Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2012 Feb;56(2):787–804. doi: 10.1128/AAC.05363-11

Global Analysis of the Staphylococcus aureus Response to Mupirocin

Swantje Reiß a, Jan Pané-Farré a, Stephan Fuchs a, Patrice François b, Manuel Liebeke c,*, Jacques Schrenzel b, Ulrike Lindequist c, Michael Lalk c, Christiane Wolz d, Michael Hecker a, Susanne Engelmann a,✉
PMCID: PMC3264241  PMID: 22106209

Abstract

In the present study, we analyzed the response of S. aureus to mupirocin, the drug of choice for nasal decolonization. Mupirocin selectively inhibits the bacterial isoleucyl-tRNA synthetase (IleRS), leading to the accumulation of uncharged isoleucyl-tRNA and eventually the synthesis of (p)ppGpp. The alarmone (p)ppGpp induces the stringent response, an important global transcriptional and translational control mechanism that allows bacteria to adapt to nutritional deprivation. To identify proteins with an altered synthesis pattern in response to mupirocin treatment, we used the highly sensitive 2-dimensional gel electrophoresis technique in combination with mass spectrometry. The results were complemented by DNA microarray, Northern blot, and metabolome analyses. Whereas expression of genes involved in nucleotide biosynthesis, DNA metabolism, energy metabolism, and translation was significantly downregulated, expression of isoleucyl-tRNA synthetase, the branched-chain amino acid pathway, and genes with functions in oxidative-stress resistance (ahpC and katA) and putative roles in stress protection (the yvyD homologue SACOL0815 and SACOL1759 and SACOL2131) and transport processes was increased. A comparison of the regulated genes to known regulons suggests the involvement of the global regulators CodY and SigB in shaping the response of S. aureus to mupirocin. Of particular interest was the induced transcription of genes encoding virulence-associated regulators (i.e., arlRS, saeRS, sarA, sarR, sarS, and sigB), as well as genes directly involved in the virulence of S. aureus (i.e., fnbA, epiE, epiG, and seb).

INTRODUCTION

Staphylococcus aureus is both a colonizer and a human pathogen. Due to its ability to express an impressive arsenal of different virulence factors, S. aureus is able to cause a variety of diseases ranging from mild skin infections to more severe and life-threatening conditions, such as osteomyelitis, endocarditis, and sepsis. With the emergence of multiresistant strains, antimicrobial therapy of S. aureus infections has become an increasing challenge.

Mupirocin (pseudomonic acid A) was first isolated from Pseudomonas fluorescens NCIB 10586 and has since proven its value as a topical agent in the treatment of S. aureus-associated wound infections. Furthermore, recent studies have shown that nasal decolonization of S. aureus carriers significantly reduces the risk of S. aureus infections after surgery (16, 28). However, the emergence of resistance to mupirocin after common use has increasingly hampered its use as the topical agent of choice for the elimination of methicillin-resistant Staphylococcus aureus (MRSA) carriage (6, 37, 75, 100, 112, 119).

Although the chemical structure of mupirocin is significantly different from that of isoleucyl-adenylate (Ile-AMP) (23), it was demonstrated that it is a structural analogue of Ile-AMP and competes with Ile-AMP for overlapping binding sites of the eubacterial and archaeal isoleucyl-tRNA synthetases (IleRSs) (66, 67, 91, 120). As a consequence, addition of mupirocin blocks the charging of isoleucyl-tRNA with isoleucine, leading to depletion of the aminoacetylated isoleucyl-tRNA pool and hence accumulation of uncharged isoleucyl-tRNAs.

The increase in uncharged tRNAs in relation to charged tRNAs is a signal of amino acid starvation for the cell, which triggers the stringent response. The stringent response is a fundamental global adaptation program universally distributed in most eubacteria and even partially conserved in the plastids of higher plants (99, 110). The major function of this response is to adjust the cell's biosynthetic machinery to the availability of energy and required precursors (59, 60, 103). The molecular details of the stringent response have been extensively studied in the model Gram-negative organism Escherichia coli and will be only briefly summarized here. Uncharged tRNAs that enter the ribosomal A site lead to a block of the ribosome and consequently protein synthesis (66). The arrest of the ribosome is recognized by the ribosome-associated RelA protein, which catalyzes the formation of the alarmones GTP 3′-diphosphate (pppGpp) and GDP 3′-diphosphate (ppGpp) from ATP as the phosphate donor and GTP or GDP (20, 57). In a DksA-dependent reaction, ppGpp is able to bind the RNA polymerase (RNAP) in E. coli, thereby blocking rRNA and tRNA gene transcription (5, 25, 113). Moreover, cell division and initiation of DNA synthesis are inhibited.

Stringently controlled promoters are often characterized by a specific discriminator region in front of the transcriptional start site. Whereas positively regulated genes are generally preceded by a CG-rich discriminator, negatively controlled genes have discriminator regions rich in adenine and thymidine nucleotides (99, 109, 114). Altogether, this course of events enables significant conservation of energy under growth-limiting conditions. However, transcription of amino acid biosynthesis and transport operons, as well as catabolic operons that yield precursors for amino acid synthesis, is enhanced in order to restore conditions that allow survival and growth (21, 93). Finally, (p)ppGpp is degraded by the hydrolase activity of SpoT. SpoT is a bifunctional enzyme that, in addition to its hydrolase activity, also has a (p)ppGpp synthetase activity that is activated by a variety of stimuli, such as inhibition of fatty acid metabolism or carbon deprivation.

Nevertheless, there are several general differences between the stringent responses of Gram-positive and Gram-negative bacteria (118). In most Gram-positive bacteria, (p)ppGpp synthetase and hydrolase activities are combined in a single protein, a bifunctional Rel/SpoT homolog (Rsh). In addition, a DksA homolog is absent from the genomes of firmicutes, such as Bacillus subtilis and S. aureus. Recently, in firmicutes, further proteins with (p)ppGpp synthetase activity have been discovered (92). The most striking differences, however, are related to the effector molecule. While in E. coli ppGpp directly affects RNAP activity, in B. subtilis the drop in the intracellular GTP pool as the result of the alarmone synthesis represents the virtual effector molecule. Interestingly, in B. subtilis, rRNA gene transcription starts predominantly with a guanosine nucleotide and can thus be affected by the intracellular GTP pool (72). In addition, GTP acts as a corepressor of the global stationary-phase regulator CodY, which also adapts downstream gene expression to stringent conditions (108).

Interestingly, in a number of pathogenic bacteria, including S. aureus, Mycobacterium tuberculosis, Listeria monocytogenes, and Pseudomonas aeruginosa, a connection between virulence and the stringent response has been observed (for a review, see references 30, 49, and 68).

Here, we investigated the response of S. aureus COL grown in a chemically defined medium in the presence of subinhibitory mupirocin concentrations by a combination of transcriptome, proteome, and metabolome analyses. The hallmark was the rapid and strong downregulation of the translation machinery and genes required for replication, as it is characteristic of the stringent response. Furthermore, the data suggested that global regulators, such as CodY, SigB, and possibly chromosomally encoded toxin/antitoxin modules contribute to the observed changes in gene expression. Surprisingly, many intracellular key metabolites showed little variation following mupirocin stress. A comparison to previous studies done in S. aureus and B. subtilis highlighted several poorly characterized but highly conserved genes that likely play pivotal roles during the stringent response. This functional-genomics approach provides a basis for more detailed experiments aimed at the dissection of the molecular mechanisms that govern the response of S. aureus to mupirocin treatment and the adaptation to stringent conditions.

MATERIALS AND METHODS

Bacterial strain and growth conditions.

The S. aureus strain COL used in this study (104) was routinely grown aerobically in a defined synthetic medium (48) with vigorous agitation at 37°C. In order to determine the MIC of mupirocin, 5 ml of synthetic medium supplemented with increasing mupirocin (AppliChem, Darmstadt, Germany) concentrations was inoculated with 10 μl of exponentially growing S. aureus cells (optical density at 500 nm [OD500], 0.5) previously propagated in the same medium without antibiotics. The minimal mupirocin concentration that prevented turbidity of the medium after 14 h of culture was deemed the mupirocin MIC. Following this procedure, the mupirocin MIC for S. aureus COL was 0.01 μg/ml.

For mupirocin experiments, prewarmed medium was inoculated with cells from an exponentially growing overnight culture to an initial OD500 of 0.1 and monitored by measuring the OD until the culture reached an OD500 of 0.5. At that time, the culture was split, and one part was transferred to a prewarmed Erlenmeyer flask and treated with mupirocin while the remaining culture served as a control. The final mupirocin concentration used in all stress experiments was 0.03 μg/ml (3 times the mupirocin MIC), reducing the growth rate of S. aureus COL by 50%.

l-[35S]methionine labeling and preparation of pulse-labeled protein extracts.

In order to investigate changes in the pattern of proteins newly synthesized after the addition of mupirocin, the proteins were pulse-labeled with l-[35S]methionine as described previously (38). Briefly, at time points 10, 30, and 60 min after mupirocin treatment, 150 μCi of l-[35S]methionine was added to 10 ml of the respective cell culture. As a control, we pulse-labeled cells of an untreated culture at time point zero (exponential growth at an OD500 of 0.5, immediately before stress) and 60 min after the beginning of the stress experiment. The uptake and incorporation of radioactively labeled methionine in newly synthesized proteins always lasted exactly 5 min. Protein synthesis was blocked by the addition of 1 ml stop solution (0.1% [wt/vol] chloramphenicol, 10 mM unlabeled l-methionine, 0.1 M Tris-HCl [pH 7.5]). Cells were harvested on ice, centrifuged for 5 min (21,500 × g at 4°C), washed twice with ice-cold Tris-EDTA (TE) buffer (10 mM Tris-HCl [pH 7.7], 1 mM EDTA), and stored at −20°C. For the preparation of intracellular-protein extracts, cell pellets were resuspended in 400 μl of TE buffer containing lysostaphin (final concentration, 250 μg/ml), followed by incubation on ice for 10 min and disruption by sonication for 1 min (0.5 pulses per second; low), followed by a 1-min cooling break. This process was repeated three times. The cell lysate obtained was cleared by two centrifugation steps for 10 min and 40 min (21,500 × g at 4°C). The protein concentration was determined by using Roti-Nanoquant reagent according to the manufacturer's instructions (Roth, Karlsruhe, Germany), and the protein solutions were stored at −20°C.

To measure the incorporation of l-[35S]methionine into proteins, two aliquots of each protein solution (5 μl) was pipetted onto filter paper disks. After drying, they were subjected to 10 min of precipitation with 10% (wt/vol) trichloroacetic acid (TCA) on ice and washed for 10 min with 5% (wt/vol) TCA on ice and for 10 min with 90% (vol/vol) ethanol at room temperature. After drying, 1 ml toluene was added, and the radioactivity of the dried filter disks was measured as counts per minute on a Packard Tricarb 2900 TR liquid scintillation counter (PerkinElmer, Waltham, MA).

Preparation of cytoplasmic proteins for preparative two-dimen-sional (2D) gel electrophoresis.

Cells were separated from the supernatant by centrifugation (9,000 × g at 4°C) for 10 min, washed three times with ice-cold TE buffer, and resuspended in 1 ml ice-cold TE buffer. For cell lysis, 500 μl glass beads (0.01 to 0.1 mm) was added to the cell suspension, and the cells were disrupted by homogenization using a Ribolyser (Hybaid, United Kingdom) for 20 s at 6.5 m/s2 followed by incubation on ice for 4 min and a second disruption step for 30 s at the same acceleration. In order to remove cell debris and insoluble or aggregated proteins, the lysate was centrifuged for 25 min (21,500 × g at 4°C). The supernatant was transferred to a new tube, and the centrifugation step was repeated for 45 min. The protein concentration was determined as described above. Protein solutions were stored at −20°C.

Analytical and preparative 2D PAGE.

2D polyacrylamide gel electrophoresis (PAGE) was performed by using the immobilized pH gradient (IPG) technique as described previously (12). In the first dimension, proteins were separated on IPG strips (GE-Healthcare, Uppsala, Sweden) in a linear pH range of 4 to 7. For analytical 2D PAGE, 80 μg of radioactively labeled protein extracts was loaded onto the IPG strips. 2D PAGE analyses were performed as described previously (38). The resulting 2D gels were fixed with 50% (vol/vol) ethanol, 12% (vol/vol) acetic acid, and 500 μl/liter formaldehyde (37% [vol/vol]) for 1 to 2 h and subsequently stained with silver nitrate (15). The stained gels were scanned, dried in a vacuum dryer, and fixed onto Whatman paper. Afterward, the dried gels were exposed to storage phosphor screens (Molecular Dynamics, Buckinghamshire, United Kingdom) and scanned with a Typhoon scanner 9400 (Amersham Biosciences, Little Chalfont, United Kingdom) until the signal intensity reached a maximum value between 90,000 and 100,000.

For the identification of protein spots by mass spectrometry (MS), preparative 2D PAGE was performed. A total amount of 350 μg of protein extracts was loaded onto the IPG strips (GE Healthcare, Uppsala, Sweden) in a pH range of 4 to 7. The 2D gels obtained were fixed with 40% (vol/vol) ethanol and 10% (vol/vol) acetic acid for 1 h and then immediately stained with colloidal Coomassie brilliant blue (19). The gels were scanned with a Scanner X finity Ultra (Quato Graphic, Braunschweig, Germany).

Protein quantitation approaches.

For quantitation of cytoplasmic proteins, the 2D gel image analysis was performed with the software DELTA 2D version 3.4.1 beta 24 (Decodon GmbH, Greifswald, Germany). For each sampling point, gel images generated from two biological replicates were used to create a virtual fusion gel (union). This fusion gel was used for spot detection and spot mask editing. The final spot mask was transferred to each gel of the project to ensure 100% spot matching. The spot volumes of all 952 protein spots obtained were normalized by using total normalization. The protein synthesis ratios of the mupirocin-stressed samples and the corresponding protein spot of the control sample were calculated. Since we observed a general strong inhibition of the synthesis of proteins involved in the translation, we did not use an absolute threshold. Instead, we determined the 10% of the proteins with the highest induction ratios and the 10% of the proteins with the lowest induction ratios for each single sample point. Protein identification was performed as described previously (117) or deduced from the 2D protein reference map of S. aureus COL published elsewhere (9).

RNA preparation.

Total RNA was isolated from S. aureus COL using the acid-phenol method (48, 82) with modifications described by Fuchs et al. (44). The RNA for the DNA microarray experiments was further purified in order to eliminate traces of contaminating DNA. Briefly, the RNA was incubated with 7 U RNase-free DNase (Qiagen) for 10 min at room temperature, followed by two phenol-chloroform-isoamyl alcohol and two chloroform-isoamyl alcohol extraction steps in order to remove the DNase. The integrity of the RNA was checked with a Bioanalyzer (Agilent Technologies, Palo Alto, CA), and the concentration and purity were assessed using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Rockland, DE).

Northern blot analyses.

Samples for the Northern blot analyses were harvested at 5, 10, 30, and 60 min after mupirocin treatment. As controls, two samples were removed from the untreated culture at time point zero and 60 min after the beginning of the stress experiment. Northern blot analyses were done according to the protocol published by Wetzstein et al. (116). Digoxigenin-labeled RNA probes were prepared by in vitro transcription with T7 RNA polymerase and appropriate PCR fragments as templates (123). The PCR fragments were generated with chromosomal DNA isolated from S. aureus COL using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI) and the oligonucleotides listed in Table 1. Digoxigenin-labeled RNA marker I (Roche, Indianapolis, IN) was used to estimate transcript sizes. The hybridization signals were detected using a Lumi-Imager (Roche Diagnostics, Mannheim, Germany) and analyzed using the software package Lumi-Analyst (Roche Diagnostics, Mannheim, Germany).

Table 1.

Oligonucleotides used in this study

ORF ID S. aureus COLa Genea Primer
Direction Sequence (5′ to 3′)b
SACOL0541 spoVG Forward ATGAAAGTGACAGATGTAAG
Reverse CTAATACGACTCACTATAGGGAGATAAGCTTCTTCTGAATCTTC
SACOL0583 rplK Forward GCACATCGTGGCTAAAAAAG
Reverse CTAATACGACTCACTATAGGGAGATTATTCTACAACGATACCCA
SACOL0594 tuf Forward GTATCTGCTGCTGACGGTCC
Reverse CTAATACGACTCACTATAGGGAGAGGCATTACCATTTCAGTACC
SACOL0672 sarA Forward TAGGGAGGTTTTAAACATGG
Reverse CTAATACGACTCACTATAGGGAGAGTTGTTTGCTTCAGTGATTC
SACOL0742 Forward TGGATAAGAAAAAAGTCATC
Reverse CTAATACGACTCACTATAGGGAGATATGCCTCTGTATTGTTTTC
SACOL0815 Forward TAGATTTGAAATTCATGGAG
Reverse CTAATACGACTCACTATAGGGAGATCACTAGTTTGAATCAAGCC
SACOL0907 seb Forward GCAGAGAGTCAACCAGATCC
Reverse CTAATACGACTCACTATAGGGAGATCTCCTGGTGCAGGCATCAT
SACOL1118 typA Forward ATAAAAGAGAAGATGTCCGC
Reverse CTAATACGACTCACTATAGGGAGAGGAAGTTTTTCACTGTACCG
SACOL1136 Forward GGTCAATTACGCAATTAAGG
Reverse CTAATACGACTCACTATAGGGAGATGCTCTTTATCATATAATTG
SACOL1206 ileS Forward ACAGATTTCCCAATGCGAGG
Reverse CTAATACGACTCACTATAGGGAGATCAGGATGAACGGTAATCGC
SACOL1272 codY Forward ACGATTAGTAGCGTAACTG
Reverse CTAATACGACTCACTATAGGGAGACGTACCGCCAAGTTCTTC
SACOL1759 Forward GTTGACGGTTCACATGAAGC
Reverse CTAATACGACTCACTATAGGGAGAACTTGTGGTTGGAAGTCTGC
SACOL2042 ilvD Forward GGAGATCACCAAGCACCAGC
Reverse CTAATACGACTCACTATAGGGAGACCGTGTTTGTTGAACCACCC
SACOL2054 sigB Forward AAATAATGGCGAAAGAGTCG
Reverse CTAATACGACTCACTATAGGGAGACATAATGGTCATCTTGTTGC
SACOL2058 Forward ATGATTAGACGAGGAGATGT
Reverse CTAATACGACTCACTATAGGGAGAATATCAATATTTTATTTATC
SACOL2131 Forward GTAGCAAACTGGACAGTAGC
Reverse CTAATACGACTCACTATAGGGAGATCTGATACATCATCGCCAGC
SACOL2379 Forward GAGTAACTCACAAGCAATTCAAGC
Reverse CTAATACGACTCACTATAGGGAGACATTCATTAGCTTAATGGATTGCGG
SACOL2484 csb7 Forward CAAATGCCGTATAATTACAAG
Reverse CTAATACGACTCACTATAGGGAGAATATTTAATCTGTTCCAACCG
SACOL2511 fnbA Forward CGAAAGTGGAAACGGGTACAG
Reverse CTAATACGACTCACTATAGGGAGAGCTCTGGATGTCCTACC
SACOL2597 Forward ACTTTAGAATTACAAGGCGC
Reverse CTAATACGACTCACTATAGGGAGAATATAACCTAAGTGACCGCC
a

Based on the Institute for Genomic Research (TIGR) annotation (http://www.jcvi.org). ORF, open reading frame.

b

The underlined nucleotides at the 5′ end represent the binding site for the T7 RNA polymerase.

DNA microarray analyses.

Samples for DNA microarray analyses were harvested at time point zero and 10 min after the addition of mupirocin.

Synthesis of Cy5-dCTP- or Cy3-dCTP (PerkinElmer, Waltham, MA)-labeled cDNA was done with 10 μg of total RNA as a template by direct reverse transcription using Superscript II (Invitrogen, Darmstadt, Germany) and random hexamers (Promega, Madison, WI) according to the manufacturers' instructions. To degrade the RNA after cDNA synthesis, the reaction mixture was incubated for 30 min at room temperature with E. coli RNase H (Invitrogen, Darmstadt, Germany). The labeled cDNA was then purified with the QIAquick PCR Purification Kit (Qiagen, Mannheim, Germany). The Cydye incorporation was analyzed with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Rockland, DE). A sample volume of the labeled cDNA corresponding to 30 pmol incorporated dye was used for two-color competitive hybridization experiments. In total, four independent hybridization experiments, with each representing a biological replicate including a control and a treated sample, were carried out. To account for the dye bias, two of the four replicates were dye swapped.

The design and evaluation of the customized StaphChip oligoarray manufactured by Agilent Technologies (Palo Alto, CA) used in this study have been described previously (24). The StaphChip used in the study is based on the whole genome sequences of S. aureus strains COL, MRSA252, MSSA476, Mu50, MW2, N315, USA300, and 8325. Hybridization and washing of slides were carried out as described by Charbonnier et al. (24). The slides were scanned with the Agilent scanner. Spot intensity values were extracted with the Feature Extraction software provided by Agilent. Visualization and analyses of expression data were done in GeneSpring GX 7.3.1 (Agilent) and with the Cyber-T program for the analysis of paired expression data (http://cybert.microarray.ics.uci.edu) (7). The parameters for the Bayesian standard deviation estimation applied in the Cyber-T analysis were as follows: a sliding-window size of 101 and a confidence value for the Bayesian variance estimate of 12. Genes with a P value of <0.001 associated with the Bayesian t statistic and at least a 2-fold change in the mean fluorescence value of the four hybridization experiments were considered biologically significant expression changes.

Metabolome analysis.

S. aureus wild-type strain COL was grown as described above in defined synthetic medium without addition of MOPS (morpholinepropanesulfonic acid) buffer. At an OD500 of 0.5, the cells were treated with 0.03 μg/ml mupirocin, and samples were harvested directly after the addition of mupirocin (0 min) and after 10 min and 30 min. Samples for intracellular metabolite analysis were taken by fast filtration through a 0.45-μm sterility filter by vacuum. The cells were washed and quenched, and metabolites were extracted as described by Meyer et al. (85). Analytical biochemistry detection of nucleotides was performed by ion-pairing–liquid chromatography–mass spectrometry (IP-LC-MS) (79) and detection of amino acids, organic acids, and fatty acids by gas chromatography-mass spectrometry (GC-MS) (78). Quantification of compounds was done by referring to an internal standard in all samples, Br-ATP for IP-LC-MS and ribitol for GC-MS analysis. Identifications and calibration curves for all metabolites were done through comparison and measuring of pure standard compounds; an exception was (p)ppGpp. For the latter, no chemical standard was commercially available, so the accurate mass was calculated and compared with the found mass [(M-H+)calculated = 681.911 versus (M-H+)detected = 681.910]. Quantification of (p)ppGpp was done by adopting the calibration values from ppGpp, due to the analogous structure. Extracellular-metabolite quantifications of sterile filtered culture medium were made by 1H nuclear magnetic resonance (NMR) analysis (78). The results for intracellular metabolites were normalized to the cell dry weight.

Microarray data accession number.

Transcription data were deposited at the NCBI Gene Expression Omnibus (GEO) database with accession number GSE30743 and platform identification GPL13937.

RESULTS AND DISCUSSION

Extensive influence of mupirocin on global gene expression in S. aureus.

We used a combined functional-genomics approach, including proteomic, transcriptomic, and metabolomic analyses, to characterize the response of S. aureus COL to subinhibitory concentrations of mupirocin (Fig. 1).

