Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2012 Feb;80(2):483–492. doi: 10.1128/IAI.05674-11

OmpT Outer Membrane Proteases of Enterohemorrhagic and Enteropathogenic Escherichia coli Contribute Differently to the Degradation of Human LL-37

Jenny-Lee Thomassin a, John R Brannon a, Bernard F Gibbs b, Samantha Gruenheid a,✉, Hervé Le Moual a,c,✉
Editor: B A McCormick
PMCID: PMC3264287  PMID: 22144482

Abstract

Enterohemorrhagic Escherichia coli (EHEC) and enteropathogenic E. coli (EPEC) are food-borne pathogens that cause serious diarrheal diseases. To colonize the human intestine, these pathogens must overcome innate immune defenses such as antimicrobial peptides (AMPs). Bacterial pathogens have evolved various mechanisms to resist killing by AMPs, including proteolytic degradation of AMPs. To examine the ability of the EHEC and EPEC OmpT outer membrane (OM) proteases to degrade α-helical AMPs, ompT deletion mutants were generated. Determination of MICs of various AMPs revealed that both mutant strains are more susceptible than their wild-type counterparts to α-helical AMPs, although to different extents. Time course assays monitoring the degradation of LL-37 and C18G showed that EHEC cells degraded both AMPs faster than EPEC cells in an OmpT-dependent manner. Mass spectrometry analyses of proteolytic fragments showed that EHEC OmpT cleaves LL-37 at dibasic sites. The superior protection provided by EHEC OmpT compared to EPEC OmpT against α-helical AMPs was due to higher expression of the ompT gene and, in turn, higher levels of the OmpT protein in EHEC. Fusion of the EPEC ompT promoter to the EHEC ompT open reading frame resulted in decreased OmpT expression, indicating that transcriptional regulation of ompT is different in EHEC and EPEC. We hypothesize that the different contributions of EHEC and EPEC OmpT to the degradation and inactivation of LL-37 may be due to their adaptation to their respective niches within the host, the colon and small intestine, respectively, where the environmental cues and abundance of AMPs are different.

INTRODUCTION

Antimicrobial peptides (AMPs) are small cationic peptides secreted into the extracellular environment by epithelial cells. AMPs have both bactericidal and immunomodulatory properties, making them key players in the innate immune response to infection. AMPs are known to bind to the anionic cell membrane and lyse bacterial cells by forming pores. They also bridge innate and adaptive immunity by recruiting immune cells to the site of infection. On the basis of their three-dimensional structures and disulfide bridge patterns, AMPs are divided into distinct families, the cathelicidins and the α- and β-defensins (18). LL-37 is the sole human AMP of the cathelicidin family. It consists of 37 amino acids, including 11 positive residues, and forms an amphipathic α helix when bound to membranes (2). LL-37 is synthesized as the precursor human cationic antimicrobial protein 18 (hCAP18) that is processed into the biologically active peptide by the serine protease proteinase 3. LL-37 is expressed by different cell types, including neutrophils, bone marrow cells, and epithelial cells of the lung and intestine. The distribution of LL-37 expression along the gastrointestinal tract is uneven, being limited to surface epithelial cells of the stomach and colon (14, 15). In addition to its antimicrobial activity, LL-37 has a broad range of immunomodulatory functions (30).

Bacterial pathogens have evolved different mechanisms to resist the killing action of AMPs (32). Gram-negative and Gram-positive bacteria modify their surface lipopolysaccharides (LPSs) and lipoteichoic acids, respectively, by adding positively charged moieties that prevent the electrostatic interaction of AMPs with bacterial surfaces. Efflux pumps can export AMPs before they damage the cytoplasmic membrane. AMPs can also be proteolytically degraded and inactivated by surface or secreted proteases. Omptins are proteases found at the outer membrane (OM) of various Gram-negative pathogens of the Enterobacteriaceae family (13, 16, 21). Omptins share high amino acid sequence identity (45 to 80%) and adopt a conserved β-barrel fold, with the active site facing the extracellular environment (41). Omptins possess a unique active site that combines elements of both serine and aspartate proteases, and interaction with LPS is critical for activity (8). Omptins impact bacterial virulence by degrading or processing a number of host proteins or peptides. For example, Yersinia pestis Pla and Salmonella enterica PgtE control human plasmin activity by processing the proenzyme plasminogen and inactivating the plasmin inhibitor α2-antiplasmin and plasminogen activator inhibitor 1 (PAI-1) (12, 22, 23). Pla and PgtE were also shown to cleave serum components and affect complement activity (33, 38). Several omptins, including OmpT, Pla, and PgtE, have been associated with the degradation of AMPs. Escherichia coli K-12 OmpT was reported to efficiently degrade the AMP protamine (39). Other studies have shown that PgtE and Pla cleave α-helical AMPs such as human LL-37 and the synthetic α-helical peptide C18G, whose sequence has been optimized for maximal antibacterial activity (4, 10, 11).

Enterohemorrhagic Escherichia coli (EHEC) and enteropathogenic E. coli (EPEC) are two genetically related bacteria that cause severe diarrheal diseases in humans (28). Together with the mouse enteric pathogen Citrobacter rodentium, EHEC and EPEC belong to a group of pathogens that cause histopathological lesions known as attaching and effacing (A/E) lesions. A/E lesions are characterized by the localized effacement of intestinal microvilli, the intimate attachment of bacteria to the enterocyte plasma membrane, and the formation of pedestal-like structures at sites of bacterial attachment. All three pathogens carry a pathogenicity island known as the locus of enterocyte effacement (LEE) that is required for the formation of A/E lesions. We have recently shown that CroP, the omptin of Citrobacter rodentium, degrades α-helical AMPs, including the mouse cathelicidin mCRAMP (24). CroP-mediated degradation of AMPs occurred before they reached the periplasmic space and triggered a PhoPQ-mediated adaptive response, resulting in AMP resistance. Since CroP is 74% identical to E. coli OmpT, we hypothesized that OmpT would confer on pathogenic E. coli (EHEC and EPEC) resistance against human LL-37 and other α-helical AMPs. In this study, we show that the EHEC and EPEC OmpT proteins contribute differently to the degradation of α-helical AMPs. EHEC OmpT readily degraded and inactivated AMPs to promote bacterial survival, whereas EPEC OmpT was found to have a more marginal role in AMP degradation.

MATERIALS AND METHODS

Media and reagents.

Bacteria were grown at 37°C with aeration in Luria-Bertani (LB) broth or N-minimal medium (29) adjusted to pH 7.5 and supplemented with 0.2% glucose and 1 mM MgCl2. When appropriate, media were supplemented with streptomycin (50 μg/ml), chloramphenicol (30 μg/ml), or dl-diaminopimelic acid (DAP; 50 μg/ml). C18G, LL-37, and peptides corresponding to LL-37 cleavage products were synthesized with a purity of >85% (BioChemia). Polymyxin B (PMB) was purchased from Sigma. AMPs were reconstituted in sterile deionized water. Restriction enzymes and Phusion DNA polymerase were from New England BioLabs.

Construction of EHEC and EPEC ompT deletion mutants.

The bacterial strains and plasmids used in this study are listed in Table 1. DNA purification, cloning, and transformation were performed according to standard procedures (36). The EHEC and EPEC ΔompT deletion mutants were generated by sacB gene-based allelic exchange (6). Genomic DNA from EHEC or EPEC was used as a template to PCR amplify the upstream (primer pair EH1/EH2 or EP1/EP2; Table 2) and downstream (primer pair EH3/EH4 or EP3/EP4) sequences of the ompT genes. The resultant PCR products were treated with KpnI and ligated together. The ligation products were used as the DNA template in a PCR using primer pairs EH1/EH4 and EP1/EP4 for EHEC and EPEC, respectively. PCR fragments were gel purified, digested with the appropriate restriction enzymes (Table 2), and ligated into pRE112 cleaved with XbaI and SacI. Resultant plasmids pΔEHompT and pΔEPompT were verified by sequencing. The pΔEHompT construct was conjugated into wild-type EHEC using E. coli χ7213 as the donor strain. Integration of the plasmid into the chromosome was selected for by plating bacteria on LB agar supplemented with chloramphenicol. The pΔEPompT construct was introduced into wild-type EPEC by conjugation using E. coli Sm10 (λ Pir) as the donor strain; integration of the plasmid into the chromosome was selected for by plating bacteria on LB agar supplemented with chloramphenicol and streptomycin. Chloramphenicol-resistant transformants of EPEC and EHEC were then cultured on peptone agar containing 5% sucrose to isolate colonies that were sucrose resistant. The resultant colonies were also tested for chloramphenicol sensitivity. Gene deletions were verified by PCR using primer pair EH1/EH4 or EP1/EP4. Plasmids used for complementation were constructed by PCR amplifying the genes of interest with their promoters from the appropriate genomic DNA using primer pair EH5/EH6 or EP5/EP6. The resultant PCR products were cloned into the XbaI and EcoRV restriction sites of plasmid pACYC184, generating plasmids pEHompT and pEPompT. Plasmids containing FLAG-tagged EHEC and EPEC ompT were generated by PCR amplifying the genes of interest with their promoters from genomic DNA using primer pair EH5/EH9 or EP5/EH9. The PCR products were then treated with XbaI and ligated into pACYC184, as described above. Promoter-swapping constructs were generated by amplifying the promoter of EHEC or EPEC ompT using primer pair EH5/EH10 or EP5/EH7. The resultant PCR products were digested with XbaI, treated with T4 polynucleotide kinase, and ligated to the PCR products of the open reading frame of EPEC ompT (primer pair EP7/EP6) or EHEC ompT (primer pair EH8/EH6). The ligation products were then used as the DNA template in a PCR using primer pair EH5/EP6 or EP5/EH6. The PCR products were then digested with XbaI and ligated into pACYC184 that had been treated with XbaI and EcoRV, generating pEHpromEPompT and pEPpromEHompT.

Table 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Description Source or reference
Strains
    EHEC EDL933 Wild-type EHEC O157:H7 34
    EHEC ΔompT EDL933 ΔompT This study
    EHEC ΔompT(pEHompT) EDL933 ΔompT mutant expressing ompT from pEHompT This study
    EHEC ΔompT(pEPompT) EDL933 ΔompT mutant expressing ompT from pEPompT This study
    EHEC ΔompT(pEHompT-FLAG) EDL933 ΔompT mutant expressing ompT-FLAG from pEHompT-FLAG This study
    EHEC ΔompT(pEPompT-FLAG) EDL933 ΔompT mutant expressing ompT-FLAG from pEPompT-FLAG This study
    EHEC ΔompT(pEPpromEHompT) EDL933 ΔompT mutant expressing ompT from pEPpromEHompT This study
    EHEC ΔompT(pEHpromEPompT) EDL933 ΔompT mutant expressing ompT from pEHpromEPompT This study
    EPEC E2348/69 Wild-type EPEC O127:H6 Strr 25
    EPEC ΔompT E2348/69 ΔompT This study
    EPEC ΔompT(pEPompT) E2348/69 ΔompT mutant expressing ompT from pEPompT mutant This study
    EPEC ΔompT(pEHompT) E2348/69 ΔompT mutant expressing ompT from pEHompT This study
    EPEC ΔompT(pEPompT-FLAG) E2348/69 ΔompT mutant expressing ompT-FLAG from pEPompT-FLAG This study
    EPEC ΔompT(pEHompT-FLAG) E2348/69 ΔompT mutant expressing ompT-FLAG from pEHompT-FLAG This study
    EPEC ΔompT(pEPpromEHompT) E2348/69 ΔompT mutant expressing ompT from pEPpromEHompT This study
    EPEC ΔompT(pEHpromEPompT) E2348/69 ΔompT mutant expressing ompT from pEHpromEPompT This study
    Sm10 (λ Pir) thi thr leuB tonA lacY supE recA::RP4-2-Tc::Mu-Kan Kanr 37
    Sm10 (λ Pir)(pΔEPompT) Sm10 (λ Pir) containing pΔEPompT This study
    χ7213 thr-1 leuB6 fhuA21 lacY1 glnV44 recA1asdA4 thi-1 RP4-2-Tc::Mu [-pir] Kanr 35
    χ7213 (pΔEHompT) χ7213 containing pΔEHompT This study
Plasmids
    pRE112 Sucrose-sensitive (sacB1) suicide vector, Cmr 7
    pΔEHompT EHEC ΔompT deletion construct in pRE112 This study
    pΔEPompT EPEC ΔompT deletion construct in pRE112 This study
    pACYC184 Multicopy plasmid, Tetr Cmr NEB
    pEHompT EHEC ompT cloned into pACYC184 This study
    pEHompT-FLAG C-terminally FLAG-tagged EHEC ompT cloned into pACYC184 This study
    pEPompT EPEC ompT cloned into pACYC184 This study
    pEPompT-FLAG C-terminally FLAG-tagged EPEC ompT cloned into pACYC184 This study
    pEPpromEHompT EHEC ompT under the control of the EPEC ompT promoter cloned into pACYC184 This study
    pEHpromEPompT EPEC ompT under the control of the EHEC ompT promoter cloned into pACYC184 This study

Table 2.

Primers used in this study

Primer Sequencea Useb Restriction site
EH1 GCTCTAGAAATTGCCGCCCACTGTGAGTCAT Generate pΔEHompT and screen for ΔompT XbaI
EH2 GGGGTACCCATAAAAGGTCTCCATTCAATCG Generate pΔEHompT KpnI
EH3 GGGGTACCTAACGAAGTTAACCAGATTTTC Generate pΔEHompT KpnI
EH4 GCGAGCTCACGACTCCATCAAGAACGATAGA Generate pΔEHompT and screen for ΔompT SacI
EH5 GCTCTAGACGACCTGATTATGCCATTACATA Generate pEHompT XbaI
EH6 GCGAGCTCAAATCTGGTTAACTTCGTTAA Generate pEHompT SacI
EH7 AAAAGGTCTCCATTCAATCGTTTTAATG Generate pEPpromEHompT
EH8 ATGCGGGCGAAACTTCTGGGAATAG Generate pEPpromEHompT
EH9 GGCGAGCTCCTATCATTACTTGTCGTCATCGTCCTTGTAGTCAAAGGTGTACTTAAGACCAGCAG Generate pEHompT-FLAG and pEPompT-FLAG SacI
EH10 GGACTATTCCCAGAAGTTTCG Generate pEHpromEPompT
EP1 GCTCTAGAGCGTGAACGTTATCTACAGG Generate pΔEPompT and screen for ΔompT XbaI
EP2 GGGGTACCGTCAGGAGTAAACGATAAAGT Generate pΔEPompT KpnI
EP3 GGGGTACCTAACAACGTTAAATAGATTTTC Generate pΔEPompT KpnI
EP4 GCGAGCTCGAAACCTCGTTGCTGGAAGC Generate pΔEPompT and screen for ΔompT SacI
EP5 GCTCTAGACTTAGAAACTCCAGGAACGACAT Generate pEPompT XbaI
EP6 GCGAGCTCAATCTATTTAACGTTGTTAAA Generate pEPompT SacI
EP7 TGACAACCCCTATTGCGATCAGC Generate pEHpromEPompT
qEH810 TCGGCTCCTTCCCGAATGGAG qPCR EHEC ompT F
qEH811 GATGCTTCCACCCAGCCGC qPCR EHEC ompT R
qEH812 GTGCTGCATGGCTGTCGTCA qPCR EHEC 16S RNA F
qEH813 AGCACGTGTGTAGCCCTGGT qPCR EHEC 16S RNA R
qEP808 CAGCGGCTGGGTGGAAGCAT qPCR EPEC ompT F
qEP809 ACCCGATTCCATGCGCCTTCA qPCR EPEC ompT R
qEP814 AACGCGTTAAGTCGACCGCC qPCR EPEC 16S RNA F
qEP815 CGGCTCCCGAAGGCACATTC qPCR EPEC 16S RNA R
a

Restriction sites are underlined.

b

F, forward; R, reverse.

MIC determination.

MICs were determined in 96-well microtiter plates using the broth microdilution method (42). Briefly, bacterial cells were grown to an optical density at 600 nm (OD600) of 0.5 in N-minimal medium, diluted to 5 × 105 CFU/ml in the same medium, and aliquoted into rows of wells. Twofold serial dilutions of the tested AMP were added to each row of wells. The plates were incubated at 37°C for 24 h. The lowest concentration of AMP that did not permit any visible growth, determined by absence of turbidity, was the MIC. Determination of MIC values was repeated at least three times.

Proteolytic cleavage of AMPs, tandem MS, peptide separation, and N-terminal sequencing.

Bacterial cells were grown to an OD600 of 0.5 in N-minimal medium supplemented with 0.2% glucose and 1 mM MgCl2. Culture aliquots (107 cells) were incubated with 10 μg of AMP, to facilitate visualization of the degradation products, for various times at 37°C in a total volume of 25 μl. Bacterial cells were pelleted by centrifugation. The supernatant was removed, and Tris-Tricine sample buffer (Bio-Rad) was added. Aliquots (5 μl) were heated at 100°C for 5 min and resolved by Tris-Tricine SDS-PAGE (10 to 20% acrylamide; Bio-Rad). After fixation for 30 min in 5% glutaraldehyde, the peptides were stained with Coomassie blue G-250. For mass spectrometry (MS) analysis, supernatants were filtered using a 0.2-μm-pore-size polyvinylidene difluoride (PVDF) filter and stored at −20°C. Samples (5 μg) were injected on a Zorbax octyldecyl silane (ODS) column installed on an Agilent 1100 series liquid chromatograph connected to a Sciex-Applied Biosystems QTRAP 4000 mass spectrometer. Peptides were eluted using a gradient with solvent A (0.1% trifluoroacetic acid [TFA] in water) and solvent B (0.1% TFA in acetonitrile). Enhanced MS scans are acquired between 350 and 2,000 m/z with a source voltage of 2,075, scan speed at 4,000 atomic mass units (amu)/s, and active dynamic fill time. Information-dependent MS/MS analysis was performed on the six most intense multiply charged ions; a dynamic exclusion of 120 s was used to limit resampling of previously selected ions. MS/MS scans were acquired at between 70 and 2,000 amu/s, and the fixed fill time was set at 25 ms with quadrupole Q0 trapping and rolling collision energy of ±3 eV. LL-37 cleavage products were separated on an ODS column, placed into different tubes, and submitted to N-terminal sequencing on an Applied Procise 494cLC automated sequence system.

FRET activity assay.

The synthetic fluorescence resonance energy transfer (FRET) peptide substrate containing ortho-aminobenzoic acid (Abz) as the fluorescent and group 2,4 nitrophenyl (Dnp) as the quencher [2Abz-SLGRKIQI-K(Dnp)-NH2] was purchased from AnaSpec. To perform the assay, bacterial cells were grown to an OD600 of 0.5 in N-minimal medium supplemented with 0.2% glucose and 1 mM MgCl2. Cells were pelleted by centrifugation and resuspended in phosphate-buffered saline (PBS; pH 7.4). The FRET substrate (final concentration, 3 μM) was transferred into a quartz cuvette equipped with a stir bar. After 30 s, 1.5 × 109 cells were added. For normalization, PBS was added instead of cells. The fluorescence emission was monitored over 60 min at 22°C with an excitation wavelength at 325 nm and emission wavelength at 430 nm. Both excitation and emission slits were set at 5 nm.

qPCR.

Quantitative PCR (qPCR) was performed as previously described (24). Briefly, bacterial strains were grown to an OD600 of 0.5 in N-minimal medium supplemented with 0.2% glucose and 1 mM MgCl2. Total RNA was isolated using TRIzol reagents (Invitrogen) and treated with a DNA-free kit (Ambion) to remove any remaining DNA. The absence of contaminating DNA was confirmed by qPCR using primers qEP814 and qEP815 (Table 2). RNA (1 μg) was reverse transcribed using Superscript II (Invitrogen) with 0.5 μg of random hexamer primers (Sigma). As a negative control, a reaction mixture without Superscript II was also included (NRT). qPCRs were performed in a Rotor-Gene 3000 thermal cycler (Corbett Research) by using a QuantiTect SYBR green PCR kit (Qiagen), according to the manufacturer's instructions. Primers used are listed in Table 2. The level of ompT transcript was normalized to 16S RNA and analyzed using the 2−ΔCT (where CT is threshold cycle) method (26). Reverse transcription (RT) was performed three times independently, and the NRT sample was used as a negative control.

OM protein extraction and Western blotting.

Bacterial strains were grown in N-minimal medium supplemented with 0.2% glucose and 1 mM MgCl2 to an OD600 of 0.5. To generate whole-cell lysates, cells were harvested by centrifugation and the pellet was resuspended in Laemmli sample buffer. Total membrane fractions were isolated by osmotic lysis as described elsewhere (43). Briefly, cells were pelleted by centrifugation, washed with PBS, resuspended in osmotic shock buffer (0.5 M sucrose, 40 mM Tris-HCl [pH 7.4], 5 mM EDTA, 100 μg/ml lysozyme), and incubated at room temperature for 30 min with gentle rocking. An equal volume of MgCl2 (20 mM) was added to the mixture, and cells were pelleted by centrifugation (10,000 rpm, 20 min). The pellet was resuspended in hypotonic solution (20 mM Tris-HCl [pH 7.4], 5 mM EDTA, 1 mM protease inhibitor cocktail [Sigma], 25 μg/ml DNase I) and incubated at room temperature for 20 min. Total membranes were collected by centrifugation (15,000 rpm, 30 min, 4°C) and solubilized with sarcosyl (10 mM Tris-HCl [pH 8.3], 2% sarcosyl, 5 mM MgCl2) at 10°C for 30 min. Sarcosyl-soluble and -insoluble fractions were separated by ultracentrifugation at 45,000 rpm for 1 h. Sarcosyl-soluble fractions, corresponding to the inner membrane fractions, were collected. Sarcosyl-insoluble fractions, corresponding to the OM fractions, were solubilized with Triton X-100 (50 mM Tris-HCl [pH 8.3], 10 mM EDTA, 1% Triton X-100) at 25°C for 30 min. Protein samples were boiled for 5 min, loaded on 10% SDS-polyacrylamide gels, and transferred to a PVDF membrane (Millipore). OmpT-FLAG was visualized using a polyclonal anti-FLAG antibody (Sigma). The rabbit polyclonal antibody raised against CroP was produced at the Comparative Medicine Animal Resources Centre (McGill University).

RESULTS

OmpT contributes to AMP resistance.

The chromosomes of both EPEC and EHEC contain the ompT gene coding for the OmpT OM protease. Both open reading frames share 98% identity at the amino acid level. To assess the contribution of OmpT to the degradation of α-helical AMPs, ompT deletion mutants were generated in both EHEC and EPEC. These ompT deletion mutants were then compared to the wild-type strains by determining MIC values of the AMPs LL-37 and C18G. As shown in Table 3, the deletion of EHEC ompT resulted in 2-fold and 8-fold decreases in the MICs of LL-37 and C18G, respectively. Complementation of the EHEC ΔompT mutant with a pACYC184-derived plasmid encoding EHEC OmpT under the control of its native promoter (pEHompT) restored resistance to both AMPs above wild-type levels. Compared to the MICs for the EHEC ΔompT mutant, 8- and 32-fold increases in the MICs of LL-37 and C18G, respectively, were obtained. Interestingly, complementation of the EHEC ΔompT mutant with the pEPompT plasmid, which encodes EPEC OmpT under the control of its native promoter, led to more modest increases in MICs. In EPEC, the deletion of ompT resulted in only a 2-fold decrease in the MIC of C18G and did not affect the MIC of LL-37 (Table 3). Complementation of the EPEC ΔompT mutant with pEPompT resulted in a 2-fold increase in the MIC of LL-37 and an 8-fold increase in the MIC of C18G compared to the MICs for the EPEC ΔompT mutant. Complementation of the EPEC ΔompT mutant with pEHompT resulted in 4- and 8-fold increases in the MICs of LL-37 and C18G, respectively. For both EHEC and EPEC, no differences in the MICs of PMB, a cyclic lipopeptide that was previously shown to resist proteolytic degradation (24), were observed (Table 3). Taken together, these data indicate that OmpT is likely to contribute to AMP resistance in both EHEC and EPEC. The MIC values of C18G determined for the EHEC strains are very similar to those previously obtained for C. rodentium under similar experimental conditions (24). In contrast, the smaller differences in MICs obtained for the EPEC strains may suggest that EPEC OmpT plays a more marginal role in AMP resistance than EHEC OmpT.

Table 3.

MICs of AMPs for EHEC and EPEC strains

Strain MIC (μg/ml)
LL-37 LL-371-7 LL-378-18 LL-3719-37 C18G PMB
EHEC wild type 16 >1,024 >1,024 512 32 2
EHEC ΔompT 8 >1,024 >1,024 512 4 2
EHEC ΔompT(pEHompT) 64 >1,024 >1,024 512 128 2
EHEC ΔompT(pEPompT) 32 NDa ND ND 32 2
EPEC wild type 16 >1,024 >1,024 1,024 16 2
EPEC ΔompT 16 >1,024 >1,024 1,024 8 2
EPEC ΔompT(pEPompT) 32 >1,024 >1,024 1,024 64 2
EPEC ΔompT(pEHompT) 64 ND ND ND 64 2
a

ND, not determined.

EHEC and EPEC cleave AMP substrates at different rates.

To confirm the proteolytic degradation of α-helical AMPs by OmpT, time course experiments monitoring the cleavage of LL-37 and C18G were conducted. AMPs were incubated with the various bacterial strains, and degradation products were analyzed by Tris-Tricine SDS-PAGE. As shown in Fig. 1A, cleavage of LL-37 by EHEC wild type was observed within the first 5 min of incubation and was complete by 60 min. As expected, no cleavage was observed for the EHEC ΔompT mutant, but complementation of the deletion mutant with pEHompT resulted in complete cleavage of LL-37 within 30 min. In EPEC, evidence of LL-37 cleavage by the wild-type strain appeared only after 30 min, and cleavage was incomplete by 60 min. The EPEC ΔompT mutant did not cleave LL-37, and complementation of this strain with pEPompT resulted in almost complete cleavage by 60 min. Both EHEC and EPEC wild-type strains cleaved C18G more rapidly than LL-37 (Fig. 1B). Cleavage of C18G by EHEC wild type was complete by 5 min. The EHEC ΔompT mutant did not cleave C18G for the duration of the assay. Complementation of the EHEC ΔompT mutant with pEHompT resulted in complete cleavage of C18G by 2 min. In the case of EPEC wild type, some cleavage products were observed after 5 min, but degradation remained incomplete at 15 min. The EPEC ΔompT mutant did not cleave C18G, and complementation of this mutant with pEPompT resulted in the complete cleavage of C18G by 5 min. Altogether, these data show that both EHEC OmpT and EPEC OmpT mediate degradation of LL-37 and C18G. They also indicate that both AMPs are cleaved more rapidly by EHEC than EPEC.

Fig 1.

Fig 1

Proteolytic degradation of LL-37 and C18G. OmpT-mediated degradation of LL-37 (A) and C18G (B). LL-37 or C18G (10 μg) was incubated with the indicated strains for the indicated times. The resulting AMP cleavage products were separated by Tris-Tricine SDS-PAGE and visualized by Coomassie staining. Asterisks, migration of the dye front; pound sign, an aberrantly migrating band that is observed only after complete C18G cleavage and may correspond to cleavage product aggregates. Data shown are representative of at least three independent experiments.

EHEC OmpT cleaves LL-37 at dibasic sites.

E. coli K-12 OmpT was previously reported to preferentially cleave substrates between two consecutive basic amino acids (40). LL-37 contains 11 basic residues, including the 2 dibasic sequences RK and KR (Fig. 2). LL-37 was incubated with EHEC ΔompT(pEHompT) cells, and at various time points, cleavage products were separated from bacterial cells by filtration and analyzed by liquid chromatog-raphy-tandem mass spectrometry (LC-MS/MS). Under these conditions, LL-37 was observed as a single peak at m/z 1,124.5, corresponding to the quadruply protonated molecular ion of LL-37 with a molecular mass of 4,494 Da that is consistent with the calculated mass of 4,493.3 Da. Following 5 min of incubation with EHEC ΔompT(pEHompT) cells, additional peaks corresponding to molecular species of 2,188, 2,341, and 3,644 Da were observed (Fig. 2). Further incubation with bacterial cells for up to 1 h did not lead to the appearance of additional peaks, indicating that OmpT did not further degrade LL-37. N-terminal sequencing by Edman degradation of the LL-37 cleavage products from the 5- and 15-min time points further confirmed the cleavage sites obtained by LC-MS/MS (data not shown). In addition, peptides corresponding to the LL-37 cleavage products were synthesized, and MICs were determined. Large increases in MIC values were obtained for EHEC and EPEC strains (Table 3), indicating that OmpT-mediated cleavage of LL-37 is protective. These data clearly show that EHEC OmpT cleaves LL-37 at two dibasic sites and inactivates its bactericidal activity.

Fig 2.

Fig 2

Mass spectrometry analysis of LL-37 degradation products. OmpT-dependent LL-37 cleavage products were detected by liquid chromatography and analyzed by MS/MS. Shown is a schematic of the LL-37 amino acid sequence. Dibasic sequences are shown in black. Vertical filled arrows, OmpT cleavage sites; horizontal open arrows, fragments detected by MS/MS analysis.

Cleavage of a synthetic FRET substrate by EHEC and EPEC OmpT.

To further compare the catalytic activities of the EHEC OmpT and EPEC OmpT, we measured the cleavage of the synthetic FRET substrate containing the dibasic sequence RK in its center [2Abz-SLGRKIQI-K(Dnp)-NH2]. This substrate is derived from the protein C2 of the classical complement pathway (20). Cleavage of the substrate was monitored by measuring fluorescence emission over time. Incubation of the substrate with EHEC wild type resulted in a rapid increase in fluorescence, reaching a maximum value of 175 arbitrary units (AU) after 1 h (Fig. 3A). Incubation with the EHEC ΔompT strain resulted in minimal fluorescence emission that remained below 20 AU for the duration of the assay, indicating that substrate cleavage was due to OmpT. Complementation of the EHEC ΔompT strain with pEHompT resulted in an even more rapid increase in fluorescence, followed by a plateau at the value of 200 AU after 15 min. As shown in Fig. 3B, EPEC wild type exhibited a lower rate of cleavage than EHEC wild type. The fluorescence level increased only to about 80 AU during the course of the assay. The EPEC ΔompT mutant showed a slow increase in fluorescence that remained below a value of 25 AU, indicating that substrate cleavage was primarily OmpT dependent. Complementation of the EPEC ΔompT mutant with pEPompT resulted in an increased rate in substrate cleavage, with fluorescence reaching a maximum value of 190 AU. These data indicate that EHEC OmpT cleaved the FRET substrate more rapidly than EPEC OmpT. Altogether, these data suggest that EHEC OmpT is more efficient than EPEC OmpT at protecting cells from AMPs (Table 3) and at cleaving LL-37, C18G, and the FRET substrate (Fig. 1 and 3). Several explanations may account for these apparent differences in activity. First, the ompT genes may be differentially expressed in EHEC and EPEC. Second, the OmpT proteins may be differentially targeted to the OM of EHEC and EPEC. Third, the catalytic activities of the OmpT proteins may be differentially regulated by unknown factors.

Fig 3.

Fig 3

Proteolytic cleavage of a synthetic FRET peptide. The synthetic FRET peptide containing the dibasic sequence RK was incubated with various EHEC and EPEC strains. Peptide cleavage, indicated by the increase in fluorescence, was measured over time. (A) Fluorescence of the FRET peptide incubated with EHEC wild type (black), EHEC ΔompT mutant (red), and EHEC ΔompT(pEHompT) mutant (blue); (B) fluorescence of the FRET peptide incubated with EPEC wild type (black), EPEC ΔompT mutant (red), and EPEC ΔompT(pEPompT) mutant (blue). All samples were normalized against a PBS blank; data shown are representative of three independent experiments.

Expression of the ompT gene is higher in EHEC than in EPEC.

To examine the expression of the ompT gene in EHEC and EPEC, relative transcript levels were analyzed by quantitative RT-PCR. The level of ompT transcript was normalized to the 16S RNA level and analyzed using the 2−ΔCT method (26). Expression of the ompT gene was 32-fold higher in EHEC wild type than in EPEC wild type (Fig. 4A). As expected, the ompT transcript was absent in the EHEC and EPEC ΔompT strains. As shown in Fig. 4B, complementation of the EPEC ΔompT strain with either pEPompT or pEHompT resulted in the overexpression of the ompT gene. Compared to the levels in wild-type EPEC, the levels of the ompT transcript were 50- and 100-fold higher in the EPEC ΔompT mutant complemented with pEPompT or pEHompT, respectively. Interestingly, complementation of the EPEC ΔompT mutant with pEHompT resulted in a significant increase in the level of ompT transcript compared to that for the same strain complemented with pEPompT. These qPCR results indicate that the faster degradation of OmpT substrates by EHEC may be due to a higher expression of the ompT gene in EHEC than EPEC under our experimental conditions.

Fig 4.

Fig 4

Expression of the ompT gene. (A) Transcription of ompT in the EHEC and EPEC wild-type and ΔompT strains; (B) transcription of ompT in the EPEC wild-type, ΔompT, ΔompT(pEPompT), and ΔompT(pEHompT) strains. Expression of ompT was quantified by RT-qPCR. Relative mRNA expression is representative of ompT expression normalized against 16S RNA. Results are expressed as means ± SDs. Statistical significance was assessed using a one-way analysis of variance and Tukey's post hoc comparison test. Unless otherwise indicated, asterisks indicate statistical significance versus wild type (*, P < 0.05; **, P < 0.01; ***, P < 0.001).

Presence of OmpT at OM of EHEC and EPEC.

To correlate the transcription levels of ompT with the presence of OmpT at the OM of EHEC and EPEC, FLAG-tagged ompT plasmids were generated and protein levels were examined by immunoblotting. First, the presence of the OmpT protein at the OM was investigated by fractionating whole-cell lysates of the EPEC ΔompT mutant complemented with pEPompT-FLAG. The band corresponding to OmpT-FLAG was detectable in the whole-cell lysate and in the OM fraction but undetectable in the cytoplasmic and inner membrane fractions (Fig. 5A). Similar results were obtained for the EHEC ΔompT mutant complemented with pEHompT-FLAG (data not shown). Western blot analysis of whole-cell lysates from EHEC and EPEC ΔompT strains complemented with either pEHompT-FLAG or pEPompT-FLAG revealed that EPEC OmpT-FLAG was expressed at lower levels than EHEC OmpT-FLAG, regardless of the host strain (Fig. 5B). To confirm these results and investigate the expression of OmpT in the wild-type strains, whole-cell lysates were analyzed using an antiserum developed against the CroP OM protease of C. rodentium (74% identical to OmpT). As shown in Fig. 5C, a band corresponding to wild-type OmpT was easily detected in EHEC lysates, but this band was undetectable in EPEC lysates. In addition, Western blot analysis of the EHEC and EPEC strains complemented with their respective genes confirmed that EHEC OmpT is expressed at higher levels than EPEC OmpT (Fig. 5C), confirming the results obtained with the OmpT-FLAG proteins. Altogether, these data are in good agreement with the qPCR data. They show that both OmpT proteins are properly targeted to the OM. They also indicate that the OmpT protein is present at higher levels at the OM membrane of EHEC than that of EPEC and that the differences in expression levels are conferred in cis by the ompT gene or its promoter rather than by trans-acting factors differing between the two bacterial strains.

Fig 5.

Fig 5

Detection of the OmpT protein by Western blotting. (A and B) OmpT-FLAG was detected using a polyclonal anti-FLAG antibody; filled arrows, OmpT-FLAG protein species. (A) Whole-cell lysates (WCL), soluble fractions (CYT), inner membrane fractions (IM), and OM fractions (OM) from the EPEC ΔompT mutant with the empty vector (ΔompT) or pEPompT-FLAG (pEPompT); (B) whole-cell lysates of the EHEC ΔompT mutant with the empty vector (ΔompT), pEHompT-FLAG (pEHompT), or pEPompT-FLAG (pEPompT) and of the EPEC ΔompT mutant with the empty vector (ΔompT), pEPompT-FLAG (pEPompT), or pEHompT-FLAG (pEHompT); (C) OmpT was detected using a polyclonal anti-CroP antibody. Whole-cell lysates of EHEC wild type, ΔompT mutant, and ΔompT(pEHompT) mutant and of EPEC wild type, ΔompT mutant, and ΔompT(pEPompT) mutant. All samples were normalized (by OD600) to ensure that the same number of cells was used. Data shown are representative of three independent experiments. Filled arrows, OmpT protein species; asterisks, cross-reactive bands.

OmpT promoter swapping.

To test whether the lower expression of EPEC ompT is caused by differences in the promoter regions, we swapped the EHEC ompT promoter with that of EPEC ompT to generate plasmid pEPpromEHompT that contains the EPEC ompT promoter in front of the EHEC open reading frame. Similarly, the EPEC ompT promoter was swapped with that of EHEC to generate plasmid pEHpromEPompT that contains the EHEC ompT promoter in front of the EPEC open reading frame. The amounts of OmpT produced by the various EPEC and EHEC strains were analyzed by Western blotting. As shown in Fig. 6A, the EPEC ΔompT mutant complemented with pEHompT produced larger amounts of OmpT than the same strain complemented with pEPompT, confirming the results shown in Fig. 5B. When the EHEC ompT gene was under the control of the EPEC ompT promoter (pEPpromEHompT), the level of OmpT produced was similar to that produced by the EPEC ΔompT mutant complemented with pEPompT, indicating that the EPEC ompT promoter is responsible for the decreased OmpT expression observed in EPEC (Fig. 6A). Conversely, when the EPEC ompT gene was under the control of the EHEC ompT promoter (pEHpromEPompT), the level of OmpT produced was similar to that produced by the EPEC ΔompT gene complemented with pEHompT (Fig. 6A). A similar trend was observed when the EHEC ΔompT gene was complemented with these various plasmids (Fig. 6B). Densitometry analyses were performed on 3 independent Western blots to quantify OmpT amounts (data not shown). Statistically significant differences in the amount of OmpT produced by pEPompT and pEHompT were observed (P < 0.05), regardless of genetic background. By analyzing OmpT bands corresponding to the promoter swap constructs, we found that the amount of OmpT was dependent on the promoter used (P < 0.05 for EPEC and P < 0.01 for EHEC). To correlate OmpT expression with enzymatic activity, cleavage of the FRET substrate was measured. As shown in Fig. 6C, the EPEC ΔompT mutant complemented with pEHompT cleaved the FRET substrate faster than the other EPEC strains, as indicated by the rapid increase in fluorescence with a plateau at about 200 AU. When the EPEC ΔompT mutant was complemented with pEPpromEHompT, the increase in fluorescence was very similar to that of the same strain complemented with pEPompT (Fig. 6C). When the EPEC ΔompT mutant was complemented with pEHpromEPompT, the increase in fluorescence was very similar to that of the same strain complemented with pEHompT. A similar trend was observed when the EHEC ΔompT gene was complemented with these various plasmids (Fig. 6D). Taken together, these data clearly show that the differential ompT expression, protein level, and OmpT activity in EHEC and EPEC are due to differences in the promoters.

Fig 6.

Fig 6

The EPEC ompT promoter lowers the expression of EHEC OmpT. (A and B) OmpT from various EPEC (A) and EHEC (B) strains was detected by Western blotting of whole-cell lysates using a polyclonal anti-CroP antibody. Asterisks, cross-reactive bands. Data shown are representative of three independent experiments. (C and D) Cleavage of the FRET peptide was measured over time. (C) Fluorescence of the FRET peptide incubated with EPEC wild type and ΔompT, ΔompT(pEPompT), ΔompT(pEHompT), ΔompT(pEPpromEHompT), and ΔompT(pEHpromEPompT) mutants; (D) fluorescence of the FRET peptide incubated with EHEC wild type and ΔompT, ΔompT(pEHompT), ΔompT(pEPompT), ΔompT(pEPpromEHompT), and ΔompT(pEHpromEPompT) mutants. All samples were normalized against a PBS blank; data shown are representative of two independent experiments.

DISCUSSION

During colonization at mucosal surfaces, EHEC and EPEC must overcome innate host defenses such as the secretion of various AMPs by epithelial cells, including the human cathelicidin LL-37. Proteolytic degradation of α-helical AMPs by OM proteases of the omptin family has been shown to be one resistance mechanism used by Gram-negative pathogens. The S. enterica PgtE, Y. pestis Pla, and C. rodentium CroP OM proteases were reported to degrade α-helical AMPs (10, 11, 24). To investigate the involvement of EHEC and EPEC OmpT in the degradation of α-helical AMPs, we generated and characterized ompT deletion mutants. When tested under the same experimental conditions, consistent differences in the rates of α-helical AMP degradation and subsequent contributions to resistance were observed between EHEC OmpT and EPEC OmpT. These differences in AMP resistance were directly associated with decreased EPEC ompT expression and OmpT protein levels compared to EHEC. Promoter-swapping experiments showed that the decreased expression of EPEC ompT was promoter dependent.

Striking differences in the proteolytic degradation of α-helical AMPs were observed between EHEC and EPEC cells expressing OmpT at wild-type levels (Fig. 1). In contrast to what was observed for EHEC cells, EPEC cells poorly degraded both LL-37 and C18G. The presence of OmpT at the OM of wild-type EPEC cells is supported by several lines of evidence. First, peptide bands corresponding to small amounts of cleavage products were observed at later time points for EPEC wild type but not for the EPEC ΔompT mutant. Second, the intensity of these bands increased dramatically upon complementation and, thus, overexpression of EPEC OmpT. The peptide degradation patterns obtained for the EPEC ΔompT(pEPompT) mutant were somewhat similar to those obtained for EHEC wild-type cells. Third, wild-type EPEC cells readily cleaved the FRET substrate in an OmpT-dependent manner (Fig. 3B). The OmpT protease from E. coli K-12 was previously reported to preferentially cleave substrates between two consecutive basic amino acids (5, 40). Our results are in agreement with these previous reports, since EHEC OmpT rapidly cleaves LL-37 at dibasic sequences (Fig. 2). We did not observe any evidence of preferential cleavage at the RK or KR site of LL-37. In addition, no further cleavage of the LL-37 fragments by OmpT was observed at the later time points, confirming that OmpT exhibits narrow cleavage specificity against LL-37. The substrate specificity of omptins depends on the sequence variability of the five outer loops (22). Because there are no amino acid changes in the EHEC and EPEC outer loop sequences, it is most likely that both EHEC and EPEC OmpT cleave LL-37 with the same specificity. Our results clearly indicate that the ompT gene is differentially regulated in EHEC and EPEC in a promoter-dependent manner. Such differential gene regulation between EHEC and EPEC is not unprecedented. The LEE, the major pathogenicity island of A/E pathogens, is known to exhibit subtle differences in gene regulation between EHEC and EPEC (27).

Although our results showed that EPEC OmpT poorly degrades LL-37 and C18G (Fig. 1), the MIC values, determined under similar growth conditions, indicate that the EPEC ΔompT mutant is slightly more resistant to α-helical AMPs than the EHEC ΔompT mutant (Table 3). In contrast to what was observed in EHEC, deletion of ompT in EPEC resulted in MIC values that were unchanged for LL-37 and minimally different for C18G. Despite this apparent minor role for OmpT in EPEC, we noted that the MIC values of LL-37 and C18G for EPEC were not strikingly lower than those obtained for EHEC wild type. Although we cannot rule out the possibility that expression of EPEC ompT is upregulated during infection by stimuli that were not present in the growth medium used, these observations may suggest that EPEC relies, at least partly, on other mechanisms to resist AMP killing. Several possible mechanisms may account for this. For example, capsules, curli fibers, and efflux pumps have all been associated with AMP resistance by other pathogens (3, 9, 19, 31). Whether these previously described resistance mechanisms play a role in EHEC and/or EPEC AMP resistance remains to be determined. Additionally, we cannot completely rule out the possibility of an uncharacterized resistance mechanism in EPEC.

We previously identified and characterized CroP, the omptin from the mouse A/E pathogen C. rodentium, and showed that it can proteolytically degrade α-helical AMPs (24). By comparing the omptin mutants from the three A/E pathogens, striking similarities are noticed between EHEC and C. rodentium. Identical MIC values of C18G were obtained for the various strains of EHEC and C. rodentium under similar growth conditions. In addition, both wild-type EHEC and C. rodentium readily degraded both C18G and their native host cathelicidins, LL-37 and mCRAMP, respectively. In contrast, the contribution of EPEC OmpT to α-helical AMP resistance appears to be more marginal. Notably, the differential contribution of omptins to AMP resistance in these three A/E pathogens appears to correlate with their niches in their respective hosts. Both EHEC and C. rodentium infect the distal part of the large intestine, whereas EPEC infects the small intestine (28). Large quantities of LL-37 were detected in the epithelial cells of the human colon, whereas little or no expression was seen within epithelial cells of the small intestine (14). Likewise, mCRAMP was produced in larger amounts by the mouse colon epithelium than by epithelial cells that line the small intestinal villi and crypts (17). Therefore, high levels of omptin expression by A/E pathogens correlate with colonization at intestinal sites where the largest amounts of cathelicidins are produced. The smaller quantity of LL-37 present in the small intestine is probably compensated for by the secretion of large amounts of α-defensins from Paneth cells (1). It remains unclear whether EPEC OmpT and other omptins play a role in the proteolytic degradation of defensins. Ongoing work in our laboratories is exploring this possibility.

ACKNOWLEDGMENTS

This work was supported by the Canadian Institutes of Health Research (CIHR, MOP-15551) and the Natural Sciences and Engineering Research Council (NSERC, 217482). S. Gruenheid is supported by a Canada Research Chair.

We thank K. Salmon for critical reading of the manuscript.

Footnotes

Published ahead of print 5 December 2011

REFERENCES

  • 1. Bevins CL, Salzman NH. 2011. Paneth cells, antimicrobial peptides and maintenance of intestinal homeostasis. Nat. Rev. Microbiol. 9:356–368 [DOI] [PubMed] [Google Scholar]
  • 2. Burton MF, Steel PG. 2009. The chemistry and biology of LL-37. Nat. Prod. Rep. 26:1572–1584 [DOI] [PubMed] [Google Scholar]
  • 3. Campos MA, et al. 2004. Capsule polysaccharide mediates bacterial resistance to antimicrobial peptides. Infect. Immun. 72:7107–7114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Darveau RP, et al. 1992. Peptides related to the carboxyl terminus of human platelet factor IV with antibacterial activity. J. Clin. Invest. 90:447–455 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Dekker N, Cox RC, Kramer RA, Egmond MR. 2001. Substrate specificity of the integral membrane protease OmpT determined by spatially addressed peptide libraries. Biochemistry 40:1694–1701 [DOI] [PubMed] [Google Scholar]
  • 6. Donnenberg MS, Kaper JB. 1991. Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59:4310–4317 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Edwards RA, Keller LH, Schifferli DM. 1998. Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression. Gene 207:149–157 [DOI] [PubMed] [Google Scholar]
  • 8. Eren E, Murphy M, Goguen J, van den Berg B. 2010. An active site water network in the plasminogen activator Pla from Yersinia pestis. Structure 18:809–818 [DOI] [PubMed] [Google Scholar]
  • 9. Foschiatti M, Cescutti P, Tossi A, Rizzo R. 2009. Inhibition of cathelicidin activity by bacterial exopolysaccharides. Mol. Microbiol. 72:1137–1146 [DOI] [PubMed] [Google Scholar]
  • 10. Galvan EM, Lasaro MA, Schifferli DM. 2008. Capsular antigen fraction 1 and Pla modulate the susceptibility of Yersinia pestis to pulmonary antimicrobial peptides such as cathelicidin. Infect. Immun. 76:1456–1464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Guina T, Yi EC, Wang H, Hackett M, Miller SI. 2000. A PhoP-regulated outer membrane protease of Salmonella enterica serovar Typhimurium promotes resistance to alpha-helical antimicrobial peptides. J. Bacteriol. 182:4077–4086 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Haiko J, Laakkonen L, Juuti K, Kalkkinen N, Korhonen TK. 2010. The omptins of Yersinia pestis and Salmonella enterica cleave the reactive center loop of plasminogen activator inhibitor 1. J. Bacteriol. 192:4553–4561 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Haiko J, Suomalainen M, Ojala T, Lahteenmaki K, Korhonen TK. 2009. Breaking barriers—attack on innate immune defences by omptin surface proteases of enterobacterial pathogens. Innate Immun. 15:67–80 [DOI] [PubMed] [Google Scholar]
  • 14. Hase K, Eckmann L, Leopard JD, Varki N, Kagnoff MF. 2002. Cell differentiation is a key determinant of cathelicidin LL-37/human cationic antimicrobial protein 18 expression by human colon epithelium. Infect. Immun. 70:953–963 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Hase K, et al. 2003. Expression of LL-37 by human gastric epithelial cells as a potential host defense mechanism against Helicobacter pylori. Gastroenterology 125:1613–1625 [DOI] [PubMed] [Google Scholar]
  • 16. Hritonenko V, Stathopoulos C. 2007. Omptin proteins: an expanding family of outer membrane proteases in Gram-negative Enterobacteriaceae. Mol. Membr. Biol. 24:395–406 [DOI] [PubMed] [Google Scholar]
  • 17. Iimura M, et al. 2005. Cathelicidin mediates innate intestinal defense against colonization with epithelial adherent bacterial pathogens. J. Immunol. 174:4901–4907 [DOI] [PubMed] [Google Scholar]
  • 18. Jenssen H, Hamill P, Hancock RE. 2006. Peptide antimicrobial agents. Clin. Microbiol. Rev. 19:491–511 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Kai-Larsen Y, et al. 2010. Uropathogenic Escherichia coli modulates immune responses and its curli fimbriae interact with the antimicrobial peptide LL-37. PLoS Pathog. 6:e1001010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Kerr FK, et al. 2005. Elucidation of the substrate specificity of the C1s protease of the classical complement pathway. J. Biol. Chem. 280:39510–39514 [DOI] [PubMed] [Google Scholar]
  • 21. Kukkonen M, Korhonen TK. 2004. The omptin family of enterobacterial surface proteases/adhesins: from housekeeping in Escherichia coli to systemic spread of Yersinia pestis. Int. J. Med. Microbiol. 294:7–14 [DOI] [PubMed] [Google Scholar]
  • 22. Kukkonen M, et al. 2001. Protein regions important for plasminogen activation and inactivation of α2-antiplasmin in the surface protease Pla of Yersinia pestis. Mol. Microbiol. 40:1097–1111 [DOI] [PubMed] [Google Scholar]
  • 23. Lahteenmaki K, Kyllonen P, Partanen L, Korhonen TK. 2005. Antiprotease inactivation by Salmonella enterica released from infected macrophages. Cell. Microbiol. 7:529–538 [DOI] [PubMed] [Google Scholar]
  • 24. Le Sage V, et al. 2009. An outer membrane protease of the omptin family prevents activation of the Citrobacter rodentium PhoPQ two-component system by antimicrobial peptides. Mol. Microbiol. 74:98–111 [DOI] [PubMed] [Google Scholar]
  • 25. Levine MM, et al. 1978. Escherichia coli strains that cause diarrhoea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive. Lancet i:1119–1122 [DOI] [PubMed] [Google Scholar]
  • 26. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408 [DOI] [PubMed] [Google Scholar]
  • 27. Mellies JL, Barron AM, Carmona AM. 2007. Enteropathogenic and enterohemorrhagic Escherichia coli virulence gene regulation. Infect. Immun. 75:4199–4210 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Nataro JP, Kaper JB. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142–201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Nelson DL, Kennedy EP. 1971. Magnesium transport in Escherichia coli. Inhibition by cobaltous ion. J. Biol. Chem. 246:3042–3049 [PubMed] [Google Scholar]
  • 30. Nijnik A, Hancock RE. 2009. The roles of cathelicidin LL-37 in immune defences and novel clinical applications. Curr. Opin. Hematol. 16:41–47 [DOI] [PubMed] [Google Scholar]
  • 31. Parra-Lopez C, Baer MT, Groisman EA. 1993. Molecular genetic analysis of a locus required for resistance to antimicrobial peptides in Salmonella typhimurium. EMBO J. 12:4053–4062 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Peschel A, Sahl HG. 2006. The co-evolution of host cationic antimicrobial peptides and microbial resistance. Nat. Rev. Microbiol. 4:529–536 [DOI] [PubMed] [Google Scholar]
  • 33. Ramu P, et al. 2007. The surface protease PgtE of Salmonella enterica affects complement activity by proteolytically cleaving C3b, C4b and C5. FEBS Lett. 581:1716–1720 [DOI] [PubMed] [Google Scholar]
  • 34. Riley LW, et al. 1983. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med. 308:681–685 [DOI] [PubMed] [Google Scholar]
  • 35. Roland K, Curtiss R, III, Sizemore D. 1999. Construction and evaluation of a Δcya Δcrp Salmonella typhimurium strain expressing avian pathogenic Escherichia coli O78 LPS as a vaccine to prevent airsacculitis in chickens. Avian Dis. 43:429–441 [PubMed] [Google Scholar]
  • 36. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
  • 37. Simon R, Priefer U, Pühler A. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Biotechnology (NY) 1:784–791 [Google Scholar]
  • 38. Sodeinde OA, et al. 1992. A surface protease and the invasive character of plague. Science 258:1004–1007 [DOI] [PubMed] [Google Scholar]
  • 39. Stumpe S, Schmid R, Stephens DL, Georgiou G, Bakker EP. 1998. Identification of OmpT as the protease that hydrolyzes the antimicrobial peptide protamine before it enters growing cells of Escherichia coli. J. Bacteriol. 180:4002–4006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Sugimura K, Nishihara T. 1988. Purification, characterization, and primary structure of Escherichia coli protease VII with specificity for paired basic residues: identity of protease VII and OmpT. J. Bacteriol. 170:5625–5632 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Vandeputte-Rutten L, et al. 2001. Crystal structure of the outer membrane protease OmpT from Escherichia coli suggests a novel catalytic site. EMBO J. 20:5033–5039 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Wiegand I, Hilpert K, Hancock RE. 2008. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat. Protoc. 3:163–175 [DOI] [PubMed] [Google Scholar]
  • 43. Yip CK, et al. 2005. Structural characterization of the molecular platform for type III secretion system assembly. Nature 435:702–707 [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES