Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1981 Oct 10;9(19):5049–5059. doi: 10.1093/nar/9.19.5049

Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

V E Brennan, L A Bobek, J A Bruenn
PMCID: PMC327498  PMID: 7031603

Abstract

ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

Full text

PDF
5052

Images in this article

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Alwine J. C., Kemp D. J., Stark G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridization with DNA probes. Proc Natl Acad Sci U S A. 1977 Dec;74(12):5350–5354. doi: 10.1073/pnas.74.12.5350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bostian K. A., Hopper J. E., Rogers D. T., Tipper D. J. Translational analysis of the killer-associated virus-like particle dsRNA genome of S. cerevisiae: M dsRNA encodes toxin. Cell. 1980 Feb;19(2):403–414. doi: 10.1016/0092-8674(80)90514-0. [DOI] [PubMed] [Google Scholar]
  3. Bruenn J. A., Brennan V. E. Yeast viral double-stranded RNAs have heterogeneous 3' termini. Cell. 1980 Apr;19(4):923–933. doi: 10.1016/0092-8674(80)90084-7. [DOI] [PubMed] [Google Scholar]
  4. Bruenn J., Bobek L., Brennan V., Held W. Yeast viral RNA polymerase is a transcriptase. Nucleic Acids Res. 1980 Jul 11;8(13):2985–2997. doi: 10.1093/nar/8.13.2985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bruenn J., Kane W. Relatedness of the double-stranded RNAs present in yeast virus-like particles. J Virol. 1978 Jun;26(3):762–772. doi: 10.1128/jvi.26.3.762-772.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bruenn J., Keitz B. The 5' ends of yeast killer factor RNAs are pppGp. Nucleic Acids Res. 1976 Oct;3(10):2427–2436. doi: 10.1093/nar/3.10.2427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Fried H. M., Fink G. R. Electron microscopic heteroduplex analysis of "killer" double-stranded RNA species from yeast. Proc Natl Acad Sci U S A. 1978 Sep;75(9):4224–4228. doi: 10.1073/pnas.75.9.4224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Harris M. S. Virus-like particles and double stranded RNA from killer and non-killer strains of Saccharomyces cerevisiae. Microbios. 1978;21(85-86):161–176. [PubMed] [Google Scholar]
  9. Hastie N. D., Brennan V., Bruenn J. A. No homology between double-stranded RNA and nuclear DNA of yeast. J Virol. 1978 Dec;28(3):1002–1005. doi: 10.1128/jvi.28.3.1002-1005.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Herring A. J., Bevan E. A. Virus-like particles associated with the double-stranded RNA species found in killer and sensitive strains of the yeast Saccharomyces cerevisiae. J Gen Virol. 1974 Mar;22(3):387–394. doi: 10.1099/0022-1317-22-3-387. [DOI] [PubMed] [Google Scholar]
  11. Herring A. J., Bevan E. A. Yeast virus-like particles possess a capsid-associated single-stranded RNA polymerase. Nature. 1977 Aug 4;268(5619):464–466. doi: 10.1038/268464a0. [DOI] [PubMed] [Google Scholar]
  12. Hopper J. E., Bostian K. A., Rowe L. B., Tipper D. J. Translation of the L-species dsRNA genome of the killer-associated virus-like particles of Saccharomyces cerevisiae. J Biol Chem. 1977 Dec 25;252(24):9010–9017. [PubMed] [Google Scholar]
  13. Kane W. P., Pietras D. F., Bruenn J. A. Evolution of defective-interfering double-stranded RNAs of the yeast killer virus. J Virol. 1979 Nov;32(2):692–696. doi: 10.1128/jvi.32.2.692-696.1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Koper-Zwarthoff E. C., Bol J. F. Nucleotide sequence of the putative recognition site for coat protein in the RNAs of alfalfa mosaic virus and tobacco streak virus. Nucleic Acids Res. 1980 Aug 11;8(15):3307–3318. doi: 10.1093/nar/8.15.3307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Koper-Zwarthoff E. C., Brederode F. T., Veeneman G., van Boom J. H., Bol J. F. Nucleotide sequences at the 5'-termini of the alfalfa mosaic virus RNAs and the intercistronic junction in RNA 3. Nucleic Acids Res. 1980 Dec 11;8(23):5635–5647. doi: 10.1093/nar/8.23.5635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Koper-Zwarthoff E. C., Lockard R. E., Alzner-deWeerd B., RajBhandary U. L., Bol J. F. Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron. Proc Natl Acad Sci U S A. 1977 Dec;74(12):5504–5508. doi: 10.1073/pnas.74.12.5504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Oliver S. G., McCREADY S. J., Holm C., Sutherland P. A., McLaughlin C. S., Cox B. S. Biochemical and physiological studies of the yeast virus-like particle. J Bacteriol. 1977 Jun;130(3):1303–1309. doi: 10.1128/jb.130.3.1303-1309.1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Palfree R. G., Bussey H. Yeast killer toxin: purification and characterisation of the protein toxin from Saccharomyces cerevisiae. Eur J Biochem. 1979 Feb 1;93(3):487–493. doi: 10.1111/j.1432-1033.1979.tb12847.x. [DOI] [PubMed] [Google Scholar]
  19. Peattie D. A. Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760–1764. doi: 10.1073/pnas.76.4.1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Somers J. M. Isolation of Suppressive Sensitive Mutants from Killer and Neutral Strains of SACCHAROMYCES CEREVISIAE. Genetics. 1973 Aug;74(4):571–579. doi: 10.1093/genetics/74.4.571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Thomas P. S. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc Natl Acad Sci U S A. 1980 Sep;77(9):5201–5205. doi: 10.1073/pnas.77.9.5201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Welsh D., Leibowitz M. J. Transcription of killer virion double-stranded RNA in vitro. Nucleic Acids Res. 1980 Jun 11;8(11):2365–2375. doi: 10.1093/nar/8.11.2365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Welsh J. D., Leibowitz M. J., Wickner R. B. Virion DNA-independent RNA polymerase from Saccharomyces cerevisiae. Nucleic Acids Res. 1980 Jun 11;8(11):2349–2363. doi: 10.1093/nar/8.11.2349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Wickner R. B. Plasmids controlled exclusion of the K2 killer double-stranded RNA plasmid of yeast. Cell. 1980 Aug;21(1):217–226. doi: 10.1016/0092-8674(80)90129-4. [DOI] [PubMed] [Google Scholar]
  25. Wickner R. B. Twenty-six chromosomal genes needed to maintain the killer double-stranded RNA plasmid of Saccharomyces cerevisiae. Genetics. 1978 Mar;88(3):419–425. doi: 10.1093/genetics/88.3.419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. de Wachter R., Fiers W. Preparative two-dimensional polyacrylamide gel electrophoresis of 32 P-labeled RNA. Anal Biochem. 1972 Sep;49(1):184–197. doi: 10.1016/0003-2697(72)90257-6. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES