Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1981 Oct 10;9(19):5141–5144. doi: 10.1093/nar/9.19.5141

The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

Ludo Diels 1, Raymond De Baere 1, Antoon Vandenberghe 1, Rupert De Wachter 1
PMCID: PMC327504  PMID: 7312626

Abstract

The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

Full text

PDF
5144

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Benhamou J., Jordan B. R. Nucleotide sequence of Drosophila melanogaster 5S RNA: evidence for a general 5S RNA model. FEBS Lett. 1976 Feb 15;62(2):146–149. doi: 10.1016/0014-5793(76)80039-7. [DOI] [PubMed] [Google Scholar]
  2. Benhamou J., Jourdan R., Jordan B. R. Sequence of Drosophila 5S RNA synthesized by cultured cells and by the insect at different developmental stages. Homogeneity of the product and homologies with other 5S RNA's at the level of primary and secondary structure. J Mol Evol. 1977 May 13;9(3):279–298. doi: 10.1007/BF01796116. [DOI] [PubMed] [Google Scholar]
  3. Diels L., De Wachter R. An RNA sequencing method based on a two-dimensional combination of gel electrophoresis and thin-layer chromatography [proceedings]. Arch Int Physiol Biochim. 1980 Feb;88(1):B26–B27. [PubMed] [Google Scholar]
  4. Erdmann V. A. Collection of published 5S and 5.8S RNA sequences and their precursors. Nucleic Acids Res. 1981 Jan 10;9(1):r25–r42. doi: 10.1093/nar/9.1.213-a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Fox G. E., Woese C. R. 5S RNA secondary structure. Nature. 1975 Aug 7;256(5517):505–507. doi: 10.1038/256505a0. [DOI] [PubMed] [Google Scholar]
  6. Hori H., Osawa S. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979 Jan;76(1):381–385. doi: 10.1073/pnas.76.1.381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hori H., Osawa S., Iwabuchi M. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum. Nucleic Acids Res. 1980 Dec 11;8(23):5535–5539. doi: 10.1093/nar/8.23.5535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Komiya H., Kawakami M., Shimizu N., Takemura S. Nucleotide sequences and evolutional aspect of 5S ribosomal RNAs from Lingula and silkworm. Nucleic Acids Symp Ser. 1980;(8):s119–s122. [PubMed] [Google Scholar]
  9. Küntzel H., Heidrich M., Piechulla B. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences. Nucleic Acids Res. 1981 Mar 25;9(6):1451–1461. doi: 10.1093/nar/9.6.1451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Luehrsen K. R., Fox G. E. Secondary structure of eukaryotic cytoplasmic 5S ribosomal RNA. Proc Natl Acad Sci U S A. 1981 Apr;78(4):2150–2154. doi: 10.1073/pnas.78.4.2150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Peattie D. A. Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760–1764. doi: 10.1073/pnas.76.4.1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Pinck L., Pinck M. Sequence homology at the 3'-ends of alfalfa mosaic virus RNAs. FEBS Lett. 1979 Nov 1;107(1):61–65. doi: 10.1016/0014-5793(79)80463-9. [DOI] [PubMed] [Google Scholar]
  13. Stanley J., Vassilenko S. A different approach to RNA sequencing. Nature. 1978 Jul 6;274(5666):87–89. doi: 10.1038/274087a0. [DOI] [PubMed] [Google Scholar]
  14. Tanaka Y., Dyer T. A., Brownlee G. G. An improved direct RNA sequence method; its application to Vicia faba 5.8S ribosomal RNA. Nucleic Acids Res. 1980 Mar 25;8(6):1259–1272. doi: 10.1093/nar/8.6.1259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Tschudi C., Pirrotta V. Sequence and heterogeneity in the 5S RNA gene cluster of Drosophila melanogaster. Nucleic Acids Res. 1980 Feb 11;8(3):441–451. doi: 10.1093/nar/8.3.441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Vandenberghe A., Nelles L., De Wachter R. High-pressure liquid chromatography analysis of oligo- and monoribonucleotide mixtures, with special reference to ribosomal RNA constituents. Anal Biochem. 1980 Sep 15;107(2):369–376. doi: 10.1016/0003-2697(80)90398-x. [DOI] [PubMed] [Google Scholar]
  17. Zasloff M., Ochoa S. A supernatant factor involved in initiation complex formation with eukaryotic ribosomes. Proc Natl Acad Sci U S A. 1971 Dec;68(12):3059–3063. doi: 10.1073/pnas.68.12.3059. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES