Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Dec 1.
Published in final edited form as: Anesthesiology. 2011 Dec;115(6):1162–1171. doi: 10.1097/ALN.0b013e318239355d

A Gain-of-function Mutation in Adenylate Cyclase Confers Isoflurane Resistance in C. elegans

Owais Saifee 3,4, Laura B Metz 1, Michael L Nonet 3,4, C Michael Crowder, Rose T Brown 1,2,4
PMCID: PMC3226976  NIHMSID: NIHMS334218  PMID: 22024713

Abstract

Background

Volatile general anesthetics inhibit neurotransmitter release by a mechanism not fully understood. Genetic evidence in C. elegans has shown that a major mechanism of action of volatile anesthetics acting at clinical concentrations in this animal is presynaptic inhibition of neurotransmission. To define additional components of this presynaptic volatile anesthetic mechanism, C. elegans mutants isolated as phenotypic suppressors of a mutation in syntaxin, an essential component of the neurotransmitter release machinery, were screened for anesthetic sensitivity phenotypes.

Methods

Sensitivity to isoflurane concentrations was measured in locomotion assays on adult C. elegans. Sensitivity to the acetylcholinesterase inhibitor aldicarb was used as an assay for the global level of C. elegans acetylcholine release. Comparisons of isoflurane sensitivity (measured by the EC50) were made by simultaneous curve-fitting and F-test.

Results

Among the syntaxin suppressor mutants, js127 was the most isoflurane resistant with an EC50 more than three-fold wild type. Genetic mapping, sequencing, and transformation phenocopy showed that js127 was an allele of acy-1, which encodes an adenylate cyclase expressed throughout the C. elegans nervous system and in muscle. js127 behaved as a gain-of-function mutation in acy-1 and had increased levels of cyclic adenosine monophosphate. Testing of single and double mutants along with selective tissue expression of the js127 mutation revealed that acy-1 acts in neurons within a G□s – PKA – UNC-13-dependent pathway to regulate behaviour and isoflurane sensitivity.

Conclusions

Activation of neuronal adenylate cyclase antagonizes isoflurane inhibition of locomotion in C. elegans.

Introduction

Volatile general anesthetics (VAs) have a complex set of actions on neurotransmission that summate to produce general anesthesia 1. VAs promote inhibitory synaptic transmission by potentiation of γ-aminobutryic acid type A and glycine receptors and decrease excitatory transmission by multiple potential mechanisms. Transmitter release is reduced at both inhibitory and excitatory synapses by VAs, but VA potency and efficacy are greater at excitatory synapses 1. Thus, the net presynaptic VA effect should be a decrease in central nervous system excitability. Biochemical and electrophysiological evidence have implicated inhibition of sodium channels as one molecular mechanism whereby VAs inhibit neurotransmitter release 1. However, blockade of sodium channels does not account for the entire inhibition of transmitter release, at least at some synapses 2; rather, the transmitter release machinery that lies mechanistically downstream of the sodium channel is a good candidate as the residual VA target.

In the nematode C. elegans, we found that an unusual mutation in the unc-64 gene, which encodes C. elegans neuronal syntaxin, fully blocked the behavioral effects of clinical concentrations of isoflurane (by this we mean concentrations that fall within the range used for human anesthesia, up to 2-fold the minimum alveolar concentrations of isoflurane which produces 0.62 mM aqueous concentration; isoflurane EC50 against coordinated locomotion in C. elegans at 22°C = 0.7-1 vol%; 1 vol% isoflurane at 22°C = 0.58 mM)3,4,5. Syntaxin is one of three essential presynaptic SNARE proteins that acts in concert with other proteins to mediate fusion of synaptic vesicles with the presynaptic membrane 6. The unusual mutation, designated unc-64(md130), produces a truncated syntaxin that dominantly antagonizes VA sensitivity along with expressing a reduced levels of wild-type syntaxin, resulting in other phenotypes consistent with decreased excitatory transmitter release. Importantly, other unc-64 alleles with similarly decreased transmitter release phenotypes were hypersensitive to VAs; for example, unc-64(md130) has a 20-30-fold higher isoflurane EC50 than the otherwise phenotypically similar VA hypersensitive unc-64(md1259) and unc-64(js21) mutants 5. Thus, the truncated syntaxin is not indirectly antagonizing VA sensitivity by reducing transmitter release; rather, the data are most consistent with interaction of the truncated syntaxin with another protein essential for VA sensitivity.

To identify the relevant syntaxin-interacting protein(s) essential for VA sensitivity, we tested C. elegans mutants isolated in a screen for suppressors of syntaxin reduction-of-function phenotypes 7,8. The logic of testing these mutants is that one or more of the suppressor mutations might lie in the putative syntaxin-interacting VA target and might be VA resistant. Indeed, we previously reported that some of these suppressors were VA resistant; however, the level of resistance was not as great as that in unc-64(md130) and was most likely due to an indirect effect on elevation of transmitter release 7. Here we report on an additional syntaxin suppressor mutant whose level of resistance is similar to that of md130 and define in part the mechanism whereby it regulates VA sensitivity in C. elegans.

Materials and Methods

C. elegans strains and transformants

C. elegans mutant strains were obtained from the Caenorhabditis Genetics Center, which is funded by the National Institutes of Health-National Center for Research Resources (Bethesda, MD). Strains were grown as described previously on nematode growth media agar 9. N2 var Bristol was the wild-type strain and the genetic background for all mutants. Mutant strains used for this work are as follows: LGI: unc-13(e376), unc-13(e376); acy-1(js127)III, unc-13(s69); acy-1(js127)III, unc-13(s69), gsa-1(ce81) LGIII: unc-64(e246), acy-1(js127), acy-1(js127)/+, acy-1(js127) unc-64(e246), acy-1(js127)/+ unc-64(e246), acy-1(nu329), acy-1(js127); snb-1(md247)V, acy-1(js127); unc-10(md1117)X, crh-1(n3315), acy-1(js127) crh-1(n3315), unc-64(e246); jsEx558 [acy-1(P260S) Prol-6::GFP], unc-64(e246); jsEx570[acy-1(+) Prol-6::GFP], unc-64(e246); jsEx571[acy-1(+) Prol-6::GFP], unc-64(e246);jsEx575[acy-1(L2444S) Prol-6::GFP], unc-64(e246); jsEx579 [Psnb-1::acy-1(P260S) Prol-6::GFP], unc-64(e246); jsEx580 [Pmyo-3::acy-1(P260S) Prol-6::GFP] LGV: snb-1(md247) LGX: unc-10(md1117), kin-2(ce179). Extrachromosomal only: jsEx558 [acy-1(P260S) Prol-6::GFP], jsEx570[acy-1(+) Prol-6::GFP], jsEx571[acy-1(+) Prol-6::GFP], jsEx575[acy-1(L2444S) Prol-6::GFP], jsEx579 [Psnb-1::acy-1(P260S) Prol-6::GFP], jsEx580 [Pmyo-3::acy-1(P260S) Prol-6::GFP], jsEx676[gsa-1(+) Prol-6::GFP]. js127 double mutants with snb-1(md247), unc-10(md1117), unc-13(e376), and unc-13(s69) were constructed using rbf-1(js232) marked Unc strains. rbf-1 is located at the center of chromosome III and was used to mark the non-js127 chromosome III. js127; him-8 males were mated into rbf-1; Unc hermaphrodites, and hyperactive (js127 homozygous) progeny selected from the broods of heterozygous animals. The next generation was examined for nonhyperactive progeny (js127; Unc). Homozygosity of md247 and md1117 was verified molecularly while js127 was deduced by the absence of js232 scored molecularly.

Germline transformation was accomplished by coinjecting the plasmid of interest, pBluescript carrier DNA (200 μg/ml), and the dominant transformation marker prol-6::GFP (pPHGFP1 at 20-35 μg/ml) 10. Transformants were selected by scoring GFP expression on an epifluorescence dissecting microscope, and stably transformed lines were isolated. jsEx570 and jsEx571 were obtained from injecting pPR1522 into unc-64(e246) at 15 μg/ml. pAC2 (10μg/ml) injection into unc-64(e246) yielded jsEx558 and pAC3 (15μg/ml) injection into unc-64(e246) produced jsEx575. pAC2 and pAC3 were also independently introduced into the balanced null allele acy-1(pk1279)/dpy-17(e164) in order to determine if these altered forms were capable of rescuing null mutant lethality. pAC5 and pAC6 were each transformed into unc-64(e246) and the lines jsEx579 and jsEx580 isolated, respectively. Once stable lines were established, individual arrays were outcrossed to remove the unc-64(e246) mutation. jsEx676 was created by the coinjection of pPD118.33 and pRP1505.

Plasmid constructs

pRP1522, a 14 kb genomic clone containing the acy-1 locus 11, was obtained from Celine Moorman, Ph.D. (Hubrecht Laboratory, Centre for Biomedical Genetics, Utrecht, The Netherlands) and Ronald Plasterk, Ph.D. (Professor, Hubrecht Laboratory, Centre for Biomedical Genetics, Utrecht, The Netherlands). The single base pair acy-1(js127) lesion was introduced into this clone using the DpnI-mediated site-directed mutagenesis protocol 12 to create a genomic clone (pAC2) encoding the P260S mutant form of ACY-1. Specifically, pRP1522 was mutagenized using OL#897 (ATTCAGTCTGTGATGTCT-AAAAAGGTACGCA) and OL#898 (TGCGTACCTTTTTAGACATCACAGACTGAAT). Similarly, pRP1522 was mutagenized using OL#955 (TTGGCAAGAAAGGATTCTGAGTTGGAGACACAG) and OL#956 (CTGTGTCTC-CAACTCAGAATCCTTTCTTGCCAA) to create pAC3, an acy-1 genomic clone harboring an L244S lesion modeled after the constitutively active adenylate cyclase mutation isolated in Dictyostelium 13. Both constructs were sequenced to verify proper introduction of the desired lesion. Using this same mutagenesis method, a BamHI restriction site was engineered prior to the acy-1 initiation site by mutagenizing pAC2 using OL#1026 (TCTT-GTCTTCTGGATCCATGGACGACGATGT) and OL#1027 (ACATCGTCGTCCATGGATCCAGAAGACAAGA) to produce pAC4. The acy-1 promoter was then replaced with the snb-1 synaptobrevin promoter to yield a construct, pAC5, for selective expression of the P260S form in neurons. This was accomplished by swapping the SacII/BamHI fragment of pAC4 with the SacII/BamHI fragment of the polymerase chain reaction (PCR) product resulting from OL#1028 (GTTAGTATCATTC-GAAACATACC) and OL#1029 (AGCTTTCCGCGGAAATC-TAGG) amplification of the snb-1 promoter from pRM248. pAC6 was created in the same manner with OL#1028 and OL#1030 (GCTGCGGCCGCGGGTCGGC) used to amplify the myo-3 promoter from pPD96.52 to study muscle selective expression. pPD118.33 is a Pmyo-2::GFP and pRP1505 is a wild-type gsa-1 construct and was obtained from Ronald Plasterk 14.

unc-64(e246) suppressor screen

A non-clonal genetic screen was performed using conventional mutagenesis 15. unc-64(e246) L4-staged hermaphrodites were mutagenized for four hours in 50mM ethylmethane sulfonate. In order to recover recessive mutants, second generation self progeny were examined for mobile animals. From a given plate of approximately 50 to 150 F1 progeny, at most one F2 candidate suppressor was selected and clonally passaged. Suppression was verified in the next generation and subsequent backcrossing was initiated. This was generally performed by mating with wild-type males; F1 double heterozygous males were then crossed into unc-64(e246) and several Unc progeny hermaphrodites clonally passaged. The next generation was screened for moving animals to reticulate the unc-64 Sup double mutants. After at least two rounds of backcrossing, suppressors were outcrossed from unc-64(e246) in order to obtain the single mutant suppressor. Presence of the suppressor was verified in the strain by reintroducing the unc-64(e246) allele and showing retention of suppression of paralysis. In seven rounds of screening a total of 24,000 haploid genomes, fourteen suppressors were recovered. Other suppressors isolated in the screen have been described elsewhere 7,8.

Genetic mapping of suppressors and molecular identification of lesions

All mapping and complementation tests were performed using standard genetic methods 16. Suppressors were initially grouped based on their behavioral phenotype and then subsequently placed into complementation groups by complementation assays. js127 was a single allele isolate and was placed on chromosome III based on linkage to lon-1. Specifically, js127 e246 males were mated into lon-1 e246 hermaphrodites resulting in js127 e246/ lon-1 e246 non-Lon cross progeny. These cross progeny were e246 homozygous, but were phenotypically non-Unc because of single copy js127; i.e., js127 acted dominantly to suppress the e246 Unc phenotype. From this trans heterozygote, 7 of 31 Lon progeny were also phenotypically non-Unc through acquisition of a single copy of js127 by recombination. This localization was refined using three-factor mapping with lon-1 and dpy-18. lon-1 dpy-18 unc-64 was placed over js127 e246 and all 18 Lon non-Dpy recombinants failed to segregate js127, placing js127 close by or to the left of lon-1. Fine structure mapping was performed using the single nucleotide polymorphisms of the Hawaiian strain, CB4856 17. Single nucleotide polymorphisms that altered restriction enzyme recognition sites were chosen for analysis because they could be scored simply by PCR amplification of that genomic region and subsequent restriction enzyme digestion. First, a dpy-1 daf-2 js127 lon-1 unc-64 strain was constructed by placing dpy-1(e1) daf-2(e1370ts) in trans to js127 lon-1 unc-64. 122 Sup Lon Unc progeny were clonally passaged and 9 plates contained Dpy Daf progeny. Dpy Daf animals were then raised at the permissive temperature, 20°C for daf-2, to assess locomotion in order to verify the presence of js127. Then, CB4856 males were mated into this strain, and the resulting cross-progeny males were mated back into dpy-1 daf-2 js127 lon-1 unc-64 hermaphrodites, in order to obtain at most one recombinant chromosome per progeny. Progeny of this cross were screened for Lon non-Daf animals, which would only result from a single recombination event between daf-2 and lon-1. 239 recombinants were isolated and then each recombinant chromosome was homozygosed and scored for js127 by its Sup phenotype. The location of each recombination event was determined by scoring the genotype of each single nucleotide polymorphisms. PCR primers and location of single nucleotide polymorphisms are available upon request. Examination of the Sup Lon Unc class of recombinants placed js127 to the right of cosmid F10F2, while information from the Lon Unc class of recombinants positioned js127 to the left of cosmid C35D10. This region of approximately 273 Kb contained an estimated 82 genes, one of which was an adenylate cyclase gene, acy-1. Sequencing of the acy-1 open reading frame from js127 revealed a C->T single nucleotide change resulting in a P260S lesion in the protein. A PCR/digestion assay was developed to score the presence of this lesion molecularly. PCR amplification of a 210bp product using OL#872 (TCTTGAAGAGG-CCGGATACATT) and OL#896 (AAAATGCATGCGTAGCCTTTTAG), followed by digestion with BglI resulted in a restriction pattern of 192bp and 18bp from wild type and a 210bp undigested fragment from js127.

Behavioral and drug assays

Locomotion assays were performed at room temperature (20-22°C) on at least 20 young adult hermaphrodites by collecting serial CCD camera images with an LG3 frame grabber (Scion Corporation, Frederick, MD) every 2.5 to 5 s at a magnification between 0.5X and 0.8X. Plates were undisturbed on the microscope for five to ten minutes before initiating imaging. A series of images of basal locomotion was collected prior to dropping a metal rod from a constant height onto the plates to serve as a mechanical stimulus to excite the animals 18. A similar series of images was collected after this mechanical stimulus. Locomotory velocity was calculated between successive images by measuring the linear displacement in the position of the tail of each animal. Velocities over four consecutive images were calculated and averaged to assess both basal and stimulated locomotion. Assays were performed in triplicate.

Acute sensitivity to the acetylcholinesterase inhibitor aldicarb was assayed by transferring 20-25 animals to plates containing aldicarb and monitoring the time course of animal paralysis 19. Animals were counted as paralyzed if they appeared hypercontracted and failed to move even if prodded with a platinum wire. Aldicarb, 2-methyl-2-[methylthio]proprionaldehyde O-[methylcarbamoyl]oxime, was obtained from Chem Services, Inc. (West Chester, PA) and was prepared as a 100 mM stock solution in 70% ethanol. Aldicarb was added to the nutrient growth medium agar after autoclaving.

Isoflurane dispersal assays were performed at 22-24°C using young adult hermaphrodites as described previously 20. Worms were transferred in S-basal buffer to 9.5 cm agar dispersal plates seeded at their edge with E.coli bacteria. Dispersal plates were then placed in various atmospheric concentrations of isoflurane (measured subsequently by gas chromatography) and the animals allowed to disperse. The fraction of adults (approximately 50/assay plate) present in the bacterial ring divided by the total number of adults after 40 min was scored as the dispersal index.

Cyclic adenosine monophosphate (cAMP) and competitive binding assay

Endogenous cAMP levels were measured from young adult animals using a competitive binding ELISA assay (Amersham Biosciences, Piscataway, NJ)21. Wild type, acy-1(nu329), and acy-1(js127) animals were grown on the adenylate cyclase deficient E.coli strain DHP1 F-glnV44(AS) recA1 endA1 gyrA96(NalR) thi1 hsdR17 spoT1 rfbD1 cyaA 22. Synchronized cultures of adults were obtained using standard methods. Approximately 200 l of packed adults were resuspended in 1 ml of lysis buffer and sonicated with three 20-s pulses using a microtip. Protein concentrations were measured using a Bradford assay (Biorad, Hercules, CA). Assays were performed in triplicate.

Statistical Analysis

Concentration/response curves were fit by nonlinear regression using the equation: y=min+(max-min)/(1+([Iso]/EC50)-k). The minimum was constrained to 0. The EC50’s were used as the measure of the isoflurane sensitivity of the strains. EC50s were compared for statistical differences by simultaneous curve fitting as described by Waud 23 using GraphPad Prism 5 Software (GraphPad, Software, Inc., San Diego, CA). The error values following the EC50 values are the error of the fit. Error values for cAMP levels were SD of triplicate assays. Error values for aldicarb assays were SEM of triplicate assays. Locomotion rates and cAMP levels were compared by two-sided t-test. The time at which half of the animals were paralyzed in the aldicarb paralysis assays was compared for statistical differences by simultaneous curve fitting using GraphPad Prism 5 Software. Statistical significant differences were at the p < 0.05 level. For multiple comparisons, the significance threshold was < 0.05/# of comparisons.

Results

The js127 mutation was isolated in a screen for mutations that improve the locomotion of the unc-64 syntaxin reduction-of-function allele, e246. js127 strongly suppressed the slow uncoordinated locomotion of unc-64(e246) (fig. 1A, B). Indeed, after stimulation, the js127 e246 double mutant strain moved at speeds indistinguishable from wild-type animals and was the strongest suppressor mutant isolated in the screen (fig. 1B). To test whether this suppression of locomotion was associated with an increase in acetylcholine release, aldicarb sensitivities were measured. Aldicarb is an acetylcholinesterase inhibitor that is widely used to measure the levels of cholinergic transmission in C. elegans mutants with the caveat that aldicarb sensitivity is an indirect measure of transmitter release and only assays acetylcholine release 19. Mutants with a decrease in acetylcholine release are more resistant to paralysis by aldicarb, and this can be conveniently measured by kinetic assays. js127 e246 was significantly less resistant to aldicarb than unc-64(e246) (fig. 1C), consistent with an enhancement of syntaxin’s function to mediate synaptic vesicle fusion and transmitter release. The js127 mutation was outcrossed from unc-64(e246) and its isoflurane sensitivity was measured. js127 was strongly resistant to isoflurane with an EC50 over 3-fold that of the wild-type strain and fully resistant to concentrations of isoflurane in the clinical range (fig. 1D).

Fig. 1. Movement, transmitter release, and anesthetic phenotypes of the js127 mutant.

Fig. 1

Open in a new tab

(A) js127 increases locomotion of unc-64(e246) mutants. Plates of the given genotype were mechanically tapped to stimulate locomotion, and serial images were taken at various time points poststimulation and pseudocolored: red 0, green 30, and blue 60 s. Stationary animals that appear in the same location in all three serial images appear white. Scale bar = 1mm. (B) Measurements of locomotion speeds of unc-64(e246), js127 e246 and N2 wild-type animals. Speeds (mean ± SE) before (basal) and after stimulation were calculated from serial images collected every 2.5 to 5 s from at least 20 animals moving on seeded agar plates. (* - P < 0.0001 vs. unc-64(e246) (C) js127 increases sensitivity of unc-64(e246) to aldicarb. Time course of paralysis of wild type, unc-64(e246) and js127 e246 on 1mM aldicarb is shown. The increased rate of paralysis of js127 e246 by aldicarb is significantly different than e246 alone (p < 0.0001). (D) Isoflurane resistance of js127. The dispersal index or fraction of adult worms that moves from the center of a 9.5cm agar plate to the E. coli seeded edge after a 40-min assay was measured while being exposed to various concentrations of isoflurane. The EC50 for wild type is 1.05 +/− 0.07 and 3.17 +/− 0.20 for js127. js127 is significantly resistant to isoflurane compared to N2 (p < 0.0001).

To identify the genetic lesion responsible for the phenotypes in js127, the suppression of the sluggish locomotion phenotype of e246 was genetically mapped. The suppression phenotype mapped to a 273 Kb interval on the left arm of chromosome III (fig. 2A). The C. elegans genome sequence predicts 82 genes in this interval, one of which is acy-1, which encodes an adenylate cyclase previously shown to regulate neurotransmitter release in C. elegans and by its closest homologs in mammals 24-26. The acy-1 gene was sequenced in the js127 mutant and a C > T transition mutation was found in codon 260 resulting in proline to serine missense lesion (fig. 2B). Proline 260 lies within a highly conserved region at the N-terminal end of the C1a domain, one of the cytoplasmic catalytic domains. To confirm that the P260S mutation was indeed responsible for the js127 phenotypes, an acy-1 genomic plasmid was constructed with the P260S mutation and transgenic animals expressing the plasmid were generated. The P260S transgene strongly suppressed the locomotion defects of unc-64(e246) to levels similar to those of the js127 e246 (fig. 2C). Likewise the transgene in the absence of unc-64(e246) conferred high level isoflurane resistance, actually greater than that in js127 (p < 0.007 vs. acy-1(js127)) (fig. 2D). Based on the mapping, identification of a lesion, and phenocopy by transformation, we conclude that the C>T transition resulting in a P260S change in acy-1 is the js127 mutation. Confirming our assignment of js127 to acy-1, this identical ACY-1(P260S) lesion was independently isolated in another lab in a similar screen for suppressors of a different mutation that reduces neurotransmitter release in C. elegans 25. This suggests that relatively few mutations in acy-1 result in this phenotype.

Fig. 2. js127 is an allele of acy-1.

Fig. 2

Open in a new tab

(A) js127 mapping data. js127 was mapped onto chromosome III between daf-2 and lon-1. 239 recombinants between daf-2 and lon-1 were isolated after crossing into the highly sequence polymorphic CB4856 strain. The location and number of CB4856/N2 recombinants in each class that lie between consecutive pairs of single nucleotide polymorphisms are shown. The gray region indicates the smallest js127 mapped interval. (B) Alignment of the region around the js127 mutation. The region surrounding the js127 lesion was BLASTed against other organism listed and the highest hit was reciprocally BLASTed against ACY-1 to confirm best homology. Aden cycl stands for Adenylate Cyclase. (C) Transformation phenocopy of js127 suppression. Transformation by an acy-1 clone containing the P260S lesion into the e246 mutant phenocopies js127 suppression of the e246 movement defect. (D) jsEx558[acy-1(P260S)] transformant phenocopies the js127 mutant for isoflurane resistance. The EC50 for jsEx558 is 4.10 +/− 0.28 and 1.08 +/− 0.13 for wild type. jsEx558 is significantly resistant to isoflurane compared to N2 (p < 0.0001).

The ability to reproduce the phenotypes of js127 by transformation suggests that the mutation confers a gain-of-function to ACY-1. Consistent with this hypothesis, js127 heterozygotes significantly suppress the sluggish locomotion of unc-64(e246) (fig. 3A). js127 also dominantly confers an aldicarb hypersensitivity phenotype whereas the reduction-of-function allele acy-1(nu329) 27 is aldicarb resistant (fig. 3B). Likewise for isoflurane sensitivity, the acy-1(nu329) allele has an isoflurane hypersensitive phenotype, opposite that of acy-1(js127) (fig. 3C, D). However, unlike transgenic expression of ACY-1(P260S), transgenes expressing additional wild-type ACY-1 or ACY-1 with a mutation previously shown to confer constitutive activity on Dictyostelium adenylate cyclase 13 were not isoflurane resistant nor did these transgenes suppress slow locomotion of unc-64(e246) phenotypes (fig. 3D, E). Thus, P260S appears to be a particularly strong gain-of-function mutation. To test directly the hypothesis that js127 was a gain-of-function mutation, we compared whole animal cAMP levels in acy-1(js127), acy-1(nu329), and wild-type animals. Consistent with the genetic data, cAMP levels were significantly higher in js127 than in wild-type animals and significantly lower in nu329 (fig. 3F). Thus, we conclude that js127 confers an increase in ACY-1 adenylate cyclase activity.

Fig. 3. js127 is a gain of function acy-1 allele.

Fig. 3

Open in a new tab

(A) js127 dominantly suppresses the locomotion defect of e246. js127/+ indicates a heterozygous genotype (* p < 0.01 vs. corresponding e246 value). (B) js127 dominantly increases aldicarb sensitivity. js127/+ is significantly hypersensitive to 0.35 mM aldicarb compared to wild type (p < 0.05) (C) acy-1(nu329 rf) is a reduction of function allele of acy-127 and is hypersensitive to isoflurane. The EC50 for wild type is 1.05 +/− 0.7 compared to 0.58 +/− 0.08 for nu329 (p < 0.002). (D) acy-1(+) and L244S transformants do not confer isoflurane resistance. jsEx570[acy-1(+)]and jsEx571[acy-1(+)], wild-type worms transformed with the acy-1(+) and jsEx575[acy-1(L244S)] had wild-type sensitivities to isoflurane (* p < 0.01 vs. wild type). (E) acy-1(+) and L244S transformants do not suppress the sluggish locomotion of unc-64(e246) (* p < 0.01 vs. unc-64(e246). (F) Cyclic adenosine monophosphate (cAMP) levels elevated in js127. Endogenous cAMP levels in wild type, js127, and nu329 adult animals normalized to total protein (* p < 0.05 vs. wild type).

ACY-1 is expressed throughout the C. elegans nervous system and in body wall muscles14,27. Thus, it is possible that enhanced ACY-1 activity in muscle cells rather than neurons is responsible for the js127 phenotypes. To test this hypothesis, acy-1(P260S) was expressed selectivity in neurons or muscle using cell type specific promoters. acy-1(P260S) driven by the pan-neuronal promoter Psnb-1 strongly suppressed the slow locomotion of unc-64(e246) whereas expression in muscle with the Pmyo-3 promoter produced no discernible suppression (fig. 4A). Similarly, pan-neuronal acy-1(P260S) produced high level resistance to isoflurane while the isoflurane sensitivity of the muscle acy-1(P260S) was similar to wild type. (fig. 4B, C). We conclude that ACY-1 adenylate cyclase acts in neurons to suppress the syntaxin mutant phenotype and regulate isoflurane sensitivity.

Fig. 4. js127 functions in neurons.

Fig. 4

Open in a new tab

(A) Locomotion speeds of unc-64(e246) transformed with various acy-1 constructs. The locomotion defect of e246 is significantly suppressed by the js127 allele, jsEx558[acy-1(P260S)], and jsEx579[Psnb-1::acy-1(P260S)] which is expressed only in neurons (* p < 0.01 vs. e246). jsEx580[Pmyo-3::acy-1(P260S)], expressing only in muscle, does not suppress the e246 movement defect. (B) jsEx579 is significantly resistant to isoflurane compared to wild type. (C) Bar graph summary of B. (* p < 0.0001 vs. wild type)

To define the pathway whereby ACY-1 regulates transmitter release and isoflurane sensitivity, we tested the phenotypes of mutations in genes that might lie in the pathway. Adenylate cyclase is normally stimulated by G s. C. elegans has one G s gene, gsa-1, which has been shown previously to promote cholinergic transmitter release and neurodegeneration 14,24,25,27,28. We found that similar to acy-1(js127) an activating mutation, ce81,24 in gsa-1 was strongly resistant to isoflurane (fig. 5A). Likewise, animals transformed with additional copies of wild-type gsa-1 were also isoflurane resistant (fig. 5A). Protein kinase A (PKA) is a classical downstream target of adenylate cyclases and has previously been implicated in ACY-1 signaling 25,29. We tested a loss-of-function allele of kin-2, which encodes a negative regulatory subunit of PKA. Consistent with ACY-1 signaling through PKA to regulate isoflurane sensitivity, the kin-2 loss-of-function mutant was strongly isoflurane resistant (fig. 5A). cAMP response element binding protein (CREB) is a transcription factor that can be activated by PKA phosphorylation and regulates the expression of numerous genes 30. CREB is most clearly implicated in synaptic plasticity and neural development but has also been show to promote the expression of presynaptic syntaxin 31. Thus, we considered the hypothesis that ACY-1 might promote synaptic transmission and reduce isoflurane sensitivity by activating CREB. However, a null mutation in the only C. elegans homolog of CREB 32, crh-1, had normal sensitivity to isoflurane and did not suppress the isoflurane resistance of js127 in the acy-1(js127) crh-1(null) double mutant (fig. 5A). The crh-1(null) mutant was resistant to aldicarb consistent with the hypothesis that crh-1 does indeed promote cholinergic neurotransmission (fig 5B); however, as for isoflurane resistance the crh-1(null) mutant did not suppress the aldicarb hypersensitivity phenotype of acy-1(js127). A notable caveat to attributing the aldicarb resistance phenotype to the crh-1(null) mutant is that only one mutant was tested and the phenotype was not rescued by transformation. Thus, the aldicarb resistance could be due to an unknown background mutation. However, the data does definitively show that C. elegans CREB does not act downstream of ACY-1 to control neurotransmission and isoflurane sensitivity.

Fig. 5. Phenotypes of potential acy-1 signaling pathway mutants.

Fig. 5

Open in a new tab

(A) Isoflurane EC50 values for various genes hypothesized to lie in the acy-1 signaling pathway (* p < 0.01 vs. wild type). (B) js127 increases sensitivity of crh-1(n3315) to 0.35mM aldicarb (p < 0.01). (C) Aldicarb resistance (0.35mM) of unc-10(md1117) is not significantly suppressed by js127. (D) Aldicarb resistance (0.35mM) of snb-1(md247) is not significantly suppressed by js127. (E) Aldicarb resistance (0.35mM) of unc-13(e376) is not significantly suppressed by js127. (F) js127 mutation enhances the locomotion of several lethargic mutants but not unc-13(s69) (* p < 0.01 vs. lethargic single mutant).

Finally, we tested for suppression of js127 phenotypes by reduction of function mutations in three transmitter release machinery proteins, UNC-10 – rab-3-interacting molecule (RIM), SNB-1 - synaptobrevin, and UNC-13 – mUNC13. For isoflurane resistance and aldicarb sensitivity, the mutations in all three genes strongly suppressed js127 (fig. 5A, C, D, E). Thus, js127 adenylate cyclase activation does not bypass the core vesicular fusion machinery to produce VA resistance or enhance transmitter release. However, for locomotion rate, only the locomotion of a strong unc-13 allele (s69) was not improved by js127 (fig. 5F). unc-13(e376), a weaker allele, still moved significantly better in the background of js127 (fig. 5F). Similarly, the locomotion rates of both snb-1 partial loss of function and unc-10 null mutants were improved significantly in a js127 mutant background. Thus, UNC-10 and perhaps SNB-1 (the epistatic relationship of SNB-1 to ACY-1 is not definitive given the snb-1 allele is not null) are not required for the locomotion promoting activity of ACY-1. By contrast, UNC-13, at least at the level of sensitivity of these assays, is epistatic to acy-1(js127).

Discussion

Through screening of mutations that suppress the phenotypes of a syntaxin reduction of function mutant, we have identified a gain-of-function mutation of C. elegans ACY-1 adenylate cyclase that strongly antagonizes isoflurane sensitivity. Our data are consistent with an ACY-1 signaling pathway as shown in Figure 6. With regards to anesthetic mechanisms, the most central question posed by this study is whether ACY-1 is an anesthetic target and the js127 mutation directly blocks volatile anesthetic inhibition of ACY-1. This hypothesis seems unlikely in light of our previous findings. While not as VA resistant as acy-1(js127), other mutants that suppress unc-64(e246) are also VA resistant 7. In general, we have found that environmental conditions or mutations like acy-1(js127) that enhance neurotransmitter release confer VA resistance 7,20,33. Likewise, mutants with reduced neurotransmission have been found to be hypersensitive to VAs 5,20,33. Thus, the anesthetic phenotype of acy-1(js127) is most easily explained as due to indirect enhancement of the process that VAs block.

Fig. 6. Working model for ACY-1 signaling pathway regulating transmitter release and volatile anesthetic sensitivity.

Fig. 6

Open in a new tab

The model depicted is based on the genetic evidence and has not been confirmed by binding or electrophysiological data. Volatile anesthetics (VAs) are shown inhibiting UNC-13 as previously proposed 34. The direct target of the cyclic adenosine monophosphate (cAMP)-activated protein kinase A catalytic subunit KIN-1 is unknown but is unlikely to be UNC-13.

In C. elegans, only the truncated syntaxin and unc-13 mutants have been found to deviate from the correlation between the levels of neurotransmitter release and VA resistance 5,34. The truncated syntaxin acts in a dominant fashion to block VA effects on transmitter release without otherwise detectably altering behavior or neurotransmission 5,34. The VA resistance of the syntaxin mutant can be suppressed by overexpression of wild-type UNC-13, consistent with a model where the truncated syntaxin in a dose-dependent mechanism blocks VA inhibition of UNC-13 activity. The unc-13 mutants, despite having reduced transmitter release, were also VA resistant, and a strain with a membrane-targeted UNC-13 was VA resistant, suggesting the model that VAs block membrane association of UNC-13 34. Thus, we have previously proposed that UNC-13 is a presynaptic target for clinical concentration of VAs in C. elegans 34.

Might UNC-13 be a direct target of PKA and thereby offer a testable hypothesis for the unusually strong VA resistance of acy-1(js127)? Indeed among the release machinery mutants tested, only the strong unc-13 allele, s69, was found to be incompetent for js127 suppression of its uncoordinated locomotion. However, little spontaneous or evoked exocytosis is detected from cholinergic unc-13(s69) motor neurons by electrophysiological assays 35-37. Thus, while the formal interpretation of our genetic epistasis experiments is that UNC-13 lies downstream of ACY-1, this result may derive from the fact that unc-13(s69) has essentially no transmitter release for ACY-1 to enhance rather than UNC-13 being the direct target of the GSA-1 – ACY-1 – PKA pathway. Additionally, UNC-13/mUNC13 has not been reported to be a PKA target. It is more likely that PKA phosphorylates some intermediate target whose activity requires UNC-13. UNC-13 is a diacyl glycerol-binding presynaptic protein that interacts with syntaxin, RIM, calmodulin, and other presynaptic proteins to promote neurotransmitter release 38. A reasonable candidate PKA target is UNC-10 RIM. In mammals, PKA has been shown to phosphorylate RIM, and this phosphorylation is necessary for PKA-dependent presynaptic long term potentiation in mouse cerebellar neurons 39-41. RIM interaction with mUNC13 is necessary for normal synaptic vesicle priming in mouse hippocampal neurons 42, and RIM binding to mUNC13 has been shown to reduce the levels of mUNC13 homodimers, which are autoinhibitory 43. Besides disinhibition of mUNC13, RIM has recently been shown to promote presynaptic localization of P- and Q-type calcium channels near the active zone and interacts with other presynaptic proteins including Rab3 and may serve a scaffolding function 39,44,45. However, in C. elegans, if UNC-10 RIM is the ACY-1/PKA target, it is not an essential target since acy-1(js127) is capable of significantly improving the locomotion of an unc-10 null mutant. Likewise for the VA presynaptic mechanism, UNC-10 is non-essential as unc-10 null mutants are normally sensitive to isoflurane 34.

An alternative or additional ACY-1/PKA mechanism consistent with UNC-13 as the VA target is regulation of proteasome-dependent degradation of UNC-13. In Drosophila neurons, synaptic DUNC-13 (Drosophila UNC-13) levels were found to be positively regulated by cAMP and PKA 46. Inhibition of cAMP/PKA signaling resulted in a rapid and substantial decrease in DUNC-13 levels at the synapse, and this decrease could be blocked with proteasome inhibitors. However, the mechanism whereby the cAMP/PKA pathway regulates the apparent proteasomal degradation of DUNC-13 is obscure.

Is the C. elegans presynaptic VA mechanism described here relevant to the mammalian anesthetic mechanism? As stated above, presynaptic inhibition of excitatory neurotransmitter release has been demonstrated in a variety of mammalian models 1. Thus, a contribution of presynaptic anesthetic effects to general anesthesia seems likely. The presynaptic machinery in C. elegans is highly conserved in humans 6,47, and the VA concentrations to which the mutants in the presynaptic machinery are conferring resistance are in the clinical range. Thus, the C. elegans presynaptic VA mechanism further elaborated here might reasonably contribute to general anesthesia in mammals. Experimental support for this conjecture has recently been reported. A truncated syntaxin based on the C. elegans VA resistant mutant was expressed in a rat neuroendocrine cell line and in hippocampus and found to antagonize the effects of clinical concentrations of isoflurane on neurosecretion and transmitter release 48. These results argue that at least some aspects of the C. elegans presynaptic mechanism are conserved in higher organisms.

An important issue to consider when discussing the potential relevance of the proposed C. elegans presynaptic anesthetic mechanism to mammalian anesthesia is how to reconcile the fundamental function of UNC-13 orthologs with the differential inhibition by volatile anesthetics of transmitter release from distinct neuronal. In other words, if UNC-13 orthologs function at all synapses and are important presynaptic anesthetic targets, how might volatile anesthetics more potently inhibit excitatory synapses compared to inhibitory ones as previously shown?1 The mammalian UNC-13 homologs, mUNC13-1, 2, and 3 have distinct functional roles that could contribute to the synapse selective effects of VAs. Release from the majority of glutamatergic terminals in mouse hippocampus requires the mUNC13-1 isoform whereas mUNC13-1 and mUNC13-2 function redundantly in GABAergic release at least in the cerebral cortex and hippocampus 49. In rat brain, mUNC13-1 is expressed throughout the central nervous system whereas mUNC-13-2 expression is restricted to the cerebral cortex and hippocampus. mUNC-13-3 appears to be expressed exclusively in the cerebellum 50. Intriguingly, mUNC13-1- and mUNC13-2-mediated release in mouse differs in their potentiation by diacyl glycerol; mUNC13-1 is less efficaciously potentiated 49. These observations suggest the hypothesis that mUNC13-1, the closest homolog to C. elegans UNC-13, may be more sensitive to VAs because its weak DAG potentiation is more efficaciously blocked by VAs compared to that of mUNC13-2. Testing of this hypothesis is experimentally feasible with the availability of mouse knockout strains for each of the mUNC13 isoforms.

Summary Statement.

A gain-of-function mutation in an adenylate cyclase gene was discovered in the nematode C. elegans that strongly reduces the potency of isoflurane. This mutation acts in neurons to regulate neurotransmitter release and isoflurane sensitivity.

MS #201105060 Final Box Summary Statement.

What we know about this topic:

Although volatile general anesthetics inhibit neurotransmitter release by a mechanism not fully understood, genetic evidence in C. elegans has shown that a major mechanism of action of volatile anesthetics acting at clinical concentrations in this animal is presynaptic inhibition of neurotransmission

What new information this study provides:

An additional component of the presynaptic volatile anesthetic mechanism was demonstrated by showing that activation of neuronal adenylate cyclase antagonizes isoflurane inhibition of locomotion in C. elegans

Acknowledgments

Funding Sources: MLN – National Institute of Neurological Disorders and Stroke, Bethesda, Maryland, CMC – National Institute of General Medical Sciences, Bethesda, Maryland.

Footnotes

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Hemmings HC., Jr Sodium channels and the synaptic mechanisms of inhaled anaesthetics. Br J Anaesth. 2009;103:61–9. doi: 10.1093/bja/aep144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wu XS, Sun JY, Evers AS, Crowder M, Wu LG. Isoflurane inhibits transmitter release and the presynaptic action potential. Anesthesiology. 2004;100:663–70. doi: 10.1097/00000542-200403000-00029. [DOI] [PubMed] [Google Scholar]
  • 3.Crowder CM, Shebester LD, Schedl T. Behavioral effects of volatile anesthetics in Caenorhabditis elegans. Anesthesiology. 1996;85:901–12. doi: 10.1097/00000542-199610000-00027. [DOI] [PubMed] [Google Scholar]
  • 4.Franks NP, Lieb WR. Selective actions of volatile general anaesthetics at molecular and cellular levels. Br J Anaesth. 1993;71:65–76. doi: 10.1093/bja/71.1.65. published erratum appears in Br J Anaesth 1993; 71:616. [DOI] [PubMed] [Google Scholar]
  • 5.van Swinderen B, Saifee O, Shebester L, Roberson R, Nonet ML, Crowder CM. A neomorphic syntaxin mutation blocks volatile-anesthetic action in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 1999;96:2479–84. doi: 10.1073/pnas.96.5.2479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sudhof TC. The synaptic vesicle cycle. Annu Rev Neurosci. 2004;27:509–47. doi: 10.1146/annurev.neuro.26.041002.131412. [DOI] [PubMed] [Google Scholar]
  • 7.Hawasli AH, Saifee O, Liu C, Nonet ML, Crowder CM. Resistance to volatile anesthetics by mutations enhancing excitatory neurotransmitter release in Caenorhabditis elegans. Genetics. 2004;168:831–43. doi: 10.1534/genetics.104.030502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wang ZW, Saifee O, Nonet ML, Salkoff L. SLO-1 potassium channels control quantal content of neurotransmitter release at the C. elegans neuromuscular junction. Neuron. 2001;32:867–81. doi: 10.1016/s0896-6273(01)00522-0. [DOI] [PubMed] [Google Scholar]
  • 9.Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77:71–94. doi: 10.1093/genetics/77.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mello CC, Kramer JM, Stinchcomb D, Ambros V. Efficient gene transfer in C.elegans: Extrachromosomal maintenance and integration of transforming sequences. EMBO J. 1991;10:3959–70. doi: 10.1002/j.1460-2075.1991.tb04966.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Korswagen HC, van der Linden AM, Plasterk RH. G protein hyperactivation of the Caenorhabditis elegans adenylyl cyclase SGS-1 induces neuronal degeneration. Embo J. 1998;17:5059–65. doi: 10.1093/emboj/17.17.5059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fisher CL, Pei GK. Modification of a PCR-based site-directed mutagenesis method. Biotechniques. 1997;23:570–1. doi: 10.2144/97234bm01. [DOI] [PubMed] [Google Scholar]
  • 13.Parent CA, Devreotes PN. Constitutively active adenylyl cyclase mutant requires neither G proteins nor cytosolic regulators. J Biol Chem. 1996;271:18333–6. doi: 10.1074/jbc.271.31.18333. [DOI] [PubMed] [Google Scholar]
  • 14.Korswagen HC, Park JH, Ohshima Y, Plasterk RH. An activating mutation in a Caenorhabditis elegans Gs protein induces neural degeneration. Genes Dev. 1997;11:1493–503. doi: 10.1101/gad.11.12.1493. [DOI] [PubMed] [Google Scholar]
  • 15.Anderson P. In: Mutagenesis, Caenorhabditis elegans: Modern biological analysis of an organism. Epstein H, Shakes D, editors. Academic Press; San Diego, CA: 1995. pp. 31–58. [Google Scholar]
  • 16.Herman RK, Horvitz HR. In: Genetic analysis of Caenorhabditis elegans, Nematodes as biological models. Zuckerman BM, editor. Academic Press, Inc.; New York: 1980. pp. 227–61. [Google Scholar]
  • 17.Wicks SR, Yeh RT, Gish WR, Waterston RH, Plasterk RH. Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map. Nat Genet. 2001;28:160–4. doi: 10.1038/88878. [DOI] [PubMed] [Google Scholar]
  • 18.Staunton J, Ganetzky B, Nonet ML. Rabphilin potentiates soluble N-ethylmaleimide sensitive factor attachment protein receptor function independently of rab3. J Neurosci. 2001;21:9255–64. doi: 10.1523/JNEUROSCI.21-23-09255.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mahoney TR, Luo S, Nonet ML. Analysis of synaptic transmission in Caenorhabditis elegans using an aldicarb-sensitivity assay. Nat. Protocols. 2006;1:1772–7. doi: 10.1038/nprot.2006.281. [DOI] [PubMed] [Google Scholar]
  • 20.Van Swinderen B, Metz LB, Shebester LD, Crowder CM. A Caenorhabditis elegans pheromone antagonizes volatile anesthetic action through a go-coupled pathway. Genetics. 2002;161:109–19. doi: 10.1093/genetics/161.1.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Horton JK, Martin RC, Kalinka S, Cushing A, Kitcher JP, O’Sullivan MJ, Baxendale PM. Enzyme immunoassays for the estimation of adenosine 3′,5′ cyclic monophosphate and guanosine 3′,5′ cyclic monophosphate in biological fluids. J Immunol Methods. 1992;155:31–40. doi: 10.1016/0022-1759(92)90268-x. [DOI] [PubMed] [Google Scholar]
  • 22.Hanahan D. Studies on transformation of Escherichia coli with plasmids. J Mol Biol. 1983;166:557–80. doi: 10.1016/s0022-2836(83)80284-8. [DOI] [PubMed] [Google Scholar]
  • 23.Waud DR. On biological assays involving quantal responses. J Pharmacol Exp Ther. 1972;183:577–607. [PubMed] [Google Scholar]
  • 24.Schade MA, Reynolds NK, Dollins CM, Miller KG. Mutations that rescue the paralysis of Caenorhabditis elegans ric-8 (synembryn) mutants activate the G alpha(s) pathway and define a third major branch of the synaptic signaling network. Genetics. 2005;169:631–49. doi: 10.1534/genetics.104.032334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Reynolds NK, Schade MA, Miller KG. Convergent, RIC-8-dependent Galpha signaling pathways in the Caenorhabditis elegans synaptic signaling network. Genetics. 2005;169:651–70. doi: 10.1534/genetics.104.031286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Seino S, Shibasaki T. PKA-dependent and PKA-independent pathways for cAMP-regulated exocytosis. Physiol Rev. 2005;85:1303–42. doi: 10.1152/physrev.00001.2005. [DOI] [PubMed] [Google Scholar]
  • 27.Berger AJ, Hart AC, Kaplan JM. G alphas-induced neurodegeneration in Caenorhabditis elegans. J Neurosci. 1998;18:2871–80. doi: 10.1523/JNEUROSCI.18-08-02871.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Jansen G, Thijssen KL, Werner P, van der Horst M, Hazendonk E, Plasterk RH. The complete family of genes encoding G proteins of Caenorhabditis elegans. Nat Genet. 1999;21:414–9. doi: 10.1038/7753. [DOI] [PubMed] [Google Scholar]
  • 29.Hanoune J, Defer N. Regulation and role of adenylyl cyclase isoforms. Annu Rev Pharmacol Toxicol. 2001;41:145–74. doi: 10.1146/annurev.pharmtox.41.1.145. [DOI] [PubMed] [Google Scholar]
  • 30.Benito E, Barco A. CREB’s control of intrinsic and synaptic plasticity: Implications for CREB-dependent memory models. Trends Neurosci. 2010;33:230–40. doi: 10.1016/j.tins.2010.02.001. [DOI] [PubMed] [Google Scholar]
  • 31.Sutton KG, McRory JE, Guthrie H, Murphy TH, Snutch TP. P/Q-type calcium channels mediate the activity-dependent feedback of syntaxin-1A. Nature. 1999;401:800–4. doi: 10.1038/44586. [DOI] [PubMed] [Google Scholar]
  • 32.Bates EA, Victor M, Jones AK, Shi Y, Hart AC. Differential contributions of Caenorhabditis elegans histone deacetylases to huntingtin polyglutamine toxicity. J Neurosci. 2006;26:2830–8. doi: 10.1523/JNEUROSCI.3344-05.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.van Swinderen B, Metz LB, Shebester LD, Mendel JE, Sternberg PW, Crowder CM. Goalpha regulates volatile anesthetic action in Caenorhabditis elegans. Genetics. 2001;158:643–55. doi: 10.1093/genetics/158.2.643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Metz LB, Dasgupta N, Liu C, Hunt SJ, Crowder CM. An evolutionarily conserved presynaptic protein is required for isoflurane sensitivity in Caenorhabditis elegans. Anesthesiology. 2007;107:971–82. doi: 10.1097/01.anes.0000291451.49034.b8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Richmond JE, Davis WS, Jorgensen EM. UNC-13 is required for synaptic vesicle fusion in C. elegans. Nat Neurosci. 1999;2:959–64. doi: 10.1038/14755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Richmond JE, Weimer RM, Jorgensen EM. An open form of syntaxin bypasses the requirement for UNC-13 in vesicle priming. Nature. 2001;412:338–41. doi: 10.1038/35085583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Madison JM, Nurrish S, Kaplan JM. UNC-13 Interaction with syntaxin is required for synaptic transmission. Curr Biol. 2005;15:2236–42. doi: 10.1016/j.cub.2005.10.049. [DOI] [PubMed] [Google Scholar]
  • 38.Rizo J, Rosenmund C. Synaptic vesicle fusion. Nat Struct Mol Biol. 2008;15:665–74. doi: 10.1038/nsmb.1450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wang Y, Okamoto M, Schmitz F, Hofmann K, Sudhof TC. Rim is a putative Rab3 effector in regulating synaptic-vesicle fusion. Nature. 1997;388:593–8. doi: 10.1038/41580. [DOI] [PubMed] [Google Scholar]
  • 40.Castillo PE, Schoch S, Schmitz F, Sudhof TC, Malenka RC. RIM1alpha is required for presynaptic long-term potentiation. Nature. 2002;415:327–30. doi: 10.1038/415327a. [DOI] [PubMed] [Google Scholar]
  • 41.Lonart G, Schoch S, Kaeser PS, Larkin CJ, Sudhof TC, Linden DJ. Phosphorylation of RIM1alpha by PKA triggers presynaptic long-term potentiation at cerebellar parallel fiber synapses. Cell. 2003;115:49–60. doi: 10.1016/s0092-8674(03)00727-x. [DOI] [PubMed] [Google Scholar]
  • 42.Betz A, Thakur P, Junge HJ, Ashery U, Rhee JS, Scheuss V, Rosenmund C, Rettig J, Brose N. Functional interaction of the active zone proteins Munc13-1 and RIM1 in synaptic vesicle priming. Neuron. 2001;30:183–96. doi: 10.1016/s0896-6273(01)00272-0. [DOI] [PubMed] [Google Scholar]
  • 43.Deng L, Kaeser PS, Xu W, Sudhof TC. RIM proteins activate vesicle priming by reversing autoinhibitory homodimerization of Munc13. Neuron. 2011;69:317–31. doi: 10.1016/j.neuron.2011.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Pernia-Andrade A, Jonas P. The multiple faces of RIM. Neuron. 2011;69:185–7. doi: 10.1016/j.neuron.2011.01.010. [DOI] [PubMed] [Google Scholar]
  • 45.Kaeser PS, Deng L, Wang Y, Dulubova I, Liu X, Rizo J, Sudhof TC. RIM proteins tether Ca2+ channels to presynaptic active zones via a direct PDZ-domain interaction. Cell. 2011;144:282–95. doi: 10.1016/j.cell.2010.12.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Aravamudan B, Broadie K. Synaptic Drosophila UNC-13 is regulated by antagonistic G-protein pathways via a proteasome-dependent degradation mechanism. J Neurobiol. 2003;54:417–38. doi: 10.1002/neu.10142. [DOI] [PubMed] [Google Scholar]
  • 47.Richmond J. Synaptic function. WormBook. 2005:1–14. doi: 10.1895/wormbook.1.69.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Herring BE, Xie Z, Marks J, Fox AP. Isoflurane inhibits the neurotransmitter release machinery. J Neurophysiol. 2009;102:1265–73. doi: 10.1152/jn.00252.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Rosenmund C, Sigler A, Augustin I, Reim K, Brose N, Rhee JS. Differential control of vesicle priming and short-term plasticity by Munc13 isoforms. Neuron. 2002;33:411–24. doi: 10.1016/s0896-6273(02)00568-8. [DOI] [PubMed] [Google Scholar]
  • 50.Augustin I, Betz A, Herrmann C, Jo T, Brose N. Differential expression of two novel Munc13 proteins in rat brain. Biochem J. 1999;337(Pt 3):363–71. [PMC free article] [PubMed] [Google Scholar]

RESOURCES