Fig 1.

Fig 1

Growth inhibition of S. aureus COL induced by mupirocin. S. aureus COL was grown in synthetic medium at 37°C and 134 rpm. At an OD500 of 0.5, the culture was split and treated with increasing amounts of mupirocin: 0 μg/ml (control), 0.015 μg/ml, 0.03 μg/ml, and 0.06 μg/ml. The growth experiments were repeated three times. The results of one representative experiment are shown. For the stress experiments, a mupirocin concentration of 0.03 μg/ml (3 times the mupirocin MIC), reducing the growth rate of S. aureus COL by 50%, was selected.

The analytical window of the 2D gel-based proteomic approach covered 679 identified individual protein spots. Since proteins may occur as multiple spots due to modifications changing their isoelectric points and/or molecular weights, the 679 identified spots were assigned to 516 individual proteins (D. Zühlke, S. Fuchs, H. Kusch, D. Albrecht, and S. Engelmann, unpublished data). Of these, 60 proteins (66 protein spots) showed decreased and 20 proteins (25 protein spots) increased synthesis in response to mupirocin treatment (Tables 2 and 3 and Fig. 2). The DNA microarray analyses identified 274 downregulated and 320 upregulated genes (see Tables S1 and S2 in the supplemental material). If we consider only transcripts for which a corresponding cytosolic protein spot was identified in the analytical window of our 2D gel (pI range, 4 to 7; mass range, 10 to 140 kDa), solely for 20% of the genes with altered transcript levels in response to mupirocin, similar changes in translational activity have been observed. On the other hand, for 40% of the differently synthesized cytosolic proteins, the observed effects on protein synthesis have been attributed to changed mRNA levels. These results clearly show that posttranscriptional regulatory mechanisms play an important role under these conditions, and only a combination of both techniques provides a comprehensive picture of the regulatory processes that effectively alter gene expression by mupirocin. A compilation of both methods identified a total of 318 negatively and 325 positively regulated genes, corresponding to 23% of the S. aureus COL genome coding capacity.

Table 2.

Proteins with decreased synthesis after mupirocin treatment

ORF ID
S. aureus COLa,b
Symbol Spot IDa Functiona Induction ratio after mupirocin treatmentc:
2D PAGE
Array (10 min)
10 min 30 min 60 min c2
SACOL1385 AcnA AcnA-1 Aconitate hydratase −0.66 −1.54 −1.32 0.24 0.90
SACOL1673 AlaS AlaS Alanyl-tRNA synthetase −1.19 −1.85 −1.05 −0.50 −0.11
SACOL1984 AldA2 AldA2 Aldehyde dehydrogenase 0.47 0.04 −1.43 0.74 0.66
SACOL2097 AtpA AtpA-1 ATP synthase F1, alpha subunit −1.20 −1.36 −0.57 0.20 0.12
AtpA-2 −1.35 −1.13 −0.79 −0.02
SACOL2095 AtpD AtpD ATP synthase F1, beta subunit −0.97 −1.46 −0.75 −0.03 0.21
SACOL0142 Cap5G Cap5G UDP-N-acetylglucosamine 2-epimerase Cap5G −1.30 −0.62 −0.99 0.03 1.36
SACOL1215 CarB CarB Carbamoyl-phosphate synthase, large subunit −1.03 −1.34 −1.76 −0.46 −0.17
SACOL2563 ClpL ClpL ATP-dependent Clp protease, putative −0.51 −1.30 −0.56 −0.25 0.58
SACOL1272 CodY CodY-1 Transcriptional regulator CodY −1.26 −1.28 −1.01 0.19 −1.96
SACOL0987 FabH FabH 3-Oxoacyl-(acyl carrier protein) synthase III −1.32 −1.79 −1.01 −0.39 −1.56
SACOL1782 Fhs Fhs-1 Formate-tetrahydrofolate ligase −0.98 −1.49 −1.36 0.27 −0.90
Fhs-2 −0.62 −1.28 −1.26 0.04
SACOL2737 GidA GidA Glucose-inhibited division protein A −0.80 −1.32 −0.14 0.01 −0.26
SACOL1321 GlpD GlpD-1 Aerobic glycerol-3-phosphate dehydrogenase 0.16 −0.88 −2.24 −0.52 −0.26
SACOL2105 GlyA GlyA-2 Serine hydroxymethyltransferase −0.69 −1.28 −1.30 0.19 0.09
SACOL1371 GuaC GuaC-2 GMP reductase −1.46 −1.20 −3.02 −0.34 −0.07
SACOL0005 GyrB GyrB-1 DNA gyrase, B subunit −1.15 −1.47 −1.00 0.14 −1.14
SACOL0825 HprK HprK HPr kinase/phosphatase −0.82 −0.73 −1.35 0.14 −0.51
SACOL1271 HslU HslU-1 Heat shock protein HslVU, ATPase subunit HslU −1.68 −1.91 −1.35 −0.27 −1.95
SACOL1741 Icd Icd-1 Isocitrate dehydrogenase, NADP dependent −1.10 −1.17 −1.66 0.10 0.17
SACOL0428 MetE MetE 5-Methyltetrahydropteroyl-triglutamate–homocysteine methyltransferase −1.89 −2.90 −2.74 −0.41 −0.60
SACOL1966 PcrA PcrA ATP-dependent DNA helicase PcrA −1.17 −1.73 −1.02 0.30 −0.83
SACOL1104 PdhC PdhC-1 Pyruvate dehydrogenase complex E2 component, dihydrolipoamide acetyltransferase −0.37 −1.13 −0.21 −0.24 −0.18
SACOL1105 PdhD PdhD-1 Pyruvate dehydrogenase complex E3 component, lipoamide dehydrogenase −0.66 −1.31 −1.06 −0.08 −0.41
SACOL1795 PepA1 PepA1 Glutamyl aminopeptidase −1.39 −1.61 −1.58 −0.11 −0.62
SACOL0841 Pgm Pgm-2 Phosphoglycerate mutase, 2,3-bisphosphoglycerate independent −1.24 −2.17 −1.54 −0.55 0.48
SACOL1149 PheT PheT Phenylalanyl-tRNA synthetase, beta subunit −0.97 −1.30 −0.73 0.39 −0.39
SACOL1092 PtsI PtsI-1 Phosphoenolpyruvate-protein phosphotransferase −1.13 −1.36 −1.02 0.12 0.18
PtsI-2 −0.87 −1.18 −1.13 −0.33
SACOL1969 PurB PurB Adenylosuccinate lyase −0.95 −0.62 −1.68 0.61 −0.32
SACOL1075 PurC PurC Phosphoribosylaminoimidazole-succinocarboxamide synthase −1.36 −0.23 −1.76 −0.04 −0.98
SACOL1083 PurD PurD Phosphoribosylamine-glycine ligase −0.72 −1.37 −0.66 0.25 −0.46
SACOL1073 PurE PurE Phosphoribosylaminoimidazole carboxylase, catalytic subunit −1.22 −0.68 −1.70 0.49 −1.67
SACOL1082 PurH PurH-1 Phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase −1.49 −2.59 −2.48 0.17 −1.13
PurH-2 −1.36 −1.33 −1.83 −0.21
PurH-3 −1.32 −1.02 −1.61 0.50
SACOL1074 PurK PurK Phosphoribosylaminoimidazole carboxylase, ATPase subunit −1.19 −1.97 −1.46 0.42 −1.24
SACOL1080 PurM PurM Phosphoribosylformylglycine-amidine cycloligase −1.31 −0.58 −1.70 0.31 −1.28
SACOL1077 PurQ PurQ Phosphoribosylformylglycine-amidine synthase I −1.24 −1.35 −1.67 0.42 −1.02
SACOL1216 PyrF PyrF Orotidine 5-phosphate decarboxylase −1.17 0.28 −1.35 0.59 −0.32
SACOL2213 RpoA RpoA DNA-directed RNA polymerase, alpha subunit −1.00 −1.33 −1.06 −0.24 −0.59
SACOL1274 RpsB RpsB-1 Ribosomal protein S2 −0.86 −1.18 −0.59 −0.36 −0.92
SACOL2057 RsbU RsbU Sigma factor B regulator protein −0.33 −1.16 −0.32 −0.10 −0.24
SACOL0429 SACOL0429-1 5-Methyltetrahydrofolate–homocysteine methyltransferase, putative −1.66 −1.18 −2.37 −0.37 −2.56
SACOL0430 SACOL0430-1 trans-sulfuration enzyme family protein −1.76 −1.23 −2.45 −0.47 −2.99
SACOL0430-2 −1.51 −0.44 −1.66 −0.41
SACOL0617 SACOL0617 Hexulose-6-phosphate synthase, putative −0.66 −1.14 −1.37 −0.73 0.87
SACOL0944 SACOL0944 NADH dehydrogenase, putative −0.82 −1.41 −0.95 −0.05 −0.17
SACOL0945 SACOL0945-2 Cytosol aminopeptidase −0.79 −1.73 −1.77 −0.21 0.01
SACOL1108 SACOL1108 Spermidine/putrescine ABC transporter, ATP-binding protein −1.20 −1.20 −1.02 −0.14 −1.05
SACOL1236 SACOL1236 Thiamine pyrophosphokinase −0.42 −1.20 −0.34 −0.33 0.41
SACOL1386 SACOL1386 Conserved hypothetical protein TIGR00051 −1.37 −1.10 −1.38 0.33 −0.12
SACOL1483 SACOL1483 Conserved hypothetical protein −0.98 −1.21 −1.47 0.31 −1.15
SACOL2136 SACOL2136 Conserved hypothetical protein −0.64 −0.54 −1.27 −0.84 1.96
SACOL2293 SACOL2293 NAD/NADP octopine/nopaline dehydrogenase family protein −1.34 −1.27 −1.42 −0.55 1.64
SACOL2335 SACOL2335 ABC transporter, ATP-binding protein −1.12 −0.82 −1.90 0.52 0.32
SACOL2596 SACOL2596 Conserved hypothetical protein −1.85 −2.44 −2.34 −0.82 0.19
SACOL2597 SACOL2597 Hydrolase, alpha/beta hydrolase fold family −1.78 −2.61 −3.01 −0.92 1.4
SACOL1773 SerA SerA-1 d-3-Phosphoglycerate dehydrogenase −0.91 −1.17 −0.40 0.12 1.04
SACOL1449 SucA SucA-1 2-Oxoglutarate dehydrogenase, E1 component −0.22 −1.16 −0.41 0.50 −1.64
SACOL1377 Tkt Tkt-2 Transketolase −0.09 −1.15 −0.38 0.20 −1.13
SACOL0829 TrxB TrxB Thioredoxin-disulfide reductase −2.01 −1.83 −1.12 −0.28 0.47
SACOL1118 TypA TypA GTP-binding protein TypA −1.91 −1.87 −1.15 −0.08 −1.86
SACOL1778 TyrS TyrS Tyrosyl-tRNA synthetase −1.85 −1.36 −0.96 0.59 −0.01
SACOL1666 Udk Udk Uridine kinase −1.19 −0.03 −0.62 0.15 −0.68
a

The IDs, symbols, and functions are based on the Institute for Genomic Research (TIGR) annotation (http://www.jcvi.org).

b

The ORF ID is italicized if the transcriptional data show contrary values.

c

At the indicated time points following mupirocin administration, radioactively labeled methionine was added for 5 min to visualize newly synthesized proteins. The induction ratios were calculated by dividing the normalized intensity of the protein spot in the 2D gel image at the indicated time point after mupirocin stress (10, 20, or 30 min of stress; c2, 60-min control sample) by the corresponding spot intensity in the image of the unstressed control at time point zero. Values are shown as log2 of ratios. The induction ratios of the most reduced 10% of the proteins are in boldface.

Table 3.

Proteins with increased synthesis after mupirocin treatment

ORF ID S. aureus COLa Symbol Spot IDa Functiona Induction ratio after mupirocin treatmentb
2D PAGE
Array (10 min)
10 min 30 min 60 min c2
SACOL0452 AhpC AhpC-1 Alkyl hydroperoxide reductase, C subunit 0.21 0.78 1.24 −0.17 1.06
SACOL2173 Asp23 Asp23-4 Alkaline shock protein 23 1.07 0.88 1.08 −0.47
SACOL1206 IleS IleS-2 Isoleucyl-tRNA synthetase 2.70 2.69 3.31 −0.08 2.93
IleS-3 2.08 2.09 2.71 −0.37
SACOL2050 IlvA2 IlvA2-1 Threonine dehydratase 1.62 1.93 1.65 0.88 1.73
SACOL2043 IlvB IlvB-1 Acetolactate synthase, large subunit, biosynthetic type 2.64 2.23 2.46 0.62 1.94
IlvB-2 1.59 1.35 1.27 0.17
SACOL2045 IlvC IlvC-1 Ketol-acid reductoisomerase 2.32 2.36 2.37 0.18 1.07
IlvC-3 2.05 2.45 2.37 0.18
SACOL2042 IlvD IlvD-1 Dihydroxy-acid dehydratase 2.00 2.01 1.71 0.63 2.37
IlvD-2 1.65 1.57 1.44 0.35
SACOL2049 LeuD LeuD 3-Isopropylmalate dehydratase, small subunit 1.39 1.93 1.46 0.67 1.20
SACOL1005 PepF PepF Oligoendopeptidase F 1.61 0.74 1.51 0.36 1.19
SACOL1365 SACOL1365 Hydrolase, haloacid dehalogenase-like family 0.93 0.87 0.61 0.81 0.52
SACOL1562 SACOL1562-1 2-Oxoisovalerate dehydrogenase, E1 component, alpha subunit 1.53 2.53 2.13 −0.08 −0.72
SACOL1759 SACOL1759-1 Universal stress protein family 1.10 1.33 0.35 0.08 2.09
SACOL1759-2 1.73 2.74 0.84 0.77
SACOL1787 SACOL1787-2 Chorismate mutase/phospho-2-dehydro-3-deoxyheptonate aldolase 1.05 1.86 1.32 0.64 2.17
SACOL1891 SACOL1891-1 RNAIII-activating protein TRAP 0.63 1.37 0.31 0.24 2.28
SACOL1975 SACOL1975 Nicotinate phosphoribosyltransferase 0.88 0.72 1.02 0.29 0.43
SACOL2106 SACOL2106 Conserved hypothetical protein TIGR01440, 1.95 1.28 0.96 0.78 0.20
SACOL2131 SACOL2131 Dps family protein 0.35 1.37 1.67 −0.11 1.23
SACOL2379 SACOL2379-1 Conserved hypothetical protein 0.82 0.73 1.05 −0.21 1.89
SACOL2519 SACOL2519-2 Conserved hypothetical protein 0.40 1.43 1.11 −0.61 1.63
SACOL2722 SACOL2722 N-Acetyltransferase family protein 1.14 1.32 0.86 0.30 1.05
a

The IDs, symbols, and functions are based on the Institute for Genomic Research (TIGR) annotation (http://www.jcvi.org).

b

At the indicated time points following mupirocin administration, radioactively labeled methionine was added for 5 min to visualize newly synthesized proteins. The induction ratios were calculated by dividing the normalized intensity of the protein spot in the 2D gel image at the indicated time point after mupirocin stress (10, 20, or 30 min of stress; c2, control sample) by the corresponding spot intensity in the image of the unstressed control at time point zero. Values are shown as log2 of ratios. The induction ratios of the most induced 10% of the proteins are in boldface.

Fig 2.

Fig 2

Synthesis of cytoplasmic proteins following mupirocin treatment. (A) False-color image of 2D gels from l-[35S]methionine-labeled protein extracts. Green, untreated control (exponentially growing cells); red, cells exposed to 0.03 μg/ml mupirocin. As a representative example, a 2D gel from the 30-min stress time point is shown. The 2D gel images were overlaid and analyzed with Delta2D software. Proteins that were regulated at least at one time point during the course of the experiment are indicated. Proteins with significantly increased synthesis rates following mupirocin treatment are labeled in red. The green-labeled spots represent proteins whose synthesis was significantly repressed. Proteins with unchanged synthesis rates in response to mupirocin appear in yellow. Summaries of the regulated proteins are shown in Table 2 (repressed proteins) and Table 3 (induced proteins). (B) Threshold criteria. The 10% of the proteins with either the lowest or the highest induction ratios were considered significantly regulated. The induction ratio cutoffs for each time point are shown as log2 values.

Among the repressed genes identified by both approaches, the most prominent functional groups were those with roles in the regulation, structure, and function of the cell's replication, transcription, and translation machineries. However, whereas the DNA array showed strong repression of 29 ribosomal protein-encoding genes, they were not detected satisfactorily by the 2D gels. Ribosomal proteins are characterized by an alkaline pI (usually in the range from 8 to 11) and are not reproducibly covered by the analytical window of the 2D gels used in this study (pI range, 4 to 7). We further observed strong repression of the pathways that provide precursors for RNA and DNA synthesis (the pur and pyr operons) (Fig. 3). This massive repression of genes whose products are required at a high level during rapid growth is a hallmark of the stringent response. Consistent with this, we observed that 10 min after the addition of mupirocin, the protein synthesis rate, as measured by the incorporation of radioactive methionine, had already decreased to 50% compared to that of the untreated control. Maximal repression of protein synthesis to 26% was observed 30 min after stress (Fig. 4).

Fig 3.

Fig 3

Timeline analyses of newly synthesized proteins following mupirocin treatment. Shown are false-color images of the protein synthesis rates of S. aureus COL grown in synthetic medium under nonstressed conditions (exponential growth) (c1) compared to the protein synthesis patterns at different time points after the addition of mupirocin (10, 30, and 60 min) and that of an untreated culture 60 min after the beginning of the stress experiment (c2). The autoradiograms were normalized using total normalization. Red indicates induced synthesis, while green indicates repressed synthesis. The diagrams on the right illustrate fold changes in protein synthesis rates as log2 values of stress/control ratios of protein spot intensities at the different time points (10 min/c1, 30 min/c1, 60 min/c1, and c2/c1). If a protein was present as multiple spots on the 2D gel, the respective spot identifier (ID) is shown as a subscript. (A) Protein synthesis of enzymes of purine ribonucleotide biosynthesis was repressed following mupirocin addition. Also shown is a schematic diagram of the purine ribonucleotide biosynthetic pathway summarizing the results of the 2D gel and DNA array analyses. Genes or proteins that were identified as significantly repressed are depicted as green lines connecting key intermediates (shown in blue). (B) Negatively controlled proteins of DNA metabolism (GyrB, PcrA, and RpoA). (C) Synthesis patterns of significantly induced proteins with functions in detoxification (AhpC), stress protection, or adaptation (SACOL1759, SACOL2131, and Asp23).

Fig 4.

Fig 4

Inhibitory effect of mupirocin on the protein synthesis rate of S. aureus COL cells. Cultures were grown in synthetic medium and treated with 0.03 μg/ml mupirocin at an OD500 of 0.5. Five, 10, 30, and 60 min after the addition of mupirocin, the proteins were pulse-labeled for 5 min with l-[35S]methionine (black bars) to investigate the rate of newly synthesized proteins. Cells of the untreated culture (white bars) were pulse-labeled at the beginning of the stress experiment (c1) and 60 min later (c2). Counts per minute were determined for each time point relative to the corresponding protein amount in order to define the level of l-[35S]methionine incorporation. The values are given as means. Standard deviations of two independently analyzed cultures are shown.

Additional metabolic pathways that were downregulated included fatty acid and phospholipid biosynthesis and the tricarboxylic acid cycle. Furthermore, expression of genes of the phosphotransferase system (PTS) was repressed. In addition, the synthesis of several transport systems was repressed. Most of these transport systems encode highly hydrophobic integral membrane proteins and were mainly detected by the DNA microarray experiment. However, in some instances, the ATP-binding protein domains of ABC transporters (e.g., SACOL1108) were also detected as repressed on the 2D gels.

The resources released by the general shutdown of energy-consuming processes required during rapid growth are a prerequisite for the initiation of adaptation strategies in order to restore conditions that allow survival under stringent control. By far the strongest induction of expression was observed for the isoleucyl-tRNA synthetase IleS, the molecular target of mupirocin, and for the enzymes catalyzing branched-chain amino acid (BCAA) biosynthesis (the ilv-leu operon). Nonetheless, the intracellular levels of the BCAAs valine, leucine, and isoleucine increased only slightly 30 min after mupirocin treatment compared to the untreated control (Fig. 5). This lack of increased BCAA synthesis, albeit strong induction of the biosynthetic pathways and putative uptake systems, might be caused by allosteric inhibition of the biosynthetic enzymes by the isoleucine that is still present (41, 58, 106). Surprisingly, overall we observed only minor alterations in the intracellular amino acid and carbon metabolism intermediate pool and no specific changes in the extracellular metabolite concentration following mupirocin treatment. No significant changes in the concentrations of glycine, tryptophan, threonine, aspartate, glucose, pyruvate, phosphoenolpyruvate, citrate, fumarate, ketoglutarate, malate, glycerol, lactate, and urea were detected. The succinate concentration displayed a significant drop at 30 min (data not shown), and the nucleotide pools changed in distinct ways in the mupirocin-treated culture.

Fig 5.

Fig 5

Effects of mupirocin on Ala, Leu, Val, Ile, and Thr amino acid biosynthetic pathways. (A) Schematic overview of biosynthetic amino acid pathways summarizing the results of the proteome and the array analyses. Significantly induced or repressed synthesis steps are shown in red and green, respectively. Important metabolites are depicted in blue. (B) Synthesis patterns of proteins of the BCAA pathway and IleS, as well as IlvA2, under nonstressed conditions at exponential growth (c1) compared with the protein synthesis patterns at different time points after addition of mupirocin (10, 30, and 60 min) and with that of a culture 60 min after the beginning of the stress experiment (c2). Red indicates induced synthesis. The diagrams on the right illustrate fold changes in protein synthesis rates as log2 values of stress/control ratios of protein spot intensities at different time points (10 min/c1, 30 min/c1, 60 min/c1, and c2/c1). If a protein was present as multiple spots on the 2D gel, the respective spot ID is shown as a subscript. (C) Intracellular concentrations of alanine, leucine, valine, isoleucine, and threonine following mupirocin treatment were measured using gas chromatography-mass spectrometry. The results were normalized to the cell dry weight (CDW). The data are expressed as means and standard deviations (SD) calculated from four biological replicates. White bars, untreated control; black bars, mupirocin-treated cells. Note the different scaling of the y axes.

In addition to ileS and the ilv-leu genes, several genes with roles in adaptation to stress and starvation were significantly induced (ahpC, katA, SACOL1753, SACOL1759, and SACOL2131). Of particular interest was the induction of the two GTP pyrophosphokinases, encoded by relA1 (synonyms relQ and SACOL1010) and relA2 (synonyms rsh and SACOL1689), responsible for the synthesis of the stringent response alarmone (p)ppGpp (for a review, see reference 118). Furthermore, toxin/antitoxin addiction modules, encoded by SACOL2404-SACOL2405 and SACOL2464-SACOL2465, were among the induced genes. In addition, Northern blot analysis revealed upregulation of the transcription of the genes SACOL2059-SACOL2058, coding for MazE-MazF, which are not represented on the DNA array. Another striking observation was the induction of a large set of operons encoding ABC transporters and permeases with a predicted substrate specificity for amino acids and oligopeptides. Regarding the above-mentioned results, it is important to note that almost 50% of the genes that we found to be either induced or repressed in response to mupirocin encode hypothetical proteins or proteins with unknown or only predicted functions.

While the DNA microarray analyses reflected the immediate events in the adaptation to a mupirocin challenge, the proteomic data allowed timeline analysis. This analysis revealed two groups of expression kinetics for the induced proteins: (i) proteins with an immediate increase in synthesis (e.g., IleS, enzymes of the BCAA pathway, and SACOL1759) already reaching the maximum induction level 10 min following mupirocin treatment and (ii) proteins with delayed upregulation of synthesis (e.g., SACOL2131 and AhpC) (Fig. 3 and Fig. 5). Expression of proteins in the second group increased at a constant rate during the course of the experiment. These results suggest that the disturbance of the cells' physiology caused by mupirocin, in addition to stringent conditions, evokes secondary stress that may accumulate over time.

A clear grouping of significantly repressed proteins was less evident. In the majority of cases, repression was already observed 10 min after stress, with maximum repression occurring between 30 and 60 min following mupirocin exposure (Fig. 3). In general, the translation kinetics equaled the transcription kinetics, as shown for selected induced and repressed genes (typA, codY, ileS, ilvD, SACOL1759, and SACOL2131) by Northern blots (Tables 2 and 3 and Fig. 6).

Fig 6.

Fig 6

Fig 6

Fig 6

Northern blot analysis of genes whose transcription was influenced by mupirocin. For RNA preparation, S. aureus COL was grown in synthetic medium at 37°C to an OD500 of 0.5 and treated with 0.03 μg/ml mupirocin. RNA was isolated 5, 10, 30, and 60 min after the addition of mupirocin (+). As a control, untreated cells (−) were harvested at time point zero (c1) and 60 min later (c2). Total RNA was separated on denaturing RNA gels and blotted onto positively charged nylon membranes. The membranes were hybridized with digoxigenin-labeled RNA probes for the respective genes. Schematic representations of the gene loci based on the sequence of S. aureus COL and the transcriptional organization of the predicted operons are shown. Induction ratios (log2 values) for the probed genes as determined by the DNA microarray experiments for the 10-min stress versus control time point are indicated below the respective Northern blots (indicated by A:). The grouping based on expression profiles is as follows: repressed transcription (A), immediately induced transcription (within 5 to 10 min) (B), induced transcription but with a delay (maximum reached after 10 min) (C), transient induction of transcription (decline to prestress level after a maximum) (D), and complex regulation (multiple differentially regulated transcripts detected with the same probe) (E).

For five genes (cap5G, serA, SACOL2136, SACOL2293, and SACOL2597), however, an opposite regulation was observed in the 2D gel and DNA microarray experiments. For instance, while the DNA array detected clear induction of SACOL2597 transcription, the proteomic approach revealed strong downregulation in synthesis of the encoded protein. In this context, it is important to consider that the signal in the DNA microarray reflects the sum of all RNA molecules detected by a given probe. For SACOL2597, Northern blot analyses showed a complex transcript pattern. The small size of some of the detected mRNAs suggests processing of the SACOL2597 mRNA and may thus point to posttranscriptional regulation of SACOL2597 expression via control of mRNA stability (Fig. 6).

Regulatory networks active in the presence of mupirocin. (i) (p)ppGpp.

The massive changes in gene expression following mupirocin treatment are orchestrated by an exceedingly complex network of global regulators that act at the transcriptional and posttranscriptional levels. The major player in this network is likely (p)ppGpp, and intracellular accumulation of (p)ppGpp was evident 30 min after mupirocin treatment (Fig. 7) (22, 29, 46, 51). The amount of pppGpp exceeded that of ppGpp, which is in agreement with previous data (22, 46). A significant decrease in the level of the (p)ppGpp reagent GTP was already measurable 10 min after the addition of mupirocin. At this early time point, (p)ppGpp was not detectable. These data suggest that the significant drop in the GTP level may exert a major regulatory effect, since considerable alterations in gene expression were already observed 10 min after stress. At present, however, the possibility that biologically effective levels of (p)ppGpp may have escaped detection by the liquid chromatography (LC)-based approach cannot be excluded, since transcription of the (p)ppGpp synthetase gene relA1 (relQ) and the bifunctional (p)ppGpp synthetase and hydrolase gene relA2 (rsh) was already significantly upregulated at the 10-min point. In contrast, expression of SACOL2518, which is a homologue of the streptococcal (p)ppGpp synthetase gene relP, was downregulated. The exact physiological roles of RelQ and RelP in firmicutes has not been conclusively clarified yet, but it has been suggested that they may contribute to the fine tuning of the (p)ppGpp level under specific conditions. The main source of (p)ppGpp following amino acid limitation in S. aureus or Streptococcus mutans, however, remains synthesis by RelA2 (synonyms Rsh and SACOL1689) (46, 76, 118).

Fig 7.

Fig 7

Intracellular concentrations of nucleotides involved in (p)ppGpp synthesis following mupirocin treatment. S. aureus COL was cultivated in synthetic medium to an OD500 of 0.5 and treated with mupirocin at a final concentration of 0.03 μg/ml. Shown are the intracellular concentrations of the effector molecules GTP 3′-diphosphate (pppGpp) and GDP 3′-diphosphate (ppGpp) and the nucleotides required for their synthesis as determined by liquid chromatography-mass spectrometry. White bars, untreated control; black bars, mupirocin-treated cells. The data display means and SDs of the means calculated from four biological replicates. Note the different scaling of the y axes. (Significant difference by unpaired t test with Welch's correction, P < 0.05.)

(ii) T-box.

In addition to the stimulation of (p)ppGpp synthesis, monitoring of the cellular amino acid pool via tRNAs is further exploited by a conserved cis-regulatory sequence motif, the T-box. A T-box is present in the leader region of many mRNAs encoding aminoacyl-tRNA synthetases and biosynthesis genes. Binding of the cognate uncharged tRNA to the T-box stimulates read-through of a termination signal in the mRNA leader region, allowing expression of the genes located downstream (53). The presence of a T-box has been demonstrated for the ileS leader mRNA (52). Inspection of the upstream region of SACOL2412, encoding an amino acid binding protein of an ABC transporter, which was strongly induced by mupirocin, also revealed the presence of a T-box motif. Thus, it is conceivable that expression of this gene, like that of ileS, is also subjected to control by isoleucyl-tRNA. In addition, the biosynthetic pathway for the synthesis of BCAAs encoded by genes of the ilv-leu operon was markedly upregulated at the transcriptional and the protein synthesis levels. Although only a weak T-box motif was identified in the ilv-leu upstream region, isoleucyl-tRNA-dependent regulation of the ilv-leu operon cannot yet be fully excluded.

In contrast to the strong upregulation of ileS, the alanyl-tRNA synthetase (alaS), histidyl-tRNA synthetase (hisS), and leucyl-tRNA synthetase (leuS) genes were downregulated. This might be a result of the accumulation of their cognate charged tRNAs due to the overall stop in protein synthesis, since good T-box sequences were identified in the upstream regions of the respective genes.

(iii) CodY.

Although it is obvious that mupirocin triggers a stringent response, in the absence of a mutant defective in synthesis of (p)ppGpp, we cannot clearly distinguish between regulatory effects directly [(p)ppGpp mediated] or indirectly related to stringent control. The large number of regulated genes suggests that, in addition to stringent control, further global regulators, like CodY, shape the response of S. aureus to mupirocin (46).

CodY is a global transcriptional repressor in many Gram-positive bacteria that during exponential growth mainly inhibits transcription of a large number of genes required for stationary-phase adaptation (10, 101, 107, 108). Although the amino acid sequence of CodY is highly conserved among firmicutes, CodY activity is differently affected by GTP and BCAAs. While in B. subtilis and its close relatives Bacillus cereus, Clostridium difficile, and Listeria monocytogenes CodY is allosterically activated for DNA binding by both GTP and BCAAs (11, 17, 33, 65, 87, 101, 105), in lactococci and streptococci, CodY activity seems to be enhanced solely by BCAAs (54, 61, 77, 97).

A consensus directed search using the B. subtilis CodY operator sequence AATTTTCWGAAAATT (31) as a query identified 63 genes potentially under the control of CodY in S. aureus COL. Of these, 19 were found to be upregulated and 4 to be repressed in our experiment. A significant overlap was also found with the experimentally determined CodY regulons in S. aureus Newman and UAMS-1. Of the genes affected by mupirocin in the present study, CodY has been shown to regulate the transcription of 44, and of 61 genes in strains Newman and UAMS-1, respectively. This corresponds to 35% (Newman) and 22% (UAMS-1) of CodY-regulated genes in these strains (80, 98).

Furthermore, the metabolome analyses for the two CodY ligands showed a marked decrease in the intracellular GTP pool but only a slight increase in intracellular BCAA levels (Fig. 5 and 7). Interestingly, following mupirocin treatment, we found a marked repression of CodY expression at the transcriptional and translational levels. However, autoregulation of the codY operon has not been demonstrated for S. aureus so far. Together, these observations suggest that CodY is a central regulator in S. aureus during the response to mupirocin and that in the absence of changes in the level of BCAAs a drop in the cellular GTP level may be sufficient to alter the affinity of CodY for at least some of its operators in S. aureus.

(iv) SigB.

The alternative sigma factor SigB (RpoF) may be an additional global regulator active in mupirocin-treated cells. Of the 25 genes with an experimentally confirmed SigB-dependent transcriptional start site (14, 32, 48, 62, 63, 83, 95), 16 showed increased expression following mupirocin stress in the present study (katA, opuD2, SACOL0444, SACOL0671, SACOL0678, SACOL0679, SACOL0680, SACOL0681, SACOL0682, SACOL0684, SACOL0685, SACOL0741, SACOL0742, SACOL2136, SACOL2174, and sarA) (Table 3; see Table S2 in the supplemental material). Interestingly, recent work showed that alkaline stress, a condition that was demonstrated to induce SigB-dependent transcription, also triggers a stringent response in S. aureus (4, 95). For a selected set of SigB-dependent transcripts (SACOL0742, SACOL2484, sarA, sigB, and spoVG), induction upon mupirocin treatment was confirmed by Northern blotting. These analyses further revealed a steady increase in the transcription of these genes during the course of the experiment, suggesting continuous SigB activation (Fig. 6). Surprisingly, transcription of the sigB operon, which is under autoregulation by SigB, showed transient repression immediately after mupirocin stress. In addition to increased SigB activity, we observed strong repression of the rpoD gene encoding the housekeeping sigma factor SigA. A model for passive sigma factor regulation was proposed for E. coli under stringent conditions (70, 74). Core RNA polymerase that is no longer required for rRNA synthesis may become increasingly available for interaction with alternative sigma factors, thus increasing transcription at the respective target promoters. A similar mechanism may also account for increased SigB activity under stringent conditions in B. subtilis (39). However, at present, it remains to be elucidated if such passive regulation of sigma factor activity also applies to SigB in S. aureus or if an as yet undiscovered signal regulates SigB activity in S. aureus during mupirocin treatment.

(v) Toxin-antitoxin systems.

Furthermore, it has been proposed that chromosomally encoded toxin-antitoxin systems might be integrated into the regulatory networks that are important in coping with stress by downregulating vital cellular processes ranging from transcription and translation to replication (47, 86, 89, 96). Among the mupirocin-induced genes, we identified three toxin-antitoxin systems, SACOL2405-SACOL2404, SACOL2465-SACOL2464, and mazE-mazF (SACOL2059-SACOL2058, also termed pemI-pemK). Recent work demonstrated UACAU sequence-specific endoribonuclease activity for MazF (43, 122). For SACOL2404 and SACOL2464, encoding homologues of E. coli YoeB, a function in the inhibition of translation initiation was shown (121). It is tempting to speculate that the above-mentioned S. aureus toxin-antitoxin systems are active under stringent conditions and therefore contribute to the fitness of S. aureus following mupirocin treatment. Transcription of these systems was also shown to increase upon treatment with tetracycline and erythromycin (34) and thus may have an even more general function for survival in the presence of antibiotics that interfere with ribosome function.

Virulence.

A growing number of recent studies have established a close link between the stringent response and the capacity to cause disease for many pathogenic Gram-positive and Gram-negative bacteria. In general, the capacity to initiate a stringent response is crucial to sustain virulence. The precise link between the stringent response and virulence, however, seems to be unique for each pathogen (1, 18, 45, 49, 56, 69, 115). For S. aureus, it has been shown in different animal models that persistent activation (45), as well as permanent inhibition, of the stringent response (46) may not be beneficial and rather may lead to attenuated virulence. Consistent with this, we found a number of virulence factor genes (seb, fnbA, fnbB, epiG, epiE, SACOL1164, SACOL1169, sdrD, sdrC, SACOL2019, and efb) to be upregulated following a mupirocin challenge that might be stringently controlled. Of these, at least five have a function in adhesion of S. aureus to host tissue or serum proteins.

Moreover, induction of SACOL1891, encoding the RNAIII-activating protein TRAP, was almost 5-fold upregulated following mupirocin stress compared to the control conditions. Interestingly, the TRAP protein, in addition to the modulation of RNAIII activity, may have a function in oxidative-stress resistance (71). A particularly high level of induction of TRAP was also observed after diamide stress (117).

Furthermore, the staphylococcal enterotoxin B gene (seb) and the similarly upregulated SACOL2449, encoding a hypothetical drug transporter, possess putative CodY binding motifs. By lowering the stringency of the motif search, fnbA and the cap operon, also positively controlled, were identified as potential CodY target genes (98). In S. aureus, CodY was demonstrated to serve as a regulatory switch that matches the cellular metabolic state with the expression of virulence factors whose functions may be related to the recruitment of nutrients from the host environment (81, 98, 111).

For the more classical virulence regulators, we observed enhanced transcript levels for genes encoding members of the Sar family (sarA, sarS, and sarR) and of two-component systems (saeRS and arlRS). A recent study demonstrated that upregulation of sarA and sae mRNAs in the presence of mupirocin is independent of relA2 (rsh) but may be the consequence of transcript stabilization, as shown for sarA (46). The target genes of these virulence regulators are often coregulated by the cell density-dependent agr two-component system (26, 27, 102). Since the present study was done under condition where the agr system was not active, the effect of mupirocin on expression of agr-regulated genes cannot be conclusively addressed.

Genes with conserved induction under stringent conditions.

In order to identify key genes important for coping with stringent conditions, we compared our data with previous analyses done in S. aureus and B. subtilis (3, 40) (see Fig. S1 in the supplemental material). While the global repression of the energy-consuming cellular machineries required for growth and proliferation is a highly conserved feature of the stringent response, a large variation was observed for the expression of genes with functions in energy metabolism, as well as transport and binding processes. This may reflect differences between the stimulus inducing the stringent response and the growth media used in these studies. Interestingly, the largest variation was found for upregulated genes encoding hypothetical proteins (see Fig. S1 in the supplemental material), suggesting that many of them may have a role in the fine tuning of the cell's physiology in response to growth-limiting conditions.

Among the staphylococcal genes induced in our work and that of Anderson et al. (3), SACOL1753, SACOL1759, and SACOL2131 are of particular interest. The first two are members of the universal stress protein (Usp) family, which can be found in bacteria, archaea, and eukaryotes (73). In E. coli, the Usp proteins have multiple functions in adhesion, motility, stationary-phase survival, and oxidative-stress resistance (90, 94). For the M. tuberculosis Usp Rv2623 protein, a role in the establishment of chronic persistent infection was demonstrated (35). SACOL1759 expression increases under many additional stress conditions (44, 117) in S. aureus and thus may have a versatile function in stress resistance. In the case of SACOL1759, two distinct protein spots were identified, with an increased synthesis rate in the 2D gels. The second, more acidic spot (SACOL1759-2), especially, displayed a very high induction ratio at 30 min after mupirocin treatment, suggesting that the function of SACOL1759 is regulated at the posttranslational level by an as yet unidentified protein modification.

SACOL2131 (also known as MrgA) is a Dps-like protein. These proteins act as DNA-binding ferroxidases, thereby decreasing hydroxyl radical formation in the vicinity of DNA (55, 84). It has been demonstrated that SACOL2131 is under double control by PerR and Fur in S. aureus (88). Interestingly, we also observed increased expression of the PerR-regulated gene ahpC and the ferritin encoded by ftnA (SACOL1952) (64).

Extending our comparison to B. subtilis, besides the ilv-leu operon, SACOL0815 (yvyD), SACOL0413 (ydaF), and SACOL2379 (ydaG) were also induced in all three studies (the respective B. subtilis genes are shown in parentheses). SACOL0815 (yvyD) encodes a protein highly similar to the E. coli ribosome-associated translation inhibitor RaiA. RaiA decreases aminoacyl-tRNA affinity for the ribosomal A site following various physiological stresses to prevent miscoding and improve translation fidelity (2). In B. subtilis, yvyD is under double transcriptional control by the two alternative sigma factors SigB and SigH (36) and associates with the ribosome (J. Muntel and D. Becher, personal communication). SACOL0413 (ydaF) codes for a putative ribosomal protein-serine acetyltransferase. Acetylation of ribosomal protein L12 increases the stability of the stalk complex under conditions of stress in E. coli (50). Indeed, our DNA microarray experiment identified 11 predicted acetyltransferases (including 7 from the GNAT family) as regulated by mupirocin, suggesting that protein modification by acetylation may be an important regulatory strategy during adaptation to stringent conditions.

Finally, sequence analysis of SACOL2379 (ydaG) shows homology to the FMN-binding domain present in pyridoxamine 5′-phosphate oxidases. YdaG is one of the few proteins common to the SigB regulons of S. aureus and B. subtilis (95). The function of YdaG, however, remains elusive.

The identification of marker genes and proteins, specific for classes of antibiotics with well-defined modes of action, has proven to be a valuable approach for the elucidation of the molecular targets of so far uncharacterized antimicrobial compounds (8, 42). For example, it has been demonstrated that strong upregulation of the target aminoacyl-tRNA synthetases and the respective amino acid biosynthesis pathways is a common feature of aminoacyl-tRNA synthetase inhibitors (8, 13, 42). As a proof of principle, Freiberg and colleagues identified a phenylthiazolylurea derivative as a novel phenylalanyl-tRNA synthetase inhibitor using DNA microarray-based reference expression profiles generated for a set of 14 well-characterized antibiotics (42). Interestingly, in the model organism B. subtilis, the expression of SpoVG, YvyD, and Dps, which was also upregulated by mupirocin in our study, was positively correlated with the treatment of different aminoacyl-tRNA synthetase inhibitors or the artificial depletion of aminoacyl-tRNA synthetases using conditional mutants (8, 13). These observations further support our conclusion that these genes may have important functions in the process of adaptation to amino acid limitation and hence the stringent response.

Conclusion.

In summary, mupirocin treatment elicits a complex and comprehensive response in S. aureus that shows a clear link to the stringent response. In the absence of a mutant defective in the synthesis of (p)ppGpp, the main effector of the stringent response, however, it is not possible to clearly distinguish between stringent regulated genes and genes regulated by additional mechanisms. Global regulators, such as CodY, SigB, and chromosomally encoded toxin/antitoxin modules, likely contribute to the observed response. In the presence of mupirocin, derepression of CodY-controlled genes may be triggered by a drop in the GTP level rather than in the pool of BCAAs. Moreover, comparison to similar studies showed that growth conditions have a significant impact in individually shaping the response of S. aureus to mupirocin. Conserved induction of genes in S. aureus and B. subtilis (e.g., SACOL0815 [yvyD], SACOL0413 [ydaF], and SACOL2379 [ydaG]) following stringent conditions may point to important roles in the adaptation process. Furthermore, mupirocin clearly alters virulence gene expression in S. aureus. Targeting these genes may increase sensitivity to mupirocin and ultimately improve therapy and control of S. aureus infections.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This work was supported by the DFG (SFB/Transregio 34, Forschergruppe 585, and Graduiertenkolleg GRK 840) and the BMBF (Competence Network PathoGenoMik and ERANET Pathogenomics Network, sncRNAomics project).

We thank Decodon GmbH for the Delta 2D 3.4. gel analysis software and Dirk Albrecht for protein identification by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS).

Footnotes

Published ahead of print 21 November 2011

Supplemental material for this article may be found at http://aac.asm.org/.

REFERENCES

  • 1. Abranches J, et al. 2009. The molecular alarmone (p)ppGpp mediates stress responses, vancomycin tolerance, and virulence in Enterococcus faecalis. J. Bacteriol. 191: 2248–2256 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Agafonov DE, Spirin AS. 2004. The ribosome-associated inhibitor A reduces translation errors. Biochem. Biophys. Res. Commun. 320: 354–358 [DOI] [PubMed] [Google Scholar]
  • 3. Anderson KL, et al. 2006. Characterization of the Staphylococcus aureus heat shock, cold shock, stringent, and SOS responses and their effects on log-phase mRNA turnover. J. Bacteriol. 188: 6739–6756 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Anderson KL, et al. 2010. Characterizing the effects of inorganic acid and alkaline shock on the Staphylococcus aureus transcriptome and messenger RNA turnover. FEMS Immunol. Med. Microbiol. 60: 208–250 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Artsimovitch I, et al. 2004. Structural basis for transcription regulation by alarmone ppGpp. Cell 117: 299–310 [DOI] [PubMed] [Google Scholar]
  • 6. Baird D, Coia J. 1987. Mupirocin-resistant Staphylococcus aureus. Lancet ii: 387–388 [PubMed] [Google Scholar]
  • 7. Baldi P, Long AD. 2001. A Bayesian framework for the analysis of microarray expression data: regularized t-test and statistical inferences of gene changes. Bioinformatics 17: 509–519 [DOI] [PubMed] [Google Scholar]
  • 8. Bandow JE, Brötz H, Leichert LI, Labischinski H, Hecker M. 2003. Proteomic approach to understanding antibiotic action. Antimicrob. Agents Chemother. 47: 948–955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Becher D, et al. 2009. A proteomic view of an important human pathogen—towards the quantification of the entire Staphylococcus aureus proteome. PLoS One 4: e8176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Belitsky BR, Sonenshein AL. 2011. Contributions of multiple binding sites and effector-independent binding to CodY-mediated regulation in Bacillus subtilis. J. Bacteriol. 193: 473–484 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Bennett HJ, et al. 2007. Characterization of relA and codY mutants of Listeria monocytogenes: identification of the CodY regulon and its role in virulence. Mol. Microbiol. 63: 1453–1467 [DOI] [PubMed] [Google Scholar]
  • 12. Bernhardt J, Büttner K, Scharf C, Hecker M. 1999. Dual channel imaging of two-dimensional electropherograms in Bacillus subtilis. Electrophoresis 20: 2225–2240 [DOI] [PubMed] [Google Scholar]
  • 13. Beyer D, et al. 2004. New class of bacterial phenylalanyl-tRNA synthetase inhibitors with high potency and broad-spectrum activity. Antimicrob. Agents Chemother. 48: 525–532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Bischoff M, et al. 2004. Microarray-based analysis of the Staphylococcus aureus sigmaB regulon. J. Bacteriol. 186: 4085–4099 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Blum H, Beier H, Gross HJ. 1987. Improved silver staining of plant proteins, RNA and DNA in polyacrylamide gels. Electrophoresis 8: 93–99 [Google Scholar]
  • 16. Bode LG, et al. 2010. Preventing surgical-site infections in nasal carriers of Staphylococcus aureus. N. Engl. J. Med. 362: 9–17 [DOI] [PubMed] [Google Scholar]
  • 17. Brinsmade SR, Kleijn RJ, Sauer U, Sonenshein AL. 2010. Regulation of CodY activity through modulation of intracellular branched-chain amino acid pools. J. Bacteriol. 192: 6357–6368 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Bugrysheva JV, Bryksin AV, Godfrey HP, Cabello FC. 2005. Borrelia burgdorferi rel is responsible for generation of guanosine-3′-diphosphate-5′-triphosphate and growth control. Infect. Immun. 73: 4972–4981 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Candiano G, et al. 2004. Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis. Electrophoresis 25: 1327–1333 [DOI] [PubMed] [Google Scholar]
  • 20. Cashel M, Gallant J. 1969. Two compounds implicated in the function of the RC gene of Escherichia coli. Nature 221: 838–841 [DOI] [PubMed] [Google Scholar]
  • 21. Cashel M, Gentry DR, Hernandez VJ, Vinella D. 1996. The stringent response, p 1458–1496 In Neidhardt F. C. (ed), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed, vol 1 ASM Press, Washington, DC [Google Scholar]
  • 22. Cassels R, Oliva B, Knowles D. 1995. Occurrence of the regulatory nucleotides ppGpp and pppGpp following induction of the stringent response in staphylococci. J. Bacteriol. 177: 5161–5165 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Chain EB, Mellows G. 1977. Pseudomonic acid. Part 1. The structure of pseudomonic acid A, a novel antibiotic produced by Pseudomonas fluorescens. J. Chem. Soc. Perkin 1: 294–309 [PubMed] [Google Scholar]
  • 24. Charbonnier Y, et al. 2005. A generic approach for the design of whole-genome oligoarrays, validated for genomotyping, deletion mapping and gene expression analysis on Staphylococcus aureus. BMC Genomics 6: 95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Chatterji D, Fujita N, Ishihama A. 1998. The mediator for stringent control, ppGpp, binds to the β-subunit of Escherichia coli RNA polymerase. Genes Cells 3: 279–287 [DOI] [PubMed] [Google Scholar]
  • 26. Chien Y, Cheung AL. 1998. Molecular interactions between two global regulators, sar and agr, in Staphylococcus aureus. J. Biol. Chem. 273: 2645–2652 [DOI] [PubMed] [Google Scholar]
  • 27. Chien Y, Manna AC, Projan SJ, Cheung AL. 1999. SarA, a global regulator of virulence determinants in Staphylococcus aureus, binds to a conserved motif essential for sar-dependent gene regulation. J. Biol. Chem. 274: 37169–37176 [DOI] [PubMed] [Google Scholar]
  • 28. Coia JE, et al. 2006. Guidelines for the control and prevention of meticillin-resistant Staphylococcus aureus (MRSA) in healthcare facilities. J. Hosp. Infect. 63(Suppl. 1): S1–S44 [DOI] [PubMed] [Google Scholar]
  • 29. Crosse AM, Greenway DL, England RR. 2000. Accumulation of ppGpp and ppGp in Staphylococcus aureus 8325-4 following nutrient starvation. Lett. Appl. Microbiol. 31: 332–337 [DOI] [PubMed] [Google Scholar]
  • 30. Dalebroux ZD, Svensson SL, Gaynor EC, Swanson MS. 2010. ppGpp conjures bacterial virulence. Microbiol. Mol. Biol. Rev. 74: 171–199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. den Hengst CD, et al. 2005. The Lactococcus lactis CodY regulon: identification of a conserved cis-regulatory element. J. Biol. Chem. 280: 34332–34342 [DOI] [PubMed] [Google Scholar]
  • 32. Deora R, Tseng T, Misra TK. 1997. Alternative transcription factor σSB of Staphylococcus aureus: characterization and role in transcription of the global regulatory locus sar. J. Bacteriol. 179: 6355–6359 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Dineen SS, Villapakkam AC, Nordman JT, Sonenshein AL. 2007. Repression of Clostridium difficile toxin gene expression by CodY. Mol. Microbiol. 66: 206–219 [DOI] [PubMed] [Google Scholar]
  • 34. Donegan NP, Cheung AL. 2009. Regulation of the mazEF toxin-antitoxin module in Staphylococcus aureus and its impact on sigB expression. J. Bacteriol. 191: 2795–2805 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Drumm JE, et al. 2009. Mycobacterium tuberculosis universal stress protein Rv2623 regulates bacillary growth by ATP-binding: requirement for establishing chronic persistent infection. PLoS Pathog. 5: e1000460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Drzewiecki K, Eymann C, Mittenhuber G, Hecker M. 1998. The yvyD gene of Bacillus subtilis is under dual control of σB and σH. J. Bacteriol. 180: 6674–6680 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Eltringham I. 1997. Mupirocin resistance and methicillin-resistant Staphylococcus aureus (MRSA). J. Hosp. Infect. 35: 1–8 [DOI] [PubMed] [Google Scholar]
  • 38. Engelmann S, Hecker M. 2008. Proteomic analysis to investigate regulatory networks in Staphylococcus aureus. Methods Mol. Biol. 431: 25–45 [DOI] [PubMed] [Google Scholar]
  • 39. Eymann C, Hecker M. 2001. Induction of sigma(B)-dependent general stress genes by amino acid starvation in a spo0H mutant of Bacillus subtilis. FEMS Microbiol. Lett. 199: 221–227 [DOI] [PubMed] [Google Scholar]
  • 40. Eymann C, Homuth G, Scharf C, Hecker M. 2002. Bacillus subtilis functional genomics: global characterization of the stringent response by proteome and transcriptome analysis. J. Bacteriol. 184: 2500–2520 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Fink PS. 1993. Biosynthesis of the branched-chain amino acids, p 307–317 In Sonenshine A. L., Hoch J. A., Losick R. (ed), Bacillus subtilis and other gram-positive bacteria. American Society for Microbiology, Washington, DC [Google Scholar]
  • 42. Freiberg C, Fischer HP, Brunner NA. 2005. Discovering the mechanism of action of novel antibacterial agents through transcriptional profiling of conditional mutants. Antimicrob. Agents Chemother. 49: 749–759 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Fu Z, Donegan NP, Memmi G, Cheung AL. 2007. Characterization of MazFSa, an endoribonuclease from Staphylococcus aureus. J. Bacteriol. 189: 8871–8879 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Fuchs S, Pané-Farré J, Kohler C, Hecker M, Engelmann S. 2007. Anaerobic gene expression in Staphylococcus aureus. J. Bacteriol. 189: 4275–4289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Gao W, et al. 2010. Two novel point mutations in clinical Staphylococcus aureus reduce linezolid susceptibility and switch on the stringent response to promote persistent infection. PLoS Pathog. 6: e1000944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Geiger T, et al. 2010. Role of the (p)ppGpp synthase RSH, a RelA/SpoT homolog, in stringent response and virulence of Staphylococcus aureus. Infect. Immun. 78: 1873–1883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Gerdes K, Christensen SK, Løbner-Olesen A. 2005. Prokaryotic toxin-antitoxin stress response loci. Nat. Rev. Microbiol. 3: 371–382 [DOI] [PubMed] [Google Scholar]
  • 48. Gertz S, et al. 1999. Regulation of σB-dependent transcription of sigB and asp23 in two different Staphylococcus aureus strains. Mol. Gen. Genet. 261: 558–566 [DOI] [PubMed] [Google Scholar]
  • 49. Godfrey HP, Bugrysheva JV, Cabello FC. 2002. The role of the stringent response in the pathogenesis of bacterial infections. Trends Microbiol. 10: 349–351 [DOI] [PubMed] [Google Scholar]
  • 50. Gordiyenko Y, Deroo S, Zhou M, Videler H, Robinson CV. 2008. Acetylation of L12 increases interactions in the Escherichia coli ribosomal stalk complex. J. Mol. Biol. 380: 404–414 [DOI] [PubMed] [Google Scholar]
  • 51. Greenwood RC, Gentry DR. 2002. The effect of antibiotic treatment on the intracellular nucleotide pools of Staphylococcus aureus. FEMS Microbiol. Lett. 208: 203–206 [DOI] [PubMed] [Google Scholar]
  • 52. Grundy FJ, et al. 1997. The Staphylococcus aureus ileS gene, encoding isoleucyl-tRNA synthetase, is a member of the T-box family. J. Bacteriol. 179: 3767–3772 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Grundy FJ, Henkin TM. 2003. The T box and S box transcription termination control systems. Front. Biosci. 8: d20–d31 [DOI] [PubMed] [Google Scholar]
  • 54. Guedon E, Serror P, Ehrlich SD, Renault P, Delorme C. 2001. Pleiotropic transcriptional repressor CodY senses the intracellular pool of branched-chain amino acids in Lactococcus lactis. Mol. Microbiol. 40: 1227–1239 [DOI] [PubMed] [Google Scholar]
  • 55. Haikarainen T, Papageorgiou AC. 2010. Dps-like proteins: structural and functional insights into a versatile protein family. Cell. Mol. Life Sci. 67: 341–351 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Haralalka S, Nandi S, Bhadra RK. 2003. Mutation in the relA gene of Vibrio cholerae affects in vitro and in vivo expression of virulence factors. J. Bacteriol. 185: 4672–4682 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Haseltine WA, Block R. 1973. Synthesis of guanosine tetra- and pentaphosphate requires the presence of a codon-specific, uncharged transfer ribonucleic acid in the acceptor site of ribosomes. Proc. Natl. Acad. Sci. U. S. A. 70: 1564–1568 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Hatfield GW, Ray WJ, Jr, Umbarger HE. 1970. Threonine deaminase from Bacillus subtilis. 3. Pre-steady state kinetic properties. J. Biol. Chem. 245: 1748–1753 [PubMed] [Google Scholar]
  • 59. Hecker M, Richter A, Schroeter A, Wölfel L, Mach F. 1987. Synthesis of heat shock proteins following amino acid or oxygen limitation in Bacillus subtilis relA+ and relA strains. Z. Naturforsch. C. 42: 941–947 [PubMed] [Google Scholar]
  • 60. Hecker M, Schroeter A, Trader K, Mach F. 1986. Role of relA mutation in the survival of amino acid-starved Escherichia coli. Arch. Microbiol. 143: 400–402 [DOI] [PubMed] [Google Scholar]
