Skip to main content

Some NLM-NCBI services and products are experiencing heavy traffic, which may affect performance and availability. We apologize for the inconvenience and appreciate your patience. For assistance, please contact our Help Desk at info@ncbi.nlm.nih.gov.

PLOS ONE logoLink to PLOS ONE
. 2012 Apr 10;7(4):e34622. doi: 10.1371/journal.pone.0034622

Transcriptional Regulation of opaR, qrr2–4 and aphA by the Master Quorum-Sensing Regulator OpaR in Vibrio parahaemolyticus

Yiquan Zhang 1,#, Yefeng Qiu 2,#, Yafang Tan 1, Zhaobiao Guo 1, Ruifu Yang 1, Dongsheng Zhou 1,*
Editor: Partha Mukhopadhyay3
PMCID: PMC3323551  PMID: 22506036

Abstract

Background

Vibrio parahaemolyticus is a leading cause of infectious diarrhea and enterogastritis via the fecal-oral route. V. harveyi is a pathogen of fishes and invertebrates, and has been used as a model for quorum sensing (QS) studies. LuxR is the master QS regulator (MQSR) of V. harveyi, and LuxR-dependent expression of its own gene, qrr2–4 and aphA have been established in V. harveyi. Molecular regulation of target genes by the V. parahaemolyticus MQSR OpaR is still poorly understood.

Methodology/Principal Findings

The bioinformatics analysis indicated that V. parahaemolyticus OpaR, V. harveyi LuxR, V. vulnificu SmcR, and V. alginolyticus ValR were extremely conserved, and that these four MQSRs appeared to recognize the same conserved cis-acting signals, which was represented by the consensus constructs manifesting as a position frequency matrix and as a 20 bp box, within their target promoters. The MQSR box-like sequences were found within the upstream DNA regions of opaR, qrr2–4 and aphA in V. parahaemolyticus, and the direct transcriptional regulation of these target genes by OpaR were further confirmed by multiple biochemical experiments including primer extension assay, gel mobility shift assay, and DNase I footprinting analysis. Translation and transcription starts, core promoter elements for sigma factor recognition, Shine-Dalgarno sequences for ribosome recognition, and OpaR-binding sites were determined for the five target genes of OpaR, which gave a structural map of the OpaR-dependent promoters. Further computational promoter analysis indicated the above regulatory circuits were shared by several other closely related Vibrios but with slight exceptions.

Conclusions/Significance

This study gave a comprehensive computational and characterization of the direct transcriptional regulation of five target genes, opaR, qrr2–4 and ahpA, by OpaR in V. parahaemolyticus. These characterized regulatory circuits were conserved in V. harveyi and V. parahaemolyticus.

Introduction

Bacterial quorum sensing (QS) is a process of population density-dependent cell-to-cell communication through synthesizing, releasing, and detecting signal molecules called autoinducers. The QS systems are widely distributed in Vibrio species that are natural inhabitants in seawater, boundary regions between sea and river, and aquatic products. V. harveyi (a pathogen of fishes and invertebrates) and V. cholerae (the causative agent of the disease cholera) have been used as models for QS studies (summarized or characterized in [1], [2], [3], [4], [5], [6], [7], [8], [9], [10], [11], [12], [13]).

V. harveyi uses three distinct autoinducers, harveyi autoinducer 1 (HAI-1), autoinducer 2 (AI-2), and cholerae autoinducer 1 (CAI-1), which are synthesized by the autoinducer synthases LuxM, LuxS, and CqsA, respectively (Fig. 1). They bind to the membrane-anchoring receptor proteins, LuxN, LuxP/LuxQ, and CqsS, respectively, at the cell surface. V. cholerae uses two known autoinducers CAI-1 and AI-2, rather than HAI-1, since the orthologs of LuxN and LuxM are essentially absent from this bacterium. The association of autoinducers and their receptor proteins triggers a common phosphorylation/dephosphorylation signal transduction cascade involving LuxU and LuxO.

Figure 1. Quorum sensing systems in V. harveyi/V. parahaemolyticus.

Figure 1

The mode for signal transduction during QS in V. harveyi has been described in the text. The feedback regulatory loops are shown with dotted lines. Since all the components of V. harveyi quorum sensing appears to be intact in the V. parahaemolyticus genome [16], the QS signal transduction cascades should be conserved in V. harveyi and V. parahaemolyticus.

At low cell density (LCD) (Fig. 1), the autoinducers are absent or at low concentrations, and the receptors autophosphorylate and then transfer phosphate to the phosphorelay protein LuxU that in turn shuttles phosphate to the transcriptional factor LuxO. The phosphorylated LuxO (LuxO-P) in combination with the sigma factor σ54 activates the transcription of the genes encoding regulatory small RNAs (sRNAs), Qrr1–4. The Qrr sRNAs accompanying with the RNA-binding protein Hfq in turns inhibit the translation of the mRNA of the master QS regulator (MQSR), e.g., LuxR in V. harveyi, and HapR in V. cholerae, which leads to the ceased production of MQSR. The over-production of Qrr sRNAs and LuxO-P triggers three feedback regulatory loops: i) LuxO-P represses the transcription of its own gene, ii) Qrr sRNAs inhibits the translation of luxO, and iii) Qrr sRNAs repress the translation of luxMN encoding LuxM and its cognate receptor LuxM; these feedbacks will contribute to control the Qrr levels within physiological states, since the qrr expression requires the signal transduction among LuxO, LuxM, and LuxN.

At high cell densities (HCD) (Fig. 1), the accumulated autoinducers bind to their receptors, and convert the receptors to phosphatases, thereby reversing the phosphate flow and triggering the dephosphorylation of LuxU and LuxO. Dephosphorylated LuxO cannot activate the qrr transcription. Existing Qrr sRNAs are rapidly turned over, as Hfq-dependent sRNAs are degraded stoichiometrically with their target mRNAs. In the absence of the Qrr sRNAs, the MQSR mRNA is translated, and MQSR is produced abundantly to act as either a transcriptional activator or a repressor for its target genes. Overproduced MQSR will feed back to repress its own transcription.

MQSR is able to activate the transcription of qrr genes, and this MQSR-qrr feedback loop (Fig. 1) in turns leads to the rapid down-regulation of MQSR gene. The efficient stimulation of qrr genes requires the simultaneous presence of LuxO-P (abundant only at LCD) and MQSR (abundant only at HCD). LuxO-P and MQSR are thought to be simultaneously present immediately following the switch from HCD to LCD. Therefore, the above negative feedback loop dramatically accelerates the transition HCD to LCD, but it has no effect on the QS behaviors at steady-state LCD or HCD.

The above five negative feedback loops control the integration of multiple signals, and maintain the signal transmission fidelity of QS through affecting the input-output dynamic range of signal transmission and modulating the noise in the output [13].

V. parahaemolyticus is a leading cause of infectious diarrhea and enterogastritis via the fecal-oral route [14]. Human infections occur mainly due to the ingestion of this pathogen in raw or undercooked seafood. V. harveyi, V. parahaemolyticus, and six additional closely related species (V. alginolyticus, V. campbellii, V. rotiferianus, V. natrigens, V. mytili, and V. azureus) constitute the Harveyi clade that is a subset of the Vibrio core group [15]. All the components of the V. harveyi QS system can be annotated to be intact in the genome V. parahaemolyticus [16]. Thus, the signal transduction cascades of QS should be conserved in V. harveyi and V. parahaemolyticus (Fig. 1).

The V. parahaemolyticus OpaR [17] is the ortholog of the V. harveyi LuxR. The opaR gene (VP2516) [16] is composed of an open reading frame (ORF) containing 615 nucleotides with a G+C content of 44.55%, and it encodes a deduced protein of 204 amino acids (a.a.) with a calculated molecular mass of 23634.01 Da and with an isolectric point of 5.96. Regulation of target genes by OpaR in V. parahaemolyticus is still poorly understood. In the present work, the consensus constructs were built to represent the conserved cis-acting signals recognized by the four extremely conserved MQSR proteins, V. parahaemolyticus OpaR, V. harveyi LuxR, V. vulnificus SmcR, and V. alginolyticus ValR, which was followed by a comprehensive molecular characterization of the transcriptional regulation of five target genes, opaR, qrr2–4 and ahpA, by OpaR in V. parahaemolyticus.

Materials and Methods

Bacterial strains

The wild-type V. parahaemolyticus strain RIMD 2210633 (WT) is a pandemic O3:K6 strain isolated from a patient with traveler's diarrhea in Japan in 1996 [16]. The null opaR mutant derived from WT and the corresponding complemented mutant are described below. For the common bacterial growth and maintenance, bacteria were cultured in Luria-Bertani (LB) broth or LB agar with addition of 2% NaCl at 37°C, and chloramphenicol was added at 5 µg/ml when needed. For the longtime storage, bacteria were stored in Difco™ Marine (MR) broth 2216 (BD Bioscience) with addition of 30% glycerol at −85°C.

Construction of the opaR null mutant

The entire coding region of opaR was deleted from RIMD 2210633 to generate the opaR null mutant strain ΔopaR, using the suicide plasmid pDS132 [18] by introducing homologous recombination as previously described [19], [20]. Briefly, the 414 and 457 bp DNA regions upstream and downstream of opaR, respectively, were amplified by PCR, purified, and used as the templates to create a 871 bp deletion construct, through PCR, which was subsequently inserted between the PstI and SphI sites of pDS132. This generated a recombinant vector that contained the deletion construct and the sacB gene conferring sensitivity to sucrose. All the primers used in the present work were listed in Table 1. Upon verification by DNA sequencing, the recombinant vector was introduced into Escherichia coli S17-1(pir), and then transferred into RIMD 2210633 by conjugation. The mutant strain was selected using resistance to 10% sucrose and sensitivity to chloramphenicol, and further verified by PCR.

Table 1. Oligonucleotide primers used in this study.

Target Primers (forward/reverse, 5′-3′)
Construction of mutant
opaR GTGACTGCAGACTGCCTTGGTAACGCTCTG/GTTCGTGTTCAAATCTGAGCTATCCATTTTCCTTGCCATTTG
CAAATGGCAAGGAAAATGGATAGCTCAGATTTGAACACGAAC/GTGAGCATGCATGGGCTGCATCAGGTCG
GTGACTGCAGACTGCCTTGGTAACGCTCTG/GTGAGCATGCATGGGCTGCATCAGGTCG
Complementation of mutant
opaR GCGGGATCCTCCATCGTGTTGCCGTAGC/GCGAAGCTTGCGAAAGCAGAAGGCATCAAG
Protein expression
opaR AGCGGGATCCATGGACTCAATTGCAAAGAG/AGCGAAGCTTTTAGTGTTCGCGATTGTAG
EMSA
opaR TGTGGGTTGAGGTAGGTCG/GCCTAGTTCTAGGTCTCTTTGC
qrr2 AGTGGTTGCTTATGAATC/GGTCGAGAAGTATTATGC
qrr3 GGATAAGTTCAAATTGGATC/GTGGTTTCTGTGACATAC
qrr4 AACCGTGAAATCCATTTAC/CGACGCATTATTAACCAG
aphA AACTTCCAACCACATAATTGCG/GGCTGGAGCAGGTATGATTG
DNase I footprinting
opaR AGTGGGTTGAAAGTCACATCC/GCCTAGTTCTAGGTCTCTTTGC
qrr2 AGTGGTTGCTTATGAATC/GGTCGAGAAGTATTATGC
qrr3 GGATAAGTTCAAATTGGATC/GTGGTTTCTGTGACATAC
qrr4 AACCGTGAAATCCATTTAC/CGACGCATTATTAACCAG
aphA AACTTCCAACCACATAATTGCG/GGCTGGAGCAGGTATGATTG
Primer extension
opaR /ATCCATTTTCCTTGCCATTTG
qrr2 /TTATTGTGAACAATCTATAT
qrr3 /AATCAAGTTCACTAACAAC
qrr4 /ATATACTTGTGAACAATGTG
aphA /GCTCTTACTGGCGCTTGAG

Complementation of ΔopaR

For complementation of the ΔopaR mutant, a PCR-generated DNA fragment containing the opaR coding region together with its promoter region (539 bp DNA region upstream of the coding sequence) and transcriptional terminator region (327 bp DNA region downstream) were cloned between the SalI and SphI sites of the vector pBRMob (kindly proved by Prof. Hin-chung Wong from Taiwan Soochow University) which is the ligation product of a 3219 bp fragment (containing the RP4 mob DNA region for plasmid mobilization) from pDS132 digested with HindIII, and the HindIII-digested plasmid pBR328 (harboring a chloramphenicol resistance gene) [21]. The recombinant plasmid, verified by DNA sequencing, was subsequently introduced into ΔopaR, yielding the complemented mutant strain C-opaR.

Bacterial growth and RNA isolation

The glyceric stock of bacterial cells was inoculated into 5 ml of the MR broth for growing at 30°C with shaking at 200 rpm for 24 h. The cell culture was 40-fold diluted with the PBS buffer (pH 7.2), and then 150 µl of the diluted cells were spread onto a HI plate [2.5% Bacto heart infusion (BD Bioscience), and 1.5% bacteriological grade agar] with a diameter of 5 cm. After 8 h of growth at 30°C, cells were harvested from the plate by adding the mixture of 1.5 ml of RNAprotect (Qiagen) and 0.5 ml of PBS. Bacterial cultivations were done at least in triplicate (at least three biological replicates) for each strain.

Total bacterial RNAs were extracted using the TRIzol Reagent (Invitrogen) [22], [23], [24]. RNA quality was monitored by agarose gel electrophoresis, and RNA quantity was determined by spectrophotometry.

Primer extension assay

For the primer extension assay [22], [23], [24], an oligonucleotide primer complementary to a portion of the RNA transcript of each indicated gene was employed to synthesize cDNAs from the RNA templates. About 10 µg of the total RNA from each strain was annealed with 1 pmol of [γ-32P] end-labeled reverse primer using a Primer Extension System (Promega) according to the manufacturer's instructions. The same labeled primer was also used for sequencing with the fmol® DNA Cycle Sequencing System (Promega). The primer extension products and sequencing materials were concentrated and analyzed in a 6% polyacrylamide/8 M urea gel. The result was detected by autoradiography (Kodak film).

Preparation of purified OpaR protein

Preparation of the purified OpaR protein was performed as previously described [22], [23], [24]. The entire coding region of the opaR gene of strain RIMD 2210633 was directionally cloned between the BamHI and HindIII sites of plasmid pET28a (Novagen). The recombinant plasmid encoding the 6× His-tagged OpaR protein (His-OpaR) was transformed into Escherichia coli BL21λDE3 cells. Expression of His-OpaR was induced by the addition of 1 mM IPTG (isopropyl-b-D-thiogalactoside). The overproduced protein was purified under native conditions using an Ni-NTA Agarose Column (Qiagen). The purified protein was concentrated with the Amicon Ultra-15 centrifugal filter device (Millipore), and the protein purity was verified by SDS-PAGE.

Gel mobility shift assay (EMSA)

The 300 to 600 bp promoter-proximal region of each indicated gene was amplified by PCR. For EMSA [22], [23], [24], the 5′ ends of DNA were labeled using [γ-32P] ATP and T4 polynucleotide kinase. DNA binding was performed in a 10 µl reaction volume containing binding buffer [1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 10 mM Tris-HCl (pH 7.5) and 0.05 mg/ml poly-(dI-dC)], labeled DNA (1000 to 2000 c.p.m/µl), and increasing amounts of the His-OpaR protein. Three controls were included in each EMSA experiment: 1) cold probe as specific DNA competitor (the same promoter-proximal DNA region unlabeled), 2) negative probe as nonspecific DNA competitor (the unlabeled coding region of the 16S rRNA gene), and 3) nonspecific protein competitor [rabbit anti-F1-protein polyclonal antibodies]. The F1 protein is the protective antigen from Yersinia pestis [25]. After incubation at room temperature for 30 min, the products were loaded onto a native 4% (w/v) polyacrylamide gel, and electrophoresed in 0.5× TBE buffer for about 50 min at 220 V. Radioactive species were detected by autoradiography after exposure to Kodak film at −70°C.

DNase I footprinting

For DNase I footprinting [22], [23], [24], the 250 to 600 bp promoter-proximal DNA regions with a single 32P-labeled end were PCR amplified with either the sense or antisense primer being end-labeled. The PCR products were purified using the QiaQuick columns (Qiagen). Increasing amounts of His-OpaR were incubated with the purified, labeled DNA fragment (2 to 5 pmol) for 30 min at room temperature, in a final 10 µl reaction volume containing the binding buffer used in EMSA. Before DNA digestion, 10 µl of Ca2+/Mg2+ solution (5 mM CaCl2 and 10 mM MgCl2) was added, followed by incubation for 1 min at room temperature. The optimized RQ1 RNase-Free DNase I (Promega) was then added to the reaction mixture, and the mixture was incubated at room temperature for 40 to 90 s. The reaction was quenched by adding 9 µl of stop solution (200 mM NaCl, 30 mM EDTA, and 1% SDS), followed by incubation for 1 min at room temperature. The partially digested DNA samples were extracted with phenol/chloroform, precipitated with ethanol, and analyzed in 6% polyacrylamide/8 M urea gel. Protected regions were identified by comparison with the sequence ladders. For sequencing, we used the fmol® DNA Cycle Sequencing System (Promega). The templates for sequencing were the same as the DNA fragments of DNase I footprinting assays. Radioactive species were detected as previously described.

Computational promoter analysis

The 300 bp promoter regions upstream of the start codon of each indicated gene were retrieved with the ‘retrieve-seq’ program [26]. Known or predicted binding sites of OpaR and its orthologs were collected and aligned to generate the position frequency matrix (PFM) by using the ‘matrices-consensus’ tool [26].The sequence logo representation of the above binding sites was generated by the WebLogo tool [27]. The ‘matrices-paster’ tool [26] was used to match the PFM within the promoter-proximal DNA regions.

Results

Phylogeny of OpaR and its orthologs

The OpaR regulator shares high identity (≥70%) in a.a. sequences with the orthologous MQSRs in other six Vibrio species tested (V. alginolyticus ValR, V. harveyi LuxR, V. vulnificus SmcR, V. tubiashii VtpR, V. anguillarum VanT, and V. cholerae HapR). A phylogenetic tree (Fig. 2) was constructed from the aligned a.a. sequences of the above seven orthologous MQSR proteins, with an additional regulator LitR from V. fischeri [28] as the outgroup (LitR has about 60% identity to the above seven MQSRs; all these eight proteins are belonged to the TetR-family DNA-binding regulators), which revealed that LuxR, OpaR, SmcR, and ValR constituted the most closely related group (>92% identity between each other).

Figure 2. Phylogenetic tree of OpaR and its orthologs.

Figure 2

Protein sequences were derived from V. alginolyticus ZJ-51 [60], V. parahaemolyticus RIMD 2210633 [16], V. harveyi ATCC BAA-1116 [61], V. vulnificus YJ016 [62], V. tubiashii RE22 [63], V. anguillarum 775 [64], V. cholera N16961 [65], and V. fischeri MJ11 [66]. The a.a. sequences were aligned by the CLUSTALW [67] web server at http://align.genome.jp/. The aligned sequences were then used to construct an unrooted neighbor-joining tree using the MEGA version 5.0 [68] with a bootstrap iteration number of 1000. Shown on the branch points of phylogenic tree were the bootstrap values (%).

The MQSR consensus

Since the four DNA-binding regulatory proteins LuxR, OpaR, SmcR, and ValR were extremely conserved, they should recognize the same conserved signals within their target promoters in V. harveyi, V. parahaemolyticus, V. vulnificus, and V. alginolyticus. Known or predicted binding sites of LuxR, OpaR, SmcR, and ValR (Table 2) were collected, and then aligned to generate the MQSR consensus that manifested as a PFM (in which each row and column represents a position and a nucleotide, respectively) and as a 20 bp invert-repeat sequence TATTGATAAA-TTTATCAATA termed as the MQSR box (Fig. 3).

Table 2. Known or predicted direct targets of OpaR or its orthologs.

Gene name Gene ID Consensus-like sequence Position& Score Reference Regulation
V. harveyi ATCC BAA-1116
luxR VIBHAR_03459 TAATGACATTACTGTCTATA D-71…-52 9.99 [29] $
AACTATTAAAATAATCAATT D-152…-133 10.93 [29] $
qrr2 VIBHAR_04846 TGATGATTTATTTATCACTT D-165…-146 7.62 [7] #
qrr3 VIBHAR_05322 AGTTAATTAATTCATCATTA D-151…-132 8.02 [7] #
qrr4 VIBHAR_06697 TTCTGATAAATGTATTAGTA D-167…-148 9.34 [7] #
aphA VIBHAR_00046 TATTGAGTATTTTATTAGTT D-281…-262 12.04 [30] $
exsB VIBHAR_01694 TTTTAATAAAAAGATAAGTA D-135…-116 6.45 [31] $
qrgB VIBHAR_00176 TATTGATTGTGAACTCAATA D-98…-79 10.25 [3], [30] $
luxC VIBHAR_06244 TACAAATAACATTAATAATT D-275…-256 8.49 [58] #
TATAAATAAATCAAACTATA D-151…-132 8.88 [58] #
argA VIBHAR_03295 AATTGAATAAGAAGACAATA D-64…-45 6.6 [59] #
V. parahaemolyticus RIMD 2210633
opaR VP2516 TAATGACATTACTGTCTATA D-149…-130 9.99 This study $
AATTATTAAAATAATCAATT D-68…-49 11.29 This study $
qrr2 VPA1623–1624 intergenic GACTAACTCAATTGTTAATA D-167…-148 7.8 This study #
qrr3 VPA1240–1241 intergenic TGTTTATTAATCAATCATTA D-150…-131 8.5 This study #
qrr4 VPA0199–0200 intergenic TGCTGAGAAAGTGATTAGTA D-167…-148 8.16 This study #
aphA VP2762 TATTGAGTATTATGTTAGTT D-279…-260 10.68 This study $
V. vulnificus YJ016
smcR VV2770 TATTGACATTACTGTTCATT D-158…-139 8.56 Predicted $
AATTATTAAAACAATCAATA D-78…-59 11.33 Predicted $
qrr3 TATAAATAGATTTATTATTA D-191…-172 10.79 Predicted #
aphA VV3005 TATTGAGCATTTTGTTAGTT D-278…-259 10.50 Predicted $
V. alginolyticus ZJ-51
valR TAATGACATTACTGTATATA D-146…-127 7.60 Predicted $
AACTATTAAAATAATCAATT D-65…-46 10.93 Predicted $
&

, ‘D’ indicates the direct sequence, and minus numbers denote nucleotide positions upstream of genes.

Negative ($) or positive (#) regulation by LuxR or its relevant ortholog.

Figure 3. MQSR consensus constructs.

Figure 3

(a) The sequence logo representation of the binding sites of OpaR and its orthologs (Table 2) was generated by the WebLogo tool [27]. The 20-bp consensus box TATTGATAAA-TTTATCAATA was annotated as an inverted repeat sequence. (b) A position frequency matrix describes the alignment of the binding sites, and denotes the frequency of each nucleotide at each position.

LuxR-dependent expression of its own gene [29], qrr2–4 [7], and aphA [30] have been established in V. harveyi. The presence of MQSR box-like sequences within the upstream DNA regions of the corresponding target genes in V. parahaemolyticus, as revealed by the computational promoter analysis (Table 2), indicated that the above regulatory cascades were conservatively controlled by the LuxR ortholog OpaR in V. parahaemolyticus, which were further validated by the following biochemical experiments.

Mutation and complementation of opaR

Real-time RT-PCR experiments were performed to assess the relative mRNA levels of opaR in WT, ΔopaR, and C-opaR; the opaR transcript was lacking in ΔopaR, but was restored in C-opaR relative to WT (data not shown), indicating the successful mutation of opaR and the complementation of the opaR mRNA level.

As determined by several distinct methods (see below), the ahpA gene was negatively regulated by OpaR. To test whether the opaR mutation had the polar effect, the primer extension assays were conducted to detect the yield of the primer extension product of ahpA that represented the ahpA mRNA levels in WT, ΔopaR, and C-opaR. Herein, the ahpA mRNA level was significantly enhanced in ΔopaR relative to WT, while no obvious change in the ahpA transcription was observed between WT and C-opaR (Fig. S1). This analysis confirmed that the detecting enhanced transcription of ahpA in ΔopaR was due to the opaR mutation rather than a polar effect.

Growth of WT and ΔopaR

The growth curves of WT and ΔopaR grown at 30°C in the MR broth or in the HI broth were determined (Fig. 4). The two strains showed indistinguishable growth rates in each of the media. Thus, the opaR mutation had no effect on the bacterial in vitro growth.

Figure 4. Growth curves.

Figure 4

A two-round design of bacterial seed cultivation was employed: first, the glyceric stock of bacteria was inoculated into 15 ml of the MR or HI broth for growing at 30°C for 24 h with shaking at 200 rpm, and the cell culture was subsequently diluted to an OD600 value of about 1.0; second, the resulting culture was then 50-fold diluted into 15 ml of corresponding fresh MR or HI broth, and allowed to grow to reach an OD600 value of about 1.2 to 1.4. The bacterial seeds were 50-fold diluted into 15 ml of corresponding fresh MR or HI broth for further cultivation, and the OD600 values were monitored for each culture with a 1 h interval. Experiments were done in triplicate.

For the following molecular regulation experiments, bacteria were pre-cultivated in the MR broth, spread onto grown on the HI agar plates for further growth, and harvested after an 8 h incubation at 30°C [at this status, the dense bacterial lawns (i.e. HCD) were observed on the agar]. It was thought that, unlike the liquid cultivation for which the autoinducers would disperse into the liquid media, the cultivation on solid medium would enable the enrichment of autoinducer molecules within the bacterial lawns with little dispersal into the agar.

Negative auto-regulation of OpaR

The primer extension experiments (Fig. 5a) were conducted to compare the yields of primer extension product of opaR in WT and ΔopaR. The primer extension assay detected a single transcription start site located at 74 bp upstream of opaR; therefore, a single promoter was transcribed for opaR under the growth condition tested. In addition, the opaR promoter activity was under the negative control of OpaR. A 334 bp promoter-proximal region of opaR was amplified, radioactively labeled, and subjected to EMSA with a purified His-OpaR protein (Fig. 5b). The results showed that His-OpaR was able to bind to this DNA fragment in a dose-dependent manner in vitro. As further determined by DNase I footprinting (Fig. 5c), the purified His-OpaR protein protected two distinct regions upstream of opaR against DNase I digestion in a dose-dependent manner. These two footprints, located from 70 to 40 bp (site 1) and from 159 to 109 bp (site 2) upstream of opaR, respectively, were considered as OpaR-binding sites. Taken together, OpaR is able to recognize the promoter of its own gene to directly repress its activity in V. parahaemolyticus.

Figure 5. Repression of its own gene by OpaR.

Figure 5

a) Primer extension. An oligonucleotide primer was designed to be complementary to the RNA transcript of opaR. The primer extension products were analyzed with 8 M urea-6% acrylamide sequencing gel. Lanes C, T, A, and G represent the Sanger sequencing reactions. The transcription start site of opaR was underlined in the DNA sequence. b) EMSA. The radioactively labeled DNA fragment from the 300th bp upstream to the 34th bp downstream of opaR was incubated with increasing amounts of purified His-OpaR protein, and then subjected to 4% (w/v) polyacrylamide gel electrophoresis. The band of free DNA disappeared with increasing amounts of His-OpaR protein, and a retarded DNA band with decreased mobility turned up, which presumably represented the DNA-OpaR complex. Shown on the lower side of the figure was the schematic representation of the EMSA design. c) DNase I footprinting. Labeled coding or non-coding DNA probes were incubated with increasing amounts of purified His-OpaR (Lanes 1, 2, 3, and 4 containing 0, 6, 9, and 12 pmol, respectively), and subjected to DNase I footprinting assay. Lanes G, A, T, and C represented the Sanger sequencing reactions. The footprint regions were indicated with vertical bars. The negative or positive numbers indicated the nucleotide positions upstream or downstream of opaR, respectively.

Stimulation of qrr2–4 by OpaR

The primer extension assay (Fig. 6a) defined the transcription start sites the three sRNA genes qrr24, and this assay also indicated that the promoter activity of all the thee qrr genes was under the positive control of OpaR. Each of the promoter-proximal regions of qrr2–4 was subjected to EMSA with the purified His-OpaR protein (Fig. 6b). The results showed that His-OpaR was able to bind to each of the three DNA fragments tested in a dose-dependent manner in vitro. As further determined by DNase I footprinting (Fig. 6c), His-OpaR protected a single region within each of the three upstream DNA fragments tested against DNase I digestion in a dose-dependent manner. These footprints, located from 172 to 143 bp, from 154 to 125 bp, and from 204 to 133 bp upstream of qrr2–4, respectively, were considered as OpaR-binding sites for these three genes. Taken together, OpaR is able to recognize the promoters of qrr2–4 to activate their activity in V. parahaemolyticus.

Figure 6. Stimulation qrr2–4 by OpaR.

Figure 6

For primer extension (a1, b1, and c1), an oligonucleotide primer was designed to be complementary to the RNA transcript of each of qrr2–4. For EMSA (a2, b2, and c2) and DNase I footprinting (a3, b3, and c3), the upstream DNA fragments of qrr2–4 were radioactively labeled, and then incubated with increasing amounts of purified His-OpaR protein. The experiments were done as described in Fig. 5. The transcription start sites of qrr2–4 were underlined in the DNA sequence. Lanes G, A, T, and C represented the Sanger sequencing reactions. The footprint regions were indicated with vertical bars. The negative or positive numbers indicated the nucleotide positions upstream or downstream of relevant qrr gene, respectively.

Repression of aphA by OpaR

The primer extension assay (Fig. 7a) detected two closely neighboring extension products for aphA. Due to the facts that the shorter extension product might represent the premature stops due to the difficulty of polymerase in passing difficult sequences, and that the core promoter elements recognized by sigma factors could not be identified for the shorter extension product, only the longer product was chosen for the identification of the transcription start site that was located at 200 bp upstream of aphA. Therefore, a single promoter was transcribed for aphA under the growth condition tested, and its activity was under the negative control of OpaR. A 541 bp promoter-proximal region of aphA was subjected to EMSA with the purified His-OpaR protein (Fig. 7b). The results showed that His-OpaR was able to bind to the DNA fragment in a dose-dependent manner in vitro. As further determined by DNase I footprinting (Fig. 7c), His-OpaR protected a single region from 284 to 255 bp upstream of opaR against DNase I digestion in a dose-dependent manner. This footprint was considered as the OpaR-binding site for aphA. Taken together, OpaR is able to recognize the promoter of aphA to repress its activity in V. parahaemolyticus.

Figure 7. Repression of aphA by OpaR.

Figure 7

For primer extension (a), an oligonucleotide primer was designed to be complementary to the RNA transcript of aphA. For EMSA (b) and DNase I footprinting (c), the DNA fragment from the 380th to 161th bp upstream of aphA was incubated with increasing amounts of purified His-OpaR protein. The experiments were done as described in Fig. 5. The transcription start site of aphA were underlined in the DNA sequence. Lanes G, A, T, and C represented the Sanger sequencing reactions. The footprint regions were indicated with vertical bars.. The minus numbers indicated the nucleotide positions upstream of aphA.

Discussion

Regulation of biofilm formation and virulence by Vibrio MQSRs

The V. harveyi LuxR mediates the repression of virulence determinant type III secretion system 1 (T3SS1) [31] and the stimulation of bioluminescence encoded by the luxCDABEGH operon [32]. LuxR binds to the upstream DNA region of luxCDABEGH, and thus stimulates this operon in a direct manner [32]; in contrast, LuxR indirectly represses the T3SS1 genes via directly repressing of exsA, a transcriptional activator of T3SS1, within the T3SS1 gene loci [31].

The V. cholerae HapR is a repressor of virulence: i) HapR directly represses the transcription of aphA [33] encoding a regulator [34] that in turns stimulates the expression of toxin-coregulated pilus; and ii) HapR inhibits the hemolytic activity at both transcriptional and posttranslational levels [35] (for the former mechanism, HapR directly represses the transcription of the hemolysin gene hlyA; for the later one, HapR directly stimulates the transcription of hapA encoding a metalloprotease that in turns degrades the HlyA hemolysin). HapR is also a repressor of biofim formation in V. cholerae [36]: i) HapR directly inhibits the transcription of vpsT encoding a transcriptional activator of biofilm formation; and ii) HapR represses the cellular c-di-GMP levels (c-di-GMP in turns acts as a posttranscriptional activator of the biofilm formation [37]) through directly modulating the transcription of multiple genes encoding GGDEF and EAL proteins.

The V. vulnificus SmcR is a repressor of cytotoxicity [38] that is important for the virulence of V. vulnificus and mainly dependent on two cytotoxins, RTX (encoded by rtxA1) and cytolysin/hemolysin (encoded by vvhA) [39], [40]. The transcription of rtxA1 and vvhA is repressed by SmcR through directly repressing the transcription of hlyU [38], an activator of rtxA1 and vvhA [40], [41]. SmcR-dependent expression of the metalloprotease gene vvpE is also found in V. vulnificus [42]; the two regulators cAMP receptor protein (CRP) and SmcR bind to the upstream region of vvpE in a juxtapositioned manner, and thus they function synergistically to coactivate the transcription of vvpE by the RpoS-dependent promoter at the stationary growth phase [42]. Whether the SmcR-dependent stimulation of metalloprotease contributes to the degradation of relevant protein toxins is still unclear in V. vulnificus.

