CA136549) to X.L., and a DOD Breast Cancer Research Program Predoctoral Traineeship Award (BC050781) to T.-A.N.
Footnotes
Conflict of Interest
There are no competing financial interests in relation to the work described for any of the authors.
References
- Abraham RT. Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev. 2001;15:2177–2196. doi: 10.1101/gad.914401. [DOI] [PubMed] [Google Scholar]
- Appella E, Anderson CW. Post-translational modifications and activation of p53 by genotoxic stresses. European J Biochem. 2001;268:2764–2772. doi: 10.1046/j.1432-1327.2001.02225.x. [DOI] [PubMed] [Google Scholar]
- Barlow C, Hirotsune S, Paylor R, Liyanage M, Eckhaus M, Collins F, et al. Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell. 1996;86:159–171. doi: 10.1016/s0092-8674(00)80086-0. [DOI] [PubMed] [Google Scholar]
- Bartkova J, Horejsi Z, Koed K, Kramer A, Tort F, Zieger K, et al. DNA damage response as a candidate anti-cancer barrier in early human tumorigenesis. Nature. 2005;434:864–870. doi: 10.1038/nature03482. [DOI] [PubMed] [Google Scholar]
- Belova GI, Demidov ON, Fornace AJ, Bulavin DV. Chemical inhibition of Wip1 phosphatase contributes to suppression of tumorigenesis. Cancer Biol Ther. 2005;4:1154–1158. doi: 10.4161/cbt.4.10.2204. [DOI] [PubMed] [Google Scholar]
- Borghesani PR, Alt FW, Bottaro A, Davidson L, Aksoy S, Rathbun GA, et al. Abnormal development of Purkinje cells and lymphocytes in Atm mutant mice. Proc Natl Acad Sci USA. 2000;97:3336–3341. doi: 10.1073/pnas.050584897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bulavin DV, Demidov ON, Saito S, Kauraniemi P, Phillips C, Amundson SA, et al. Amplification of PPM1D in human tumors abrogates p53 tumor-suppressor activity. Nat Genet. 2002;31:210–215. doi: 10.1038/ng894. [DOI] [PubMed] [Google Scholar]
- Bulavin DV, Phillips C, Nannenga B, Timofeev O, Donehower LA, Anderson CW, et al. Inactivation of the Wip1 phosphatase inhibits mammary tumorigenesis through p38 MAPK-mediated activation of the p16(Ink4a)-p19(Arf) pathway. Nat Genet. 2004;36:343–350. doi: 10.1038/ng1317. [DOI] [PubMed] [Google Scholar]
- Castellino RC, De Bortoli M, Lu X, Moon SH, Nguyen TA, Shepard MA, et al. Medulloblastomas overexpress the p53-inactivating oncogene WIP1/PPM1D. J Neurooncol. 2008;86:245–256. doi: 10.1007/s11060-007-9470-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choi J, Nannenga B, Demidov ON, Bulavin DV, Cooney A, Brayton C, et al. Mice deficient for the wild-type p53-induced phosphatase gene (Wip1) exhibit defects in reproductive organs, immune function, and cell cycle control. Mol Cell Biol. 2002;22:1094–1105. doi: 10.1128/MCB.22.4.1094-1105.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chun HH, Gatti RA. Ataxia-telangiectasia, an evolving phenotype. DNA Repair (Amst.) 2004;3:1187–1196. doi: 10.1016/j.dnarep.2004.04.010. [DOI] [PubMed] [Google Scholar]
- Demidov ON, Timofeev O, Lwin HN, Kek C, Appella E, Bulavin DV. Wip1 phosphatase regulates p53-dependent apoptosis of stem cells and tumorigenesis in the mouse intestine. Cell Stem Cell. 2007;1:180–190. doi: 10.1016/j.stem.2007.05.020. [DOI] [PubMed] [Google Scholar]
- Ehrbrecht A, Muller U, Wolter M, Hoischen A, Koch A, Radlwimmer B, et al. Comprehensive genomic analysis of desmoplastic medulloblastomas: identification of novel amplified genes and separate evaluation of the different histological components. J Pathol. 2006;208:554–563. doi: 10.1002/path.1925. [DOI] [PubMed] [Google Scholar]