  • 61. Hendriksen WT, et al. 2008. CodY of Streptococcus pneumoniae: link between nutritional gene regulation and colonization. J. Bacteriol. 190: 590–601 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Homerova D, Bischoff M, Dumolin A, Kormanec J. 2004. Optimization of a two-plasmid system for the identification of promoters recognized by RNA polymerase containing Staphylococcus aureus alternative sigma factor σB. FEMS Microbiol. Lett. 232: 173–179 [DOI] [PubMed] [Google Scholar]
  • 63. Horsburgh MJ, et al. 2002. σB modulates virulence determinant expression and stress resistance: characterization of a functional rsbU strain derived from Staphylococcus aureus 8325-4. J. Bacteriol. 184: 5457–5467 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Horsburgh MJ, Clements MO, Crossley H, Ingham E, Foster SJ. 2001. PerR controls oxidative stress resistance and iron storage proteins and is required for virulence in Staphylococcus aureus. Infect. Immun. 69: 3744–3754 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Hsueh YH, Somers EB, Wong AC. 2008. Characterization of the codY gene and its influence on biofilm formation in Bacillus cereus. Arch. Microbiol. 189: 557–568 [DOI] [PubMed] [Google Scholar]
  • 66. Hughes J, Mellows G. 1978. Inhibition of isoleucyl-transfer ribonucleic acid synthetase in Escherichia coli by pseudomonic acid. Biochem. J. 176: 305–318 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Hughes J, Mellows G. 1980. Interaction of pseudomonic acid A with Escherichia coli B isoleucyl-tRNA synthetase. Biochem. J. 191: 209–219 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Jain V, Kumar M, Chatterji D. 2006. ppGpp: stringent response and survival. J. Microbiol. 44: 1–10 [PubMed] [Google Scholar]
  • 69. Jeong JH, et al. 2008. Salmonella enterica serovar gallinarum requires ppGpp for internalization and survival in animal cells. J. Bacteriol. 190: 6340–6350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Jishage M, Kvint K, Shingler V, Nyström T. 2002. Regulation of σ factor competition by the alarmone ppGpp. Genes Dev. 16: 1260–1270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Kiran MD, Balaban N. 2009. TRAP plays a role in stress response in Staphylococcus aureus. Int. J. Artif. Organs 32: 592–599 [DOI] [PubMed] [Google Scholar]
  • 72. Krasny L, Gourse RL. 2004. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation. EMBO J. 23: 4473–4483 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Kvint K, Nachin L, Diez A, Nyström T. 2003. The bacterial universal stress protein: function and regulation. Curr. Opin. Microbiol. 6: 140–145 [DOI] [PubMed] [Google Scholar]
  • 74. Laurie AD, et al. 2003. The role of the alarmone (p)ppGpp in σN competition for core RNA polymerase. J. Biol. Chem. 278: 1494–1503 [DOI] [PubMed] [Google Scholar]
  • 75. Lee AS, et al. 2011. Trends in mupirocin resistance in meticillin-resistant Staphylococcus aureus and mupirocin consumption at a tertiary care hospital. J. Hosp. Infect. 77: 360–362 [DOI] [PubMed] [Google Scholar]
  • 76. Lemos JA, Lin VK, Nascimento MM, Abranches J, Burne RA. 2007. Three gene products govern (p)ppGpp production by Streptococcus mutans. Mol. Microbiol. 65: 1568–1581 [DOI] [PubMed] [Google Scholar]
  • 77. Lemos JA, Nascimento MM, Lin VK, Abranches J, Burne RA. 2008. Global regulation by (p) ppGpp and CodY in Streptococcus mutans. J. Bacteriol. 190: 5291–5299 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Liebeke M, Brözel VS, Hecker M, Lalk M. 2009. Chemical characterization of soil extract as growth media for the ecophysiological study of bacteria. Appl. Microbiol. Biotechnol. 83: 161–173 [DOI] [PubMed] [Google Scholar]
  • 79. Liebeke M, Meyer H, Donat S, Ohlsen K, Lalk M. 2010. A metabolomic view of Staphylococcus aureus and its ser/thr kinase and phosphatase deletion mutants: involvement in cell wall biosynthesis. Chem. Biol. 17: 820–830 [DOI] [PubMed] [Google Scholar]
  • 80. Majerczyk CD, et al. 2010. Direct targets of CodY in Staphylococcus aureus. J. Bacteriol. 192: 2861–2877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Majerczyk CD, et al. 2008. Staphylococcus aureus CodY negatively regulates virulence gene expression. J. Bacteriol. 190: 2257–2265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82. Majumdar D, Avissar YJ, Wyche JH. 1991. Simultaneous and rapid isolation of bacterial and eukaryotic DNA and RNA: a new approach for isolating DNA. Biotechniques 11: 94–101 [PubMed] [Google Scholar]
  • 83. Manna AC, Bayer MG, Cheung AL. 1998. Transcriptional analysis of different promoters in the sar locus in Staphylococcus aureus. J. Bacteriol. 180: 3828–3836 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84. Martinez A, Kolter R. 1997. Protection of DNA during oxidative stress by the nonspecific DNA-binding protein Dps. J. Bacteriol. 179: 5188–5194 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85. Meyer H, Liebeke M, Lalk M. 2010. A protocol for the investigation of the intracellular Staphylococcus aureus metabolome. Anal. Biochem. 401: 250–259 [DOI] [PubMed] [Google Scholar]
  • 86. Mittenhuber G. 1999. Occurrence of mazEF-like antitoxin/toxin systems in bacteria. J. Mol. Microbiol. Biotechnol. 1: 295–302 [PubMed] [Google Scholar]
  • 87. Molle V, et al. 2003. Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. J. Bacteriol. 185: 1911–1922 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88. Morrissey JA, Cockayne A, Brummell K, Williams P. 2004. The staphylococcal ferritins are differentially regulated in response to iron and manganese and via PerR and Fur. Infect. Immun. 72: 972–979 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89. Muñoz-Gómez AJ, Santos-Sierra S, Berzal-Herranz A, Lemonnier M, Díaz-Orejas R. 2004. Insights into the specificity of RNA cleavage by the Escherichia coli MazF toxin. FEBS Lett. 567: 316–320 [DOI] [PubMed] [Google Scholar]
  • 90. Nachin L, Nannmark U, Nyström T. 2005. Differential roles of the universal stress proteins of Escherichia coli in oxidative stress resistance, adhesion, and motility. J. Bacteriol. 187: 6265–6272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91. Nakama T, Nureki O, Yokoyama S. 2001. Structural basis for the recognition of isoleucyl-adenylate and an antibiotic, mupirocin, by isoleucyl-tRNA synthetase. J. Biol. Chem. 276: 47387–47393 [DOI] [PubMed] [Google Scholar]
  • 92. Nanamiya H, et al. 2008. Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis. Mol. Microbiol. 67: 291–304 [DOI] [PubMed] [Google Scholar]
  • 93. Neidhardt FC. 1999. Bacterial growth: constant obsession with dN/dt. J. Bacteriol. 181: 7405–7408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94. Nyström T, Neidhardt FC. 1994. Expression and role of the universal stress protein, UspA, of Escherichia coli during growth arrest. Mol. Microbiol. 11: 537–544 [DOI] [PubMed] [Google Scholar]
  • 95. Pané-Farré J, Jonas B, Förstner K, Engelmann S, Hecker M. 2006. The σB regulon in Staphylococcus aureus and its regulation. Int. J. Med. Microbiol. 296: 237–258 [DOI] [PubMed] [Google Scholar]
  • 96. Pedersen K, et al. 2003. The bacterial toxin RelE displays codon-specific cleavage of mRNAs in the ribosomal A site. Cell 112: 131–140 [DOI] [PubMed] [Google Scholar]
  • 97. Petranovic D, et al. 2004. Intracellular effectors regulating the activity of the Lactococcus lactis CodY pleiotropic transcription regulator. Mol. Microbiol. 53: 613–621 [DOI] [PubMed] [Google Scholar]
  • 98. Pohl K, et al. 2009. CodY in Staphylococcus aureus: a regulatory link between metabolism and virulence gene expression. J. Bacteriol. 191: 2953–2963 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99. Potrykus K, Cashel M. 2008. (p)ppGpp: still magical? Annu. Rev. Microbiol. 62: 35–51 [DOI] [PubMed] [Google Scholar]
  • 100. Rahman M, Noble WC, Cookson B. 1987. Mupirocin-resistant Staphylococcus aureus. Lancet ii: 387. [DOI] [PubMed] [Google Scholar]
  • 101. Ratnayake-Lecamwasam M, Serror P, Wong KW, Sonenshein AL. 2001. Bacillus subtilis CodY represses early-stationary-phase genes by sensing GTP levels. Genes Dev. 15: 1093–1103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102. Rogasch K, et al. 2006. Influence of the two-component system SaeRS on global gene expression in two different Staphylococcus aureus strains. J. Bacteriol. 188: 7742–7758 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103. Ryals J, Little R, Bremer H. 1982. Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate. J. Bacteriol. 151: 1261–1268 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104. Shafer WM, Iandolo JJ. 1979. Genetics of staphylococcal enterotoxin B in methicillin-resistant isolates of Staphylococcus aureus. Infect. Immun. 25: 902–911 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105. Shivers RP, Sonenshein AL. 2004. Activation of the Bacillus subtilis global regulator CodY by direct interaction with branched-chain amino acids. Mol. Microbiol. 53: 599–611 [DOI] [PubMed] [Google Scholar]
  • 106. Shulman A, et al. 2008. Allosteric regulation of Bacillus subtilis threonine deaminase, a biosynthetic threonine deaminase with a single regulatory domain. Biochemistry 47: 11783–11792 [DOI] [PubMed] [Google Scholar]
  • 107. Somerville GA, Proctor RA. 2009. At the crossroads of bacterial metabolism and virulence factor synthesis in staphylococci. Microbiol. Mol. Biol. Rev. 73: 233–248 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 108. Sonenshein AL. 2005. CodY, a global regulator of stationary phase and virulence in Gram-positive bacteria. Curr. Opin. Microbiol. 8: 203–207 [DOI] [PubMed] [Google Scholar]
  • 109. Srivatsan A, Wang JD. 2008. Control of bacterial transcription, translation and replication by (p)ppGpp. Curr. Opin. Microbiol. 11: 100–105 [DOI] [PubMed] [Google Scholar]
  • 110. Stent GS, Brenner S. 1961. A genetic locus for the regulation of ribonucleic acid synthesis. Proc. Natl. Acad. Sci. U. S. A. 47: 2005–2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 111. Stenz L, et al. 2011. The CodY pleiotropic repressor controls virulence in gram-positive pathogens. FEMS Immunol. Med. Microbiol. 62: 123–139 [DOI] [PubMed] [Google Scholar]
  • 112. Thomas CM, Hothersall J, Willis CL, Simpson TJ. 2010. Resistance to and synthesis of the antibiotic mupirocin. Nat. Rev. Microbiol. 8: 281–289 [DOI] [PubMed] [Google Scholar]
  • 113. Toulokhonov II, Shulgina I, Hernandez VJ. 2001. Binding of the transcription effector ppGpp to Escherichia coli RNA polymerase is allosteric, modular, and occurs near the N terminus of the β′-subunit. J. Biol. Chem. 276: 1220–1225 [DOI] [PubMed] [Google Scholar]
  • 114. Travers AA. 1980. Promoter sequence for stringent control of bacterial ribonucleic acid synthesis. J. Bacteriol. 141: 973–976 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 115. Warner DF, Mizrahi V. 2006. Tuberculosis chemotherapy: the influence of bacillary stress and damage response pathways on drug efficacy. Clin. Microbiol. Rev. 19: 558–570 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 116. Wetzstein M, et al. 1992. Cloning, sequencing, and molecular analysis of the dnaK locus from Bacillus subtilis. J. Bacteriol. 174: 3300–3310 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117. Wolf C, et al. 2008. Proteomic analysis of antioxidant strategies of Staphylococcus aureus: diverse responses to different oxidants. Proteomics 8: 3139–3153 [DOI] [PubMed] [Google Scholar]
  • 118. Wolz C, Geiger T, Goerke C. 2010. The synthesis and function of the alarmone (p)ppGpp in firmicutes. Int. J. Med. Microbiol. 300: 142–147 [DOI] [PubMed] [Google Scholar]
  • 119. Wuite J, et al. 1983. Pseudomonic acid: a new topical antimicrobial agent. Lancet ii: 394. [DOI] [PubMed] [Google Scholar]
  • 120. Yanagisawa T, Lee JT, Wu HC, Kawakami M. 1994. Relationship of protein structure of isoleucyl-tRNA synthetase with pseudomonic acid resistance of Escherichia coli. A proposed mode of action of pseudomonic acid as an inhibitor of isoleucyl-tRNA synthetase. J. Biol. Chem. 269: 24304–24309 [PubMed] [Google Scholar]
  • 121. Yoshizumi S, et al. 2009. Staphylococcus aureus YoeB homologues inhibit translation initiation. J. Bacteriol. 191: 5868–5872 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122. Zhu L, et al. 2009. Staphylococcus aureus MazF specifically cleaves a pentad sequence, UACAU, which is unusually abundant in the mRNA for pathogenic adhesive factor SraP. J. Bacteriol. 191: 3248–3255 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 123. Ziebandt AK, et al. 2001. Extracellular proteins of Staphylococcus aureus and the role of SarA and σB. Proteomics 1: 480–493 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material
supp_56.2.787_FigS1.pdf (31.8KB, pdf)

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES