Identification and apical membrane localization of an electrogenic Na⁺/Ca²⁺ exchanger NCX2a likely to be involved in renal Ca²⁺ excretion by seawater fish

Abstract

Seawater (SW) contains ∼10 mM Ca²⁺, yet marine fish must drink seawater as their major water source. Thus marine teleosts fish need to excrete Ca²⁺ to maintain whole body Ca²⁺ homeostasis. In the intestine, seawater Ca²⁺ interreacts with epithelial-secreted HCO₃⁻ by the intestinal epithelium, and the resulting CaCO₃ precipitates, which is rectally excreted. Recently the transporters involved in intestinal HCO₃⁻ secretion were identified. Ca²⁺ is also excreted by the kidney, but the protein(s) involved in renal Ca²⁺ excretion have not been identified. Here we identified a candidate transporter by using SW pufferfish torafugu (Takifugu rubripes) and its closely related euryhaline species mefugu (Takifugu obscurus), which are becoming useful animal models for studying molecular mechanisms of seawater adaptation. RT-PCR analyses of Na⁺/Ca²⁺ exchanger (NCX) family members in various torafugu tissues demonstrated that only NCX2a is highly expressed in the kidney. Renal expression of NCX2a was markedly elevated when mefugu were transferred from freshwater to seawater. In situ hybridization and immunohistochemical analyses indicated that NCX2a is expressed in the proximal tubule at the apical membrane. NCX2a, expressed in Xenopus oocytes, conferred [Ca²⁺]_out- and Na⁺-dependent currents. These results suggest that NCX2a mediates renal Ca²⁺ secretion at the apical membrane of renal proximal tubules and has an important role in whole body Ca²⁺ homeostasis of marine teleosts.

strategies of whole body Ca²⁺ homeostasis differ among vertebrate species living in varied environments, but the concentration of Ca²⁺ of extracellular fluids is maintained at similar levels (1–2 mM). Terrestrial animals obtain Ca²⁺ from their diet, and whole body Ca²⁺ homeostasis is regulated by intestinal uptake and renal reabsorption. Teleosts fish live in water that contains varying [Ca²⁺], and obtain Ca²⁺ from environmental water. Freshwater (FW) usually contains ∼ 0.2 mM Ca²⁺ (soft water) or ∼1.5 mM Ca²⁺ (hard water). FW fish absorb Ca²⁺ by 1) the epithelial Ca²⁺ channel (ECaC/TRPV5) on the apical membrane (43) and 2) Na⁺/Ca²⁺ exchanger 1 (NCX1) on the basolateral membrane in ionocytes, which are scattered on the gill and the skin surfaces (35, 51). Seawater (SW) contains ∼10 mM Ca²⁺. Therefore, SW fish maintain whole body Ca²⁺ homeostasis by excreting excess Ca²⁺ from the intestine and kidney. In the intestine, Ca²⁺ from the ingested seawater reacts with intestinally secreted HCO₃⁻ to form insoluble carbonates (CaCO₃ and MgCO₃), which are excreted rectally (54). The intestinal HCO₃⁻ is mediated by the basolateral Na⁺-HCO₃⁻ cotransporter NBCe1 and apical Cl⁻/nHCO₃⁻ exchanger Slc26a6, both of which are upregulated after seawater acclimation (25). SW fish form a small amount of urine that contains a high concentration of divalent ions (15): 57–167 mM Mg²⁺, 29–125 mM SO₄²⁻, and 7.5–39 mM Ca²⁺. Although urinary [Ca²⁺] of SW fish vary among species, urine is a major route of Ca²⁺ excretion. In SW fish, the glomerular filtration rate is very low (glomerular kidney) or absent (aglomerular kidney), necessitating that divalent ions are actively secreted from the renal tubules and concentrated. Therefore, the SW fish kidney is a good model of renal secretion of divalent ions. Recently, Cl⁻/SO₄²⁻ exchangers Slc26a6A and Slc26a6B were identified as mediating renal SO₄²⁻ secretion in seawater (22, 52–53). However, ion transporters that are involved in renal Mg²⁺ or Ca²⁺ secretion have not yet been identified.

NCX is a family of membrane protein and categorized as solute carrier 8 (Slc8) family (33, 41). Humans have three NCX genes (NCX1, NCX2, and NCX3) (33). Recently, a fourth NCX gene (NCX4) was discovered (34), and duplicates for NCX1, NCX2, and NCX4 were found in all sequenced teleost genomes (40). Zebrafish have seven NCX genes (NCX1a, NCX1b, NCX2a, NCX2b, NCX3, NCX4a, and NCX4b) (29). Mammalian NCX1 catalyzes exchange of three Na⁺ for one Ca²⁺, and the Na⁺/Ca²⁺ exchange current is inhibited by [Na⁺]_i and enhanced by [Ca²⁺]_i. In mammals, NCX1 is ubiquitously expressed, while NCX2 and NCX3 are expressed in the brain and muscle. NCXs mediate Ca²⁺ efflux and maintain cellular Ca²⁺ homeostasis in the nervous system, heart, and skeletal muscle (33, 41). NCX3 is also involved in Ca²⁺ translocation out of osteoblasts into calcifying bone matrix (45). In the epithelia, NCX1 is found at the basolateral membrane of renal tubule cells (31) and branchial ionocytes (17). In combination with apical Ca²⁺ channel, TRPV5 and TRPV6 (ECaC), which absorb Ca²⁺ (lumen to cytosol), basolateral NCX1 and the plasma-membrane Ca²⁺-ATPase (14, 31) mediate Ca²⁺ transport from the cytosol to extracellular space. Thus, mammalian NCX1 is also involved in Ca²⁺ absorption to maintain whole body Ca²⁺ homeostasis. In contrast, Ca²⁺ excretion is believed to be passively regulated by reducing the intestinal uptake or renal reabsorption of Ca²⁺. Hence, active epithelial Ca²⁺ excretion has not been well elucidated in mammals or in fish.

In this study, we identified and characterized NCXs in a SW pufferfish torafugu (Takifugu rubripes) whose genome sequence was published in 2002 (2) and, importantly, in its close relative mefugu (Takifugu obscures). Mefugu is a euryhaline pufferfish that can acclimate to both freshwater and seawater (24). Among seven members of the fugu NCX family, NCX2a was found to be highly expressed in the SW torafugu kidney. NCX2a mRNA markedly increases when mefugu was transferred from freshwater to seawater. Interestingly, NCX2a was not expressed in the zebrafish, a FW fish, kidney (29). Immunohistochemistry revealed apical membrane localization of NCX2a in the proximal tubule cells where Ca²⁺ excretion is expected to occur in SW fish. This study seems to be the first characterization of the renal Ca²⁺ excretory system at the molecular level.

MATERIALS AND METHODS

Experimental animals.

The animal protocols and procedures were approved by the Institutional Animal Care and Use Committee of the Tokyo Institute of Technology and Mayo Clinic (Xenopus) and conform to the American Physiological Society's Guiding Principles in the Care and Use of Laboratory Animals (1). Mefugu (T. obscurus) were purchased from a local dealer and held in 150-liter indoor tanks containing brackish water (3–14% diluted seawater) until use. For freshwater samples, mefugu were transferred to 150-liter freshwater tanks and held for 8–9 days before sample collection. For seawater samples, mefugu in freshwater tanks were transferred to 150-liter seawater tanks and acclimated for 8–9 days. Torafugu (T. rubripes) were purchased from a local dealer and held in 150-liter indoor tanks containing seawater until use. The water temperature was maintained at 18–22°C. The fish were fed daily with commercial fish pellets. Artificial seawater (Rohto-Marine) was obtained from Rei-Sea (Tokyo, Japan). The experimental animals were anesthetized by immersion in 0.1% ethyl m-aminobenzoate (MS-222; tricaine) before being killed. After decapitation, the tissues were dissected, snap-frozen in liquid nitrogen, and stored at −80°C until use.

Quantitative determination of serum and urine calcium concentration.

Sera were prepared from torafugu, and their calcium concentrations were determined by o-cresolphthalein complexone method as described previously (23). Bladder urine was collected from torafugu, SW mefugu, and FW mefugu. Urine (50 μl) was transferred to 8-ml Teflon tubes (Nalgene, Tokyo, Japan), and 1 ml of concentrated nitric acid was added. Samples were digested at 90°C for 30 min, 120°C for 3 h in order, and then they were left to complete dryness at 90°C. The residues were dissolved in 0.08 M nitric acid containing 5 μg/ml Be. Concentration of calcium in bladder urine of FW mefugu were measured by inductively coupled plasma atomic emission spectrometry (model ICPS-8100; Shimazu, Kyoto, Japan), using Be as an internal standard. Concentration of calcium in bladder urine of FW mefugu were measured by inductively coupled plasma mass spectrometry (ELAN DRC-e; Perkin Elmer, Waltham, MA), using Be as an internal standard. The average calcium concentrations were statistically analyzed by ANOVA followed by the Tukey-Kramer test using GraphPad Prism software (GraphPad, San Diego, CA).

RNA isolation and molecular cloning.

Total RNA was isolated from various tissues by acidic guanidinium thiocyanate-phenol-chloroform extraction with Isogen (Nippon Gene, Tokyo, Japan) as previously described (25, 38). Tissues were homogenized in Isogen (1 g of tissue per 10 ml of Isogen) by using a Polytron tissue homogenizer, followed by guanidinium thiocyanate-phenol-chloroform extraction, isopropanol precipitation, and 70% (vol/vol) ethanol washing of precipitated RNA. The RNA was dissolved in diethyl pyrocarbonate-treated water, and its concentration was measured spectrophotometrically at 260 nm.

Genes encoding torafugu NCXs (Slc8) were identified by mining a torafugu genomic database (http://genome.jgi-psf.org/Takru4/Takru4.home.html). Partial or full-length cDNAs of mefugu NCXs were obtained by RT-PCR using primers designed and based on the genomic database (Table 1). cDNAs were directly sequenced or subcloned into pBluescript II SK(−) (Stratagene, La Jolla, CA) and then sequenced. The sequences have been deposited in GenBank/EMBL/DDBJ under accession nos. AB662950, AB662951, AB663107, AB662952, AB662953, AB662954, and AB662955. Partial cDNA of Tetraodon NCX2a was obtained by RT-PCR from the kidney of T. nigroviridis in brackish water at 10 ppt salinity with the following primers: forward 5′-GTGGAATGAGACGGTGTCCAACCT-3′ and reverse 5′-TGAAGGCGCACGAAGAAGTGCTTG-3′. The sequence has been deposited in GenBank/EMBL/DDBJ under accession no. AB662956.

Table 1.

List of primers used for PCR amplification

Gene	Sequence	Remark
NCX1a	GCAGTTTGTTGAAGCTATCACGA	RT-PCR (S)
	AGGCCTGAATGTGGCAGTAG	RT-PCR (AS)
NCX1b	TTCGACTACGTCATGCACTT	RT-PCR (S)
	GCCCTTGATGTGACAGTAGG	RT-PCR (AS)
NCX2b	ACCATGGAGGTGACCGTGGTGCGTAA	RT-PCR (S)
	GGGTGGAACGCAGGCAAACAGAACCT	RT-PCR (AS)
NCX3	CGACTACGTCATGCACTTCC	RT-PCR (S)
	AGAAGAGGATGTAGAGCAACCA	RT-PCR (AS)
NCX4a	TGCTTCGACTACATCATGCAC	RT-PCR (S)
	ACGAAGAGGAGCGACGTTAG	RT-PCR (AS)
NCX4b	CTGCTTCGATTACATCATGCAC	RT-PCR (S)
	AACCACAGCGAGATGAACAG	RT-PCR (AS)
NCX2a	AGGTGCAGCCAATTCCTAAC	RT-PCR (S)
	GATATACAGGAACCATAGTCCGAA	RT-PCR (AS)
	TCAATGGGAGTTTTGATGCTAC	Real-time PCR (S)
	ATACAGGAACCATAGTCCGAA	Real-time PCR (AS)
	TGGGGATCCGACCTCAAAGCTAAACACC	Antigen(S)
	TTCGAATTCCGCTCCCATCTTGGGTATGGA	Antigen (AS)
	ATGGGTCCCCTCAGAGTTAC	Full-length cloning (S)
	TCAGAATCCCCGAATATGGCAG	Full-length cloning (AS)
GAPDH	GGCCCAATGAAAGGCATTCT	Real-time PCR (S)
	TGGGTGTCGCCGTTGAA	Real-time PCR (AS)
β-actin	AGCGTGGGTACTCCTTCACTAC	RT-PCR (S)
	TCGTACTCCTGCTTGCTGATCC	RT-PCR (AS)

NCX, Na⁺/Ca²⁺ exchanger. In parentheses: S, sense primer; AS, antisense primer.

Sequence analysis of NCX2a.

The phylogenic relationship between the amino acid sequences of the fish and mammalian NCXs was analyzed using the ClustalW software (48) of the DNA Data Bank of Japan website. A phylogenetic tree was constructed using MEGA software (47) based on the neighbor-joining method with 1,000 bootstrap replicates. The amino acid sequences of mefugu NCX2a (mfNCX2a) and other species were initially aligned using ClustalW software and then imported into GENETYX version 8.2.0 (Genetyx, Tokyo, Japan) for manual editing. Ca²⁺-binding sites and the exchanger inhibitory peptide (XIP) site are also shown in the aligned sequences (55). Ca²⁺-binding sites have been implicated in Ca²⁺-dependent activation, and the XIP site has been implicated in Na⁺-dependent inactivation. The XIP region, first identified as a calmodulin binding site-like sequence, is composed of 20 amino acids and has an autoregulatory function as evidenced by the fact that exogenously added peptide, with the XIP sequence, potently inhibits the exchange activity (28). Hydrophobic segments were calculated by the method of Kyte and Doolittle (26) using the GENETYX software and SOSUI transmembrane prediction algorithm (13).

Semiquantitative RT-PCR.

First-strand complementary DNA was synthesized by reverse transcribing total RNA using random hexamers and the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA). The cDNA (0.125 μl of the Super Script III reaction) was used as the template for PCR with the specific set of primer of each gene (Table 1). These primers anneal to cDNAs encoding mefugu and torafugu NCXs. Each reaction consisted of 0.125 μl of cDNA, 0.4 μM each primer, GoTaq Green Master Mix 12.5 μl (2×; Promega, Madison, WI) and nuclease-free water in a final volume of 25 μl. The PCR reaction conditions were as follows: 27 or 32 cycles of initial denaturation (94°C, 2 min), denaturation (94°C, 15 s), annealing (55°C, 30 s), extension (72°C, 1 min), and a final extension (72°C, 10 min). After PCR amplification, 5 μl of each reaction mixture was run on a 1.5% agarose gel in Tris·HCl/acetic acid/EDTA buffer. The gel was stained with 0.5 μg/ml ethidium bromide, and the fluorescence image was analyzed with an Image Station 2000R system (Eastman Kodak, Rochester, NY).

Real-time PCR.

Expression of mfNCX2a was quantified by real-time PCR analysis. Total RNAs were extracted from the kidney of mefugu acclimated to seawater and freshwater (n = 5 for each group) and reverse-transcribed into cDNA using oligo(dT) primer and the SuperScript III First-Strand Synthesis System (Invitrogen). Multiplex real-time PCRs were performed to quantify mfNCX2a mRNA expression; GAPDH mRNA was amplified as an endogenous control. Reactions were performed with the SYBR Green method using SYBR Premix Ex Taq II Kit (Takara Bio, Otsu, Japan) on a Thermal Cycler Dice Real-Time System (Takara Bio). Results were analyzed using relative standard curves and melting curves. mRNA concentrations of mfNCX2a were normalized to GAPDH levels. Experiments were performed in duplicate. Data are expressed as means ± SE, and were statistically analyzed by Student's t-test using GraphPad Prism software.

Antibody production.

A cDNA fragment encoding a part of mfNCX2a (amino acid residues 286–519) was used for the production of recombinant protein as an antigen. The fragment was subcloned into EcoRI/BamHI site of the bacterial expression vector pRSET A (Invitrogen). BL21 (DE3)/pLysS Escherichia coli (Novagen, San Diego, CA) cells transformed with the expression vectors were used to inoculate 1.5 liters of Luria-Bertani broth containing 100 μg/ml ampicillin. The cultures were grown to an absorbance at 600 nm of 0.55–0.60 at 37°C, and protein expression was induced by the addition of isopropyl-1-thio-β-d-galactopyranoside to a final concentration of 1 mM for 6 h. The cells were harvested from the cultures by centrifugation, and the cell pellets were resuspended in 20 ml of PBS containing 1 mg/ml lysozyme (Seikagaku, Tokyo, Japan). Cells were disrupted by freezing-thawing and sonication, the lysates were centrifuged at 12,000 g for 20 min, and the insoluble fractions were recovered as a pellet. The recombinant proteins were solubilized, purified with a metal affinity resin (BD TALON, Clontech), and then dialyzed against saline [0.9% (wt/vol) NaCl] at 4°C. Polyclonal antibodies were prepared in Japanese white rabbits by intramuscular injection of ∼200 μg of purified recombinant protein, emulsified with the adjuvant TiterMax Gold (1:1; CytRx; Norcross, GA), at 1-mo intervals. The rabbits were bled 7 days after the third immunization.

The anti-NCX2a immunoaffinity beads were prepared as follows. The insoluble antigen (1.9 mg in 1 ml of 0.2 M NaHCO₃, 0.5 M NaCl, pH 8.3) was treated with 0.2% sarkosyl, sonicated and boiled at 65°C for 5 min; this process was repeated after the addition of 1% SDS. A large portion of the antigen became soluble when treated with 2% 2-mercaptoethanol and boiled for 5 min. The antigen was covalently coupled to 1 ml of the HiTrap NHS-activated HP column (GE Healthcare) according to the manufacturer's protocol. The antiserum (50 μl in 1 ml PBS) was incubated with the affinity column for 30 min at room temperature and then unbound antibody was collected by flushing with 1 ml of PBS and saved as control antigen-absorbed antiserum.

Antibody specificity.

Antibody specificity was established by staining COS7 cells exogenously expressing mefugu NCX2a proteins. For expression in mammalian cells, full-length cDNA of NCX2a was subcloned into the EcoRV site of pcDNA3.1 vector (Invitrogen). COS7 cells were cultured in DMEM (Sigma-Aldrich) containing 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin. The cells were transfected with plasmids encoding mfNCX2a, or an empty vector (mock transfection) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. For immunofluorescence experiments, 36 h after transfection, the cells were fixed with 4% paraformaldehyde in PBS (pH 7.4) at 4°C for 10 min, permeabilized with 0.1% Triton X-100 in PBS at 4°C for 10 min, and blocked with 5% FBS in PBS for 1 h at room temperature. After blocking, cells were reacted with anti-mfNCX2a antiserum (1:1,000) for 1 h at room temperature. Cells were then washed with PBS and treated with Alexa Fluor 488-labeled goat polyclonal antibodies specific for rabbit IgG (1:2,000; Invitrogen) and Hoechst 33342 (100 ng/ml; Invitrogen) for 1 h at room temperature. Preimmune serum was used for negative control. Fluorescence images were acquired with a laser confocal microscope (model TCS-SPE; Leica, Wetzlar, Germany) by using a fixed setting and processed with LAS AF software (Leica).

Western blot analysis.

For Western blot analyses, membrane fractions were collected from mfNCX2a-overexpressing or mock-transfected COS7 cells as described previously (37). The cells were washed three times in PBS, homogenized in homogenization buffer (50 mM Tris, 10 mM EDTA, and protease inhibitor mixture, pH 7.5), and then centrifuged at 4,000 g for 20 min. The supernatants were then centrifuged at 17,000 g for 1 h, and the resulting pellets containing plasma membranes were resuspended in homogenization buffer containing 1% Triton X-100. Protein concentrations in the samples were determined by the BCA protein assay kit (Thermo Fisher Scientific, Rockford, IL). The membrane proteins (1 μg) were separated by SDS-PAGE using 10% polyacrylamide gel and electroblotted onto a PVDF membrane. After blocking in 10 mM Tris·HCl, pH 8.0, containing 150 mM NaCl, 0.05% Tween 20, and 5% nonfat milk for 1 h at room temperature, the PVDF membrane was incubated with anti-NCX2a antiserum or antigen-absorbed antiserum at 1:1,000 dilution for 12 h at 4°C. Bound antibodies were detected using peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA) and chemiluminescent substrate solution (Immobilon Western, Millipore, Billerica, MA), and the signals were captured using an Image Station 2000R (Kodak, Rochester, NY).

In situ hybridization.

Kidney from SW mefugu was perfused and fixed with 10% buffered neutral formalin (Muto Pure Chemicals, Tokyo, Japan), harvested, embedded in paraffin, and sectioned (4 μm). Full-length NCX2a cDNA was used as the template for the preparation of digoxigenin (DIG)-labeled riboprobes. A DIG RNA labeling mix (Roche Diagnostics, Mannheim, Germany) was used for synthesis of DIG-labeled sense and antisense probes. Alkaline phosphatase-conjugated anti-DIG antibodies and nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate substrates were used to visualize the signal; then the sample was counterstained with Kernechtrot (Muto Pure Chemicals, Tokyo, Japan).

Serial sections were stained with hematoxylin/eosin or anti-Na⁺-K⁺-ATPase antibodies as previously described (24). Images were acquired by using TOCO automatic virtual slide system (Claro, Hirosaki, Japan) and a microscope equipped with a digital charge-coupled device (CCD) camera (AxioCam HRc; Carl Zeiss, Oberkochen, Germany) and processed with AxioVision 4.1 software (Carl Zeiss).

Immunohistochemistry.

SW mefugu kidney specimens were fixed in 4% paraformaldehyde in 100 mM phosphate buffer (pH 7.4) at 4°C for 1 h, and rinsed in PBS. After incubation in 20% sucrose in PBS for 16 h at 4°C, specimens were frozen in Tissue Tek OCT compound on a cryostat holder. Sections (6 μm) were prepared on a −20°C cryostat and mounted on 3-aminopropyltriethoxysilane-coated glass slides and air-dried for 1 h. After being washed with PBS, the sections were blocked with 10% FBS in PBS for 1 h at room temperature and then reacted with anti-mfNCX2a antiserum and preimmune serum (1:1,000) for 1 h at room temperature. Sections were then washed with PBS and incubated with a mixture of Alexa Fluor 488-labeled anti-rabbit secondary antibodies (1:2,000; Invitrogen), tetramethylrhodamine isothiocyanate (TRITC)-labeled phalloidin (0.15 μM; Sigma-Aldrich), and Hoechst 33342 (100 ng/ml; Invitrogen) in PBS containing 10% FBS at 20°C for 1 h. Followed by washing with PBS, the sections were mounted with a coverslip and the fluorescence was detected using an Axiovert 200M epifluorescence microscope (Carl Zeiss). The fluorescence images were obtained with a CCD camera (AxioCam HRm, Carl Zeiss) and processed with AxioVision 4.1 software (Carl Zeiss).

Expression of mfNCX2a in Xenopus oocytes and electrophysiology.

Full-length mfNCX2a cDNA was inserted into the pGEMHE Xenopus laevis expression vector (30). The plasmid was linearized with NotI, and cRNA was generated in vitro using T7 RNA polymerase and mMESSAGE mMACHINE kits (Ambion, Austin, TX). X. laevis oocytes were dissociated with collagenase as previously described (25) and injected with 25 nl of water or a solution containing cRNA at 1 μg/μl (25 ng/oocyte) using a Nanoject-II injector (Drummond Scientific, Broomall, PA). Oocytes were incubated at 16°C in OR₃ medium (42) and studied 3–6 days after injection.

Current-voltage (I-V) relationships of cRNA or water-injected oocytes in the presence or absence of Na⁺, Ca²⁺, and Mg²⁺ were analyzed by two-electrode voltage clamp analyses of Xenopus oocytes. An oocyte was perfused with ND96 medium and then clamped at a holding potential of −60 mV. After that, the oocyte was perfused with test solutions with differential contents of Na⁺, Ca²⁺, and Mg²⁺. ND96 contained 96 mM NaCl, 2 mM KCl, 1 mM MgCl₂, 1.8 mM CaCl₂, and 5 mM HEPES (pH 7.5). In 0 Ca²⁺ or 0 Mg²⁺ solutions, CaCl₂ or MgCl₂ was removed from ND96. In 0 Na⁺ solutions, Na⁺ was replaced by choline. In 10 mM Ca²⁺ solution, 12.3 mM NaCl or choline chloride was replaced by 8.2 mM calcium gluconate. In 10 mM Mg²⁺ solution, 13.5 mM NaCl or choline chloride was replaced by 9 mM magnesium gluconate.

The oocyte currents were recorded with an OC-725C voltage clamp (Warner Instruments, Hamden, CT) using Pulse software (HEKA, Lambrecht, Germany) as previously described (6). For periods when I-V protocols were not being run, oocytes were clamped at a holding potential of −60 mV, and current was constantly monitored and recorded at 1 Hz. I-V protocols consisted of 200-ms steps from a holding potential in 20 mV steps between −160 and +60 mV. Data were expressed as the means ± SE.

RESULTS

Determination of calcium in urine and serum of pufferfish.

Calcium concentrations of sera and bladder urine from SW mefugu, FW mefugu, and torafugu are shown in Table 2. Serum calcium concentrations of pufferfish were ∼3 mM, and there was no significant difference among SW mefugu, FW mefugu, and torafugu. In contrast, calcium concentration of bladder urine from FW mefugu was significantly lower than those of SW mefugu and torafugu (P < 0.05, n = 3–4).

Table 2.

Calcium concentrations of sera and bladder urine from mefugu and torafugu

	Mefugu (SW)	Mefugu (FW)	Torafugu (SW)
Serum Ca, mM	3.1 ± 0.2	3.5 ± 0.3	2.9 ± 0.1
Urine Ca, mM	7.6 ± 2.8	1.4* ±0.2	19.8 ± 5.3

Values are means ± SE (n = 3–4). SW, seawater; FW, freshwater. Serum calcium concentrations of mefugu were measured by Kato et al. (23).*P < 0.05.

Identification and tissue distribution of NCX family members of pufferfish.

We searched for homologs of human and zebrafish NCX family members and identified seven candidates in the torafugu genome. Phylogenetic analyses demonstrated that torafugu has two NCX1 genes, two NCX2 genes, one NCX3 gene, and two NCX4 genes (Fig. 1). To identify which NCX is involved in renal Ca²⁺ excretion, tissue distribution of torafugu NCXs was analyzed by RT-PCR (Fig. 2A). Among seven NCXs tested, only NCX2a was highly expressed in the torafugu kidney.

Fig. 1.

Phylogenetic analysis of the Na⁺/Ca²⁺ exchanger (NCX) family. The tree was generated using the neighbor-joining method with ClustalW (48) and MEGA4 (47). The numbers show bootstrap values (1,000 replications). The scale bar represents a genetic distance of 0.05 amino acid substitutions per site. The mefugu (Takifugu obscurus) NCX2a is indicated by a black circle. The GenBank accession nos. of the amino acid sequences used are as follows: human NCX1, P32418; human NCX2, Q9UPR5; human NCX3, NP_150287; mouse NCX1, P70414; mouse NCX2, NP_683748; mouse NCX3, NP_536688; zebrafish NCX1a, NM_001037102; zebrafish NCX1b, NM_001039144; zebrafish NCX2a, NM_001123296; zebrafish NCX2b, NM_001123284; zebrafish NCX3, NM_001123256; zebrafish NCX4a, NM_001089419; zebrafish NCX4b, NM_001123240; torafugu (Takifugu rubripes) NCX1a, CAAB01007576; torafugu NCX1b, CAAB01000103; torafugu NCX2a, CAAB01002497; torafugu NCX2b, CAAB01001252; torafugu NCX3, CAAB01001148; torafugu NCX4a, CAAB01000046; torafugu NCX4b, CAAB01002000; Tetraodon (Tetraodon nigroviridis) NCX1a, CAF93335; Tetraodon NCX1b, CAG00274; Tetraodon NCX2a, AF95011 and AB662956; Tetraodon NCX2b, CAG06357; Tetraodon NCX3, CAG13245; Tetraodon NCX4a, CAG01582; Tetraodon NCX4b, CAG05743; tilapia (Oreochromis mossambicus) NCX1, AAP37041; and mefugu NCX2a, AB663107.

Fig. 2.

NCXs mRNA expression levels in seawater (SW) and euryhaline pufferfish. A and B: expression analysis of SW pufferfish (torafugu) and euryhaline pufferfish (mefugu) NCXs in various tissues by semiquantitative RT-PCR. β-actin was used as an internal control for all cDNAs used in the analysis. F, freshwater; S, seawater. C: quantitative real-time PCR analysis of NCX2a in the kidney of mefugu. Values are means ± SE of the relative expression levels compared with GAPDH (*P ≤ 0.01).

We next cloned partial or full-length cDNAs for NCXs from mefugu. The nucleotide and amino-acid sequences of mefugu NCX1a (99.0, 100%), NCX1b (99.5, 100%), NCX2a (99.2, 99.0%), NCX2b (99.4, 99.3%), NCX3 (100, 100%), NCX4a (99.7, 100%) and NCX4b (99.7, 100%) are highly identical to the predicted sequences of torafugu NCXs, as indicated in brackets (nucleotide identity and amino acid identity). Tissue distribution of NCXs in FW- and SW-acclimated mefugu was analyzed by RT-PCR and shown in Fig. 2B. The expression patterns of NCXs were very similar between torafugu and mefugu.

The expression level of NCX2a in the kidney of FW- and SW-acclimated mefugu by real-time PCR.

The expression level of NCX2a in the kidney of SW-acclimated mefugu was 2.5 times higher than that detected in FW-acclimated mefugu (P < 0.01, n = 5) (Fig. 2C).

Amino acid sequence of mefugu NCX2a.

To study the significance of renal NCX in the seawater environment, we focused on mefugu NCX2a whose renal expression was induced after seawater acclimation. Full-length cDNA was isolated from the kidney of SW mefugu by RT-PCR. The amino-acid sequence of mfNCX2a is 64%, 61%, 44%, 58%, and 57% identical to zebrafish NCX2a, zebrafish NCX2b, human NCX1, human NCX2, and human NCX3, respectively (Fig. 3). mfNCX2a consists of 897 amino acid residues, and a hydropathy plot demonstrates 12 hydrophobic segments, which correspond to one signal peptide, nine transmembrane segments, one cytoplasmic helical segment, and one pore loop-like structure experimentally modeled by Nicoll et al. (39) and Iwamoto et al. (18) (Fig. 3). The Ca²⁺-binding domains of mfNCX2a are very similar to those of other species, suggesting that mfNCX2a is also regulated by a similar modulation mechanism (Fig. 3). The XIP site of NCX is well conserved among all NCXs in human and zebrafish. In mefugu, torafugu, and Tetraodon NCX2a, however, the XIP site is not well conserved (Figs. 3 and 4). The XIP site is well conserved in NCX2a of other fish species including zebrafish, medaka, and three-spined stickleback (Fig. 4). Therefore, the unconserved XIP sites are unique in NCX2a of pufferfish species and could serve as useful tools for functional analyses of XIP site in future studies.

Fig. 3.

Multiple sequence alignment of mefugu NCX2a. Conserved residues are indicated by black boxes. Exchanger inhibitory peptide (XIP) site and Ca²⁺-binding domains are indicated by filled gray boxes. Transmembrane (TM) domains, putative signal peptide (SP), pore loop-like structure containing GIG sequence (P loop), and intracellular helix (Helix) modeled by Nicoll et al. (39) and Iwamoto et al. (18) are overlined. Twelve predicted hydrophobic segments of mefugu NCX2a are indicated by open gray boxes. The GenBank accession nos. are as follows: human NCX1 (hNCX1), P32418; human NCX2 (hNCX2), Q9UPR5; human NCX3 (hNCX3), NP_150287; mefugu NCX2a (mfNCX2a), AB663107; zebrafish NCX2a (zNCX2a), NM_001123296; and zebrafish NCX2b (zNCX2b), NM_001123284.

Fig. 4.

XIP site of NCX family. XIP site is indicated by gray box. Conserved residues are indicated by black boxes. The GenBank accession nos. of human, mouse, zebrafish, Tetraodon, tilapia, torafugu, and mefugu NCXs are shown in the legend of Fig. 1. The GenBank accession nos. of the other sequences are as follows: stickleback (Gasterosteus aculeatus) NCX2a, AANH01000530; and medaka (Oryzias latipes) NCX2a, BAAF04093455.

Expression of NCX2a mRNA in the proximal tubule of mefugu kidney.

The mRNA distribution of NCX2a in the kidney of SW mefugu was analyzed by in situ hybridization. DIG-labeled antisense cRNA probes for NCX2a produced strong signals in the renal tubule (Fig. 5C), and no hybridization was observed with a sense probe (Fig. 5D).

Fig. 5.

In situ hybridization analysis of mefugu NCX2a in the SW mefugu kidney. Paraffin-embedded kidney sections were stained with anti-Na⁺-K⁺-ATPase antibodies (NKA) (A), hematoxylin/eosin (B), and DIG-labeled antisense and sense cRNA probes for mfNCX2a (C and D). The proximal tubule segments I (P I) and II (P II) were distinguished by their location and immunoreactivity for Na⁺-K⁺-ATPase. G, glomerulus; D, distal tubule; C, collecting duct. Scale bars = 20 μm.

To identify nephron segments that express NCX2a, serial sections were stained with hematoxylin or anti-Na⁺-K⁺-ATPase antibody (Fig. 5, A and B). NCX2a-positive segments were characterized by the presence of a brush border and shallow basolateral infoldings that are strongly labeled by anti-Na⁺-K⁺-ATPase antibody. The proximal tubule could be divided into two segments based on their Na⁺-K⁺-ATPase contents: segment I (P I) that was weakly stained with anti-Na⁺-K⁺-ATPase and segment II (P II) that was strongly positive for Na⁺-K⁺-ATPase. The latter was the site of NCX2a expression (Fig. 5C). No NCX2a mRNA was detected in the glomeruli, distal tubules, and collecting ducts.

Apical localization of mefugu NCX2a.

Rabbit polyclonal antiserum was raised against a recombinant protein containing a fragment of a cytoplasmic loop of mfNCX2a. Immunocytochemical analysis showed that anti-mfNCX2a antiserum strongly stained COS7 cells expressing mfNCX2a but not mock-transfected COS7 cells (Fig. 6A). The signal was not detected when COS7 cells expressing mfNCX2a were stained with preimmune serum (Fig. 6A) or antigen-absorbed antiserum (data not shown). Bands of ∼98 kDa were detected by Western blot analysis in membrane preparations of COS7 cells expressing mfNCX2a using anti-mfNCX2a antiserum, but the bands were not detected when antigen-absorbed antiserum was used (Fig. 6B). These results demonstrated that anti-mfNCX2a antiserum recognizes mfNCX2a.

Fig. 6.

Mefugu NCX2a localizes to the apical membrane of renal proximal tubules. A: specificity of mfNCX2a antibodies was established by transfecting COS7 cells with pcDNA3-mfNCX2a constructs (a, b) or vector alone (c) and stained with rabbit anti-mfNCX2a (green). Nuclei were stained with Hoechst (red). B: Western blot analysis. COS7 cells were transfected with pcDNA3 (mock) and pcDNA3-mfNCX2a constructs, and the membrane fractions of the cells were analyzed by Western blot analysis using anti-NCX2a antiserum (left) and antigen-absorbed antiserum (right). Arrow indicates the position of the detected band of mfNCX2a. C: immunohistochemistry of SW mefugu kidney using anti-NCX2a antibody. Kidney proximal tubules were stained with anti-mfNCX2a antibody (green). P, proximal tubule; D, distal tubule; C, collecting duct. Scale bars = 20 μm.

Next, immunohistochemical analyses were performed on frozen kidney sections from SW mefugu using anti-mfNCX2a antiserum (Fig. 6, C-a). Proximal tubules were identified by staining the apical brush borders with the F-actin marker phalloidin-TRITC. In SW mefugu, strong NCX2a-specific signals were detected in apical brush-border regions of proximal tubules (Fig. 6C, a and c–e), but not in distal tubules or collecting ducts (Fig. 6, C-a). No signal was obtained with preimmune serum (Fig. 6, A–b) or antigen-absorbed antiserum (data not shown).

Functional analysis of mefugu NCX2a.

Xenopus oocytes were injected with mfNCX2a cRNA, cultured, and voltage clamped to determine I-V relationships (Fig. 7). When all [Na⁺]_o is replaced with choline (0 Na ND96), strong positive current of ∼1.6 ± 0.4 μA was observed in mfNCX2a oocytes at −60 mV (Fig. 7B, curve b). This current disappeared when extracellular Ca²⁺ was removed (curves c and d) but was not altered when extracellular Mg²⁺ was removed (curve a). These results indicate that mfNCX2a is an electrogenic nNa⁺/Ca²⁺ exchanger.

Fig. 7.

Electrophysiological analyses of Xenopus oocytes expressing NCX2a. Current-voltage (I-V) relationships of oocytes expressing NCX2a (A) and water-injected (B) oocytes in the presence or absence of Na⁺, Ca²⁺, and Mg²⁺ are shown. Values are means ± SE, n = 3–7.

DISCUSSION

In the present study, we identified NCX2a as a most likely candidate for the renal Ca²⁺ excretion transporter in SW fish. Until this study, renal Ca²⁺ excretion by SW fish was not well characterized compared with other well-investigated calcium entry or exit pathways such as: 1) rectal excretion of CaCO₃ by SW fish (25, 54), 2) branchial absorption of Ca²⁺ by FW fish (35, 43, 51), and 3) intestinal and renal (re)absorption by mammals (46). Renal Ca²⁺ excretion may nevertheless be quite important for SW fish because of the following reasons. First, the rectal excretion of CaCO₃ is the pathway that strongly blocks the absorption of intestinal Ca²⁺ in ingested seawater, but cannot excrete Ca²⁺ from the body fluid. Second, the urine of SW fish contains a relatively high concentration of Ca²⁺ (Table 2) (15). Third, transepithelial flux of Ca²⁺ was observed by using primary monolayer cultures of winter flounder proximal tubule epithelium (32). Although it is unknown whether the Ca²⁺ efflux is mediated via a transcellular or paracellular routs, our present results of mefugu NCX2a strongly suggest the presence of transcellular secretory pathway of Ca²⁺ (Fig. 8B).

Fig. 8.

Model of calcium excretion by marine teleosts. A: rectal and renal calcium excretions by fish in SW. Renal Ca²⁺ excretion mediated by NCX2a is suggested in this study. Rectal CaCO₃ excretion is a route of Ca²⁺ elimination by SW fish (25, 54). The CaCO₃ precipitate formation reduces the intestinal Ca²⁺ absorption, and may reduce demand for renal Ca²⁺ excretion. B: hypothetical model of renal Ca²⁺ secretion by SW fish. In proximal tubule, NCX2a mediates Na⁺/Ca²⁺ exchange across apical membrane. Negative membrane potential (V_m) and low [Na⁺]_i generated by Na⁺-K⁺-ATPase may be the driving force for Ca²⁺ secretion. Basolateral transporter or channel that transports Ca²⁺ into the cells has not yet been clarified. C: hypothetical model of intestinal HCO₃⁻ secretion by SW fish based on the study of SW-acclimated mefugu (25). NBC, basolateral Na⁺-HCO₃⁻ cotransporter.

NCX2 was initially isolated from human and rat brain by hybridization screening of a λ phage cDNA library at low stringency using a fragment of NCX1 cDNA as a probe (28). In mammals, the expression of NCX2 is restricted in the brain and spinal cord, but not in other tissues, including the kidney (20). Rat NCX2, exogenously expressed in Xenopus oocytes, exhibited NCX activity similar to NCX1 whose coupling ratio is 3 Na⁺:1 Ca²⁺ (28). In the brain of mammals, NCX2 is predominantly expressed in the hippocampus, cortex, and cerebellum (20). Mice deficient in NCX2 exhibited delayed clearance of elevated Ca²⁺ following depolarization in hippocampal neurons, and exhibited enhanced performance in hippocampus-dependent learning and memory tasks (20). These results demonstrated that NCX2 is a neural regulator of Ca²⁺ in the central nervous system of mammals. NCX2a and NCX2b were initially found in zebrafish as fish-specific paralogs of NCX2 (29). The detailed evolutional study of NCX family in number of vertebrate species by On et al. (40) and our present study on fugu (Fig. 1) demonstrated that NCX2a and NCX2b are conserved among teleosts (e.g., zebrafish, fugu, spotted green pufferfish, three-spined stickleback, and medaka) and may have been created by whole 3R genome duplication in teleosts (5, 19). RT-PCR analyses of various zebrafish tissues indicated that 1) NCX2a is specifically expressed in the ovary and one cell-stage embryo and 2) NCX2b is specifically expressed in the brain, eye, ovary, and one cell-stage embryo (29). In contrast to mammals and FW fish, which tend to lose Ca²⁺, SW fish must excrete excessive Ca²⁺. Thus these considerations and the following data support our conclusion that NCX2a is a key transporter for Ca²⁺ excretion by the kidney of SW fish: 1) no expression of NCX2a was observed in the kidney of zebrafish living in freshwater and 2) as shown in the present study, SW pufferfish torafugu and SW-acclimated euryhaline pufferfish mefugu expressed NCX2a in the kidney at high levels (Fig. 2). This is the first report that indicates the involvement of an NCX family member in Ca²⁺ excretion. The difference of NCX2-gene expression pattern among species living in different environments is quite interesting at the evolutional point of view, and will be a good example of differential use of NCX genes in environmental adaptation of vertebrates.

Apical membrane of renal proximal tubule of SW fish and SW-acclimated euryhaline fish is the site of secretion of divalent ions that are present in a large excess in seawater compared with body fluid. NCX2a is localized in the apical membrane of proximal tubules, and the transcription of its gene is upregulated during seawater acclimation (Figs. 2C and 6C). Although the resolution of a light microscope is not sufficient to conclude whether NCX2a is present at or near the apical membrane, it is highly likely that at least a part of NCX2a is present at apical membrane because 1) NCX2a-immunoreactive signals and palloidin signals were colocalized at the apical membrane of proximal tubules (Fig. 6C), 2) mammalian NCX2 is present at the plasma membrane (28, 36), and 3) NCX activity at the plasma membrane was observed when mefugu NCX2a was expressed in Xenopus oocytes (Fig. 7). This localization and the electrogenic nNa⁺/Ca²⁺ exchange activity of NCX2a are also favorable properties suitable for mediating Ca²⁺ excretion. In the plant Arabidopsis thaliana, an NCX homolog AtMHX was identified as a Mg²⁺/H⁺ exchanger (44). We tested the possibility that NCX2a could act as a Mg²⁺/H⁺ exchanger, but the NCX2a-mediated current measured in Xenopus oocytes is dependent on extracellular Ca²⁺ but not Mg²⁺. Therefore, NCX2a may be involved in Ca²⁺ but not Mg²⁺ homeostasis in SW fish.

Although the rates of glomerular filtration and urinary flow have not been determined in pufferfish, rates of urinary flows are 3.6 and 7.7 times smaller than those of glomerular filtration in SW-acclimated euryhaline fish (coho salmon) and SW fish (southern flounder), respectively (3). Therefore, the filtered ions are 3.6 to 7.7 times concentrated by volume reduction of urine in those fish when there is no renal reabsorption and secretion. Serum calcium concentrations of pufferfish are ∼3 mM (Table 2). When one-half of serum calcium is assumed to bind to albumin and all free Ca²⁺ is filtered by glomeruli, [Ca²⁺] in primary urine is expected to be ∼1.5 mM. Urine calcium concentrations of pufferfish are 7.6–19.8 mM (Table 2) and are 5–13 times higher than those of putative-free [Ca²⁺] in the primary urine. Thus, the volume reduction may contribute significantly but is not sufficient to explain high calcium concentrations in the urine of SW fish, and the presence of Ca²⁺ secretion by renal tubule is highly expected.

The major function of NCXs is to extrude Ca²⁺ from the cytoplasm against gradient by using intracellular low [Na⁺] and negative membrane potential as driving forces. However, the exchangers are reversible and may allow Ca²⁺ entry under special conditions. Therefore, we assessed the property of Ca²⁺ efflux into the forming urine by NCX2a by thermodynamic calculation under assumed ion concentrations and a 3 Na⁺:1 Ca²⁺ stoichiometry. The apical epithelial membrane has a negative membrane potential (V_m) maintained by the basolateral sodium pump (Na⁺-K⁺-ATPase). The thermodynamic electrochemical potential for NCX2a (Δμ_NCX2a) can be calculated based on the equation (see Table 3): Δμ_NCX2a = 3 Δμ_Na − Δμ_Ca = 3·{RT·ln([Na⁺]_i/[Na⁺]_o) + (z_Na)·FV_m} − {RT·ln([Ca²⁺]_i/[ Ca²⁺]_o) + (z_Ca)·FV_m}, where R is the gas constant, T is the absolute temperature, F is the Faraday constant, ln is the natural log, V_m is membrane potential, and z is the ionic valence of Na or Ca. We use this equation for the model of the proximal tubule of SW fish. When putative [Ca²⁺] in primary urine of 1.5 mM is smaller than calculated [Ca²⁺]_o at the condition of equilibria, NCX2a can secrete Ca²⁺ into the urine. When putative [Ca²⁺] in primary urine of 1.5 mM is larger than calculated [Ca²⁺]_o at the condition of equilibria, apical NCX2a absorbs Ca²⁺ from the urine. The calculated [Ca²⁺]_o are 0.4–1.3 mM when V_m is between −60 and −90 mV (Table 3, lines A1–A4) under the following assumptions: 1) [Na⁺]_o is 179 mM, which is similar to plasma [Cl⁻] of SW-acclimated mefugu (23); 2) [Na⁺]_i is 25 mM, which is similar to cytosolic [Na⁺] of salamander proximal tubular cells (4); 3) [Ca²⁺]_i is 0.1 μM; and 4) the temperature is 293 K (20°C). Under these assumptions, NCX2a absorbs Ca²⁺ from the primary urine that may contain ∼1.5 mM Ca²⁺. We next assumed that [Na⁺]_i is 13 mM, which is similar to cytosolic [Na⁺] of mammalian distal convoluted tubule cells (9). The calculated [Ca²⁺]_o are 2.8–9.2 mM, and NCX2a can secrete Ca²⁺ into the primary urine (Table 3, lines B1–B4). When [Ca²⁺]_i is assumed to be 0.35 μM, which is similar to [Ca²⁺]_i of parathyroid hormone (PTH)-stimulated mammalian distal convoluted tubule cells (10), as an example of increased [Ca²⁺]_i by stimulation, the calculated [Ca²⁺]_o are 1.3–4.5 mM when [Na⁺]_i is 25 mM and are 9.8–32 mM when [Na⁺]_i is 13 mM (Table 3, lines C1–D4). These thermodynamic calculations indicate that 1) low [Na⁺]_i, increased [Ca²⁺]_i, and negative V_m are beneficial for Ca²⁺ secretion by NCX2a; and 2) NCX2a absorbs Ca²⁺ when [Na⁺]_i is high and [Ca²⁺]_i is low.

Table 3.

Thermodynamic calculations of [Ca²⁺]_o/[Ca²⁺]_i and [Ca²⁺]_o

Line	Vm, mV	[Na+]i, mM	[Na+]o, mM	[Ca2+]i, μM	[Ca2+]o, mM	[Ca2+]o/[Ca2+]i
A1	−60	25	179	0.1	0.4	4,000
A2	−70	25	179	0.1	0.6	5,900
A3	−80	25	179	0.1	0.9	8,700
A4	−90	25	179	0.1	1.3	13,000
B1	−60	13	179	0.1	2.8	28,000
B2	−70	13	179	0.1	4.2	42,000
B3	−80	13	179	0.1	6.2	62,000
B4	−90	13	179	0.1	9.2	92,000
C1	−60	25	179	0.35	1.4	4,000
C2	−70	25	179	0.35	2.1	5,900
C3	−80	25	179	0.35	3.1	8,700
C4	−90	25	179	0.35	4.5	13,000
D1	−60	13	179	0.35	9.8	28,000
D2	−70	13	179	0.35	14.6	42,000
D3	−80	13	179	0.35	21.7	62,000
D4	−90	13	179	0.35	32.3	92,000

Using various conditions of membrane potential (V_m), [Na⁺]_i, [Na⁺]_o, and [Ca²⁺]_i at the equilibria (Δμ_NCX2a = 0) when the stoichiometry of Na⁺/Ca²⁺ exchange by mfNCX2a is 3 Na⁺:1 Ca²⁺. The temperature is supposed to be 293 K (20°C).

Perspectives and Significance

In fish, whole body Ca²⁺ homeostasis is mainly regulated by hormones such as PTH (hypercalcemic), PTHrP (hypercalcemic), prolactin (hypercalcemic), somatolactin (hypercalcemic), calcitonin (CT; hypocalcemic), and stanniocalcin (STC; hypocalcemic). For example, in zebrafish larvae, the CT level is elevated in high Ca²⁺ water, which in turn negatively regulates the expression of ECaC (27). STC reduces ECaC in zebrafish (49) and branchial Ca²⁺ uptake in tilapia (50). STC also stimulates phosphate reabsorption in cultured proximal tubule cells, but exerts no effects on the net Ca²⁺ flux (32). The expression level of PTH is increased in low Ca²⁺ water and reduced in high Ca²⁺ water (12, 16). PTHrP induces Ca²⁺ influx and reduces Ca²⁺ efflux in larval sea bream (11). Prolactin induced hypercalcemia in eel and tilapia and activates branchial Ca²⁺-ATPase activity (7–8). Exposure of rainbow trout to high- or low-calcium environments reduced or increased the activity of somatolactin-producing cells, respectively (21). The present study and our previous work (25) indicate that renal NCX2a and intestinal Slc26a6s and NBCe1 are involved in calcium excretion by SW-acclimated mefugu (Fig. 8) and implicated them as potential targets for regulation by the above-mentioned hyper and hypocalcemic factors at transcriptional and posttranscriptional levels.

GRANTS

This work was supported by the Ministry of Education, Culture, Sports, Science, and Technology of Japan (MEXT) Grants-in-Aid for Scientific Research 14104002, 18059010, 21770077, and 22370029, the 21st Century and Global Center of Excellence Program of MEXT, and the Sumitomo Foundation Grant 100535. Work in the Romero lab was supported by National Institutes of Health Grants EY017732, DK083007, and DK090728.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).