- El-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, et al. WAF1, a potential mediator of p53 tumor suppression. Cell. 1993;19:817–825. doi: 10.1016/0092-8674(93)90500-p. [DOI] [PubMed] [Google Scholar]
- Elson A, Wang Y, Daugherty CJ, Morton CC, Zhou F, Campos-Torres J, et al. Pleiotropic defects in ataxia-telangiectasia protein-deficient mice. Proc Natl Acad Sci USA. 1996;93:13084–13089. doi: 10.1073/pnas.93.23.13084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fiscella M, Zhang HL, Fan SJ, Sakaguchi K, Shen SF, Mercer WE, et al. Wip1, a novel human protein phosphatase that is induced in response to ionizing radiation in a p53-dependent manner. Proc Natl Acad Sci USA. 1997;94:6048–6053. doi: 10.1073/pnas.94.12.6048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fujimoto H, Onishi N, Kato N, Takekawa M, Xu X, Kosugi A, et al. Regulation of the antioncogenic Chk2 kinase by the oncogenic Wip1 phosphatase. Cell Death Different. 2006;13:1170–1180. doi: 10.1038/sj.cdd.4401801. [DOI] [PubMed] [Google Scholar]
- Gurley KE, Kemp CJ. Synthetic lethality between mutation in Atm and DNA-PK(cs) during murine embryogenesis. Curr Biol. 2001;11:191–194. doi: 10.1016/s0960-9822(01)00048-3. [DOI] [PubMed] [Google Scholar]
- Halazonetis TD, Gorgoulis VG, Bartek J. An oncogene-induced DNA damage model for cancer development. Science. 2008;319:1352–1355. doi: 10.1126/science.1140735. [DOI] [PubMed] [Google Scholar]
- Harrison M, Li J, Degenhardt Y, Hoey T, Powers S. Wip1-deficient mice are resistant to common cancer genes. Trends Mol Med. 2004;10:359–361. doi: 10.1016/j.molmed.2004.06.010. [DOI] [PubMed] [Google Scholar]
- Herzog KH, Chong MJ, Kapsetaki M, Morgan JI, McKinnon PJ. Requirement for Atm in ionizing radiation-induced cell death in the developing central nervous system. Science. 1998;280:1089–1091. doi: 10.1126/science.280.5366.1089. [DOI] [PubMed] [Google Scholar]
- Hirasawa A, Saito-Ohara F, Inoue J, Aoki D, Susumu N, Yokoyama T, et al. Association of 17q21-q24 gain in ovarian clear cell adenocarcinomas with poor prognosis and identification of PPM1D and APPBP2 as likely amplification targets. Clin Cancer Res. 2003;9:1995–2004. [PubMed] [Google Scholar]
- Ito K, Hirao A, Arai F, Matsuoka S, Takubo K, Hamaguchi I, et al. Regulation of oxidative stress by ATM is required for self-renewal of haematopoietic stem cells. Nature. 2004;431:997–1002. doi: 10.1038/nature02989. [DOI] [PubMed] [Google Scholar]
- Jiang H, Reinhardt HC, Bartkova J, Tommiska J, Blomqvist C, Nevanlinna H, et al. The combined status of ATM and p53 link tumor development with therapeutic response. Genes Dev. 2009;23:1895–1909. doi: 10.1101/gad.1815309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lavin MF. ATM and the Mre11 complex combine to recognize and signal DNA double-strand breaks. Oncogene. 2007;26:7749–7758. doi: 10.1038/sj.onc.1210880. [DOI] [PubMed] [Google Scholar]
- Lavin MF. Ataxia-telangiectasia: from a rare disorder to a paradigm for cell signalling and cancer. Nat Rev Mol Cell Biol. 2008;9:759–769. doi: 10.1038/nrm2514. [DOI] [PubMed] [Google Scholar]
- Le Guezennec X, Bulavin DV. WIP1 phosphatase at the crossroads of cancer and aging. Trends Biochem Sci. 2009;35:109–114. doi: 10.1016/j.tibs.2009.09.005. [DOI] [PubMed] [Google Scholar]
- Li J, Yang Y, Peng Y, Austin RJ, van Eyndhoven G, Nguyen KCQ, et al. Oncogenic properties of PPM1D located within a breast cancer amplification epicenter at 17q23. Nat Genet. 2002;31:133–134. doi: 10.1038/ng888. [DOI] [PubMed] [Google Scholar]
- Li M, Fang X, Baker DJ, Guo L, Gao X, Wei Z, et al. The ATM-p53 pathway suppresses aneuploidy-induced tumorigenesis. Proc Natl Acad Sci USA. 2010;107:14188–14193. doi: 10.1073/pnas.1005960107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Loukopoulos P, Shibata T, Katoh H, Kokubu A, Sakamoto M, Yamazaki K, et al. Genome-wide array-based comparative genomic hybridization analysis of pancreatic adenocarcinoma: Identification of genetic indicators that predict patient outcome. Cancer Sci. 2007;98:392–400. doi: 10.1111/j.1349-7006.2007.00395.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lu X, Ma O, Nguyen TA, Jones SN, Oren M, Donehower LA. The Wip1 Phosphatase acts as a gatekeeper in the p53-Mdm2 autoregulatory loop. Cancer Cell. 2007;12:342–354. doi: 10.1016/j.ccr.2007.08.033. [DOI] [PubMed] [Google Scholar]
- Lu X, Nannenga B, Donehower LA. PPM1D dephosphorylates Chk1 and p53 and abrogates cell cycle checkpoints. Genes Dev. 2005a;19:1162–1174. doi: 10.1101/gad.1291305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lu XB, Nguyen TA, Donehower LA. Reversal of the ATM/ATR-mediated DNA damage response by the oncogenic phosphatase PPM1D. Cell Cycle. 2005b;4:1060–1064. [PubMed] [Google Scholar]
- Lu X, Nguyen TA, Moon SH, Darlington Y, Sommer M, Donehower LA. The type 2C phosphatase Wip1: an oncogenic regulator of tumor suppressor and DNA damage response pathways. Cancer Metastasis Rev. 2008;27:123–135. doi: 10.1007/s10555-008-9127-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Macurek L, Lindqvist A, Voets O, Kool J, Vos HR, Medema RH. Wip1 phosphatase is associated with chromatin and dephosphorylates gammaH2AX to promote checkpoint inhibition. Oncogene. 2010;29:2281–2291. doi: 10.1038/onc.2009.501. [DOI] [PubMed] [Google Scholar]
- Moon SH, Lin L, Zhang X, Nguyen TA, Darlington Y, Waldman AS, et al. Wildtype p53-induced phosphatase 1 dephosphorylates histone variant {gamma}-H2AX and suppresses DNA double strand break repair. J Biol Chem. 2010;285:12935–12947. doi: 10.1074/jbc.M109.071696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moretti P, Bouwknecht JA, Teague R, Paylor R, Zoghbi HY. Abnormalities of social interactions and home-cage behavior in a mouse model of Rett syndrome. Hum Mol Genet. 2005;14:205–220. doi: 10.1093/hmg/ddi016. [DOI] [PubMed] [Google Scholar]
- Nannenga B, Lu X, Dumble M, Van Maanen M, Nguyen TA, Sutton R, et al. Augmented cancer resistance and DNA damage response phenotypes in PPM1D null mice. Mol Carcinog. 2006;45:594–604. doi: 10.1002/mc.20195. [DOI] [PubMed] [Google Scholar]
- Rao PH, Cigudosa JC, Ning Y, Calasanz MJ, Iida S, Tagawa S, et al. Multicolor spectral karyotyping identifies new recurring breakpoints and translocations in multiple myeloma. Blood. 1998;92:1743–1748. [PubMed] [Google Scholar]
- Rayter S, Elliott R, Travers J, Rowlands MG, Richardson TB, Boxall K, et al. A chemical inhibitor of PPM1D that selectively kills cells overexpressing PPM1D. Oncogene. 2008;27:1036–1044. doi: 10.1038/sj.onc.1210729. [DOI] [PubMed] [Google Scholar]
- Rotman G, Shiloh Y. ATM: from gene to function. Hum Mol Genet. 1998;7:1555–1563. doi: 10.1093/hmg/7.10.1555. [DOI] [PubMed] [Google Scholar]
- Saito-Ohara F, Imoto I, Inoue J, Hosoi H, Nakagawara A, Sugimoto T, et al. PPM1D is a potential target for 17q gain in neuroblastoma. Cancer Res. 2003;63:1876–1883. [PubMed] [Google Scholar]
- Savitsky K, Sfez S, Tagle DA, Ziv Y, Sartiel A, Collins FS, et al. The complete sequence of the coding region of the ATM gene reveals similarity to cell cycle regulators in different species. Hum Mol Genet. 1995;4:2025–2032. doi: 10.1093/hmg/4.11.2025. [DOI] [PubMed] [Google Scholar]
- Schito ML, Demidov ON, Saito S, Ashwell JD, Appella E. Wip1 phosphatase-deficient mice exhibit defective T cell maturation due to sustained p53 activation. J Immunol. 2006;176:4818–4825. doi: 10.4049/jimmunol.176.8.4818. [DOI] [PubMed] [Google Scholar]
- Sedgwick RP, Boder E, Ataxia-Telangiectasia . In: Hereditary Neuropathies and Spinocerebellar Atrophies. deJong JMBE, editor. Elsevier; New York: 1991. pp. 347–423. Vinken PJ, Bruyn GW, Klawans HL, eds. Handbook of Clinical Neurology, vol 16. [Google Scholar]
- Shen KC, Heng H, Wang Y, Lu S, Liu G, Deng CX, et al. ATM and p21 cooperate to suppress aneuploidy and subsequent tumor development. Cancer Res. 2005;65:8747–8753. doi: 10.1158/0008-5472.CAN-05-1471. [DOI] [PubMed] [Google Scholar]
- Shiloh Y. ATM and related protein kinases: safeguarding genome integrity. Nat Rev Cancer. 2003;3:155–168. doi: 10.1038/nrc1011. [DOI] [PubMed] [Google Scholar]
- Shreeram S, Demidov ON, Hee WK, Yamaguchi H, Onishi N, Kek C, et al. Wip1 phosphatase modulates ATM-dependent signaling pathways. Mol Cell. 2006a;23:757–764. doi: 10.1016/j.molcel.2006.07.010. [DOI] [PubMed] [Google Scholar]
- Shreeram S, Hee WK, Demidov ON, Kek C, Yamaguchi H, Fornace AJ, et al. Regulation of ATM/p53-dependent suppression of myc-induced lymphomas by Wip1 phosphatase. J Exp Med. 2006b;203:2793–2799. doi: 10.1084/jem.20061563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takekawa M, Adachi M, Nakahata A, Nakayama I, Itoh F, et al. p53-inducible Wip1 phosphatase mediates a negative feedback regulation of p38 MAPK-p53 signaling in response to UV radiation. EMBO J. 2000;19:6517–6526. doi: 10.1093/emboj/19.23.6517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tan DS, Lambros MB, Rayter S, Natrajan R, Vatcheva R, Gao Q, et al. PPM1D is a potential therapeutic target in ovarian clear cell carcinomas. Clin Cancer Res. 2009;15:2269–2280. doi: 10.1158/1078-0432.CCR-08-2403. [DOI] [PubMed] [Google Scholar]
- Westphal CH, Rowan S, Schmaltz C, Elson A, Fisher DE, Leder P. Atm and p53 cooperate in apoptosis and suppression of tumorigenesis, but not in resistance to acute radiation toxicity. Nat Genet. 1997;16:397–401. doi: 10.1038/ng0897-397. [DOI] [PubMed] [Google Scholar]
- Williamson CT, Muzik H, Turhan AG, Zamo A, O’Connor MJ, Bebb DG, et al. ATM deficiency sensitizes mantle cell lymphoma cells to poly(ADP-ribose) polymerase-1 inhibitors. Mol Cancer Ther. 2010;9:347–357. doi: 10.1158/1535-7163.MCT-09-0872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xia Y, Ongusaha P, Lee SW, Liou YC. Loss of Wip1 sensitizes cells to stress- and DNA damage-induced apoptosis. J Biol Chem. 2009;284:17428–17437. doi: 10.1074/jbc.M109.007823. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu Y, Ashley T, Brainerd EE, Bronson RT, Meyn MS, Baltimore D. Targeted disruption of ATM leads to growth retardation, chromosomal fragmentation during meiosis, immune defects, and thymic lymphoma. Genes Dev. 1996;10:2411–2422. doi: 10.1101/gad.10.19.2411. [DOI] [PubMed] [Google Scholar]
- Yamaguchi H, Durell SR, Feng HQ, Bai YW, Anderson CW, Appella E. Development of a substrate-based cyclic phosphopeptide inhibitor of protein phosphatase 2C delta, Wip1. Biochemistry. 2006;45:13193–13202. doi: 10.1021/bi061356b. [DOI] [PubMed] [Google Scholar]
- Yoda A, Toyoshima K, Watanabe Y, Onishi N, Hazaka Y, Tsukuda Y, et al. Arsenic trioxide augments Chk2/p53-mediated apoptosis by inhibiting oncogenic Wip1 phosphatase. J Biol Chem. 2008;283:18969–18979. doi: 10.1074/jbc.M800560200. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