The V. parahaemolyticus OpaR is a repressor of cytotoxicity to host cells [43], most likely through inhibiting the assembly/secretion of the cytotoxicity determinant T3SS1 [43], [44]. OpaR appears to repress biofilm formation through directly modulating the transcription of multiple genes encoding GGDEF and EAL proteins in pandemic O3:K6 V. parahaemolyticus (data unpublished). The molecular mechanisms employed by OpaR to regulate biofilm formation and virulence need to be elucidated.

Biofilm formation can be concisely linked to the bacterial survive in adverse conditions outside of the host, thus aiding in bacterial persistence during inter-epidemic seasons [45]. As shown in V. cholerae [45], [46], both intact and dispersed biofilms enhance the bacterial infectivity upon oral ingestion. Based on the previous speculations for V. cholerae [36], [47], [48], [49], a model of regulation of biofilm formation and virulence by QS during intestinal infection of pathogenic Vibrios is proposed herein: on the initial colonization (i.e., LCD) of a host, the expression of the MQSRs was inhibited by the Qrr sRNAs, and thus the expression of the biofilm formation and virulence genes occurs, which promotes the bacterial colonization and infection. When a HCD is reached, the MQSRs are abundantly produced, and thus inhibit biofilm formation and virulence in both direct (via control of structural genes) and indirect (via modulation of regulatory determinants) manners.

Conserved cis-acting DNA signals recognized by MQSRs

Two consensus constructs, a box and a PFM, (Fig. 3) were built to represent the conserved cis-acting signals recognized by the four extremely conserved MQSR proteins, V. harveyi LuxR, V. parahaemolyticus OpaR, V. vulnificus SmcR, and V. alginolyticus ValR. These consensus constructs could be also applied to all the other members of the Harveyi clade in addition to the above four bacteria.

The 20 bp MQSR box was further annotated as an inverted repeat sequence. This dyad symmetry structure indicated that LuxR, OpaR, SmcR, and ValR, like other TetR-type proteins, bind to cis-acting regulatory DNA as a dimer. The box is a contiguous oligonucleotide, and thus it presents limited information that are originally presented in the MQSR-binding sites. Representation of the cis-acting regulatory motif with a PFM is able to give a much more comprehensive description of the uneven composition in each position, i.e., some nucleotides occurred much more frequently than others. Thus, the PFM presentedd here will over-represent the MQSR-binding sites more accurately than the 20 bp box sequence.

The PFM can be used to statistically predict the presence of MQSR consensus-like elements within the promoter-proximal sequences tested, which will generate a weight score for each gene, and a higher score denoted the higher probability of regulator-promoter association (Table 2). This assay was applied to the OpaR regulon members previously determined by microarray [43], when a frequently-used cutoff number of 7 was set for the score values, disclosing a set of candidates of direct OpaR targets (data not shown) in V. parahaemolyticus for further biochemical validation.

The PFM construct herein is essentially in agreement with those previously characterized for LuxR in V. harveyi [30] and SmcR in V. vulnificus [50]. A major difference is that the PFM of this study was constructed from the cis-acting DNA sequences from four closed related Vibrios, rather than from the artificial sequences [30], [50]. It was deemed that the PFM herein would enable the more accurate prediction of novel MQSR box-like sequences.

Autoregulation of MQSRs

Direct transcriptional repression of their own genes have been established for LuxR [29], HapR [51], VanT [52], and OpaR (this study). The promoter-proximal regions of valR, opaR, luxR, smcR, vtpR, vanT, and hapR were aligned in Fig. 8a, in which shown were translation and transcription starts, −35 and −10 core promoter elements for σ70 recognition, Shine-Dalgarno (SD) sequences for ribosome recognition, and MQSR box-like sequences representing the conserved signals for recognition by OpaR or its orthologs. This analysis gave a structural map of these auto-repressed promoters.

Figure 8. Organization of promoter DNA regions.

Figure 8

DNA sequences were derived from V. alginolyticus ZJ-51 [60], V. parahaemolyticus RIMD 2210633 [16], V. harveyi ATCC BAA-1116 [61], V. vulnificus YJ016 [62], V. tubiashii RE22 [63], V. anguillarum 775 [64], V. cholera N16961 [65], and V. fischeri MJ11 [66]. Shown were translation and transcription starts, SD sequences, MQSR box-like sequences, and −10/−12 and −35/−24 core promoter elements.

Two MQSR box-like sequences, upstream and downstream of the transcription start site, respectively, were annotated for valR, opaR, luxR, or smcR, indicating that two sites were recognized by the relevant regulatory protein for each target gene. Indeed, corresponding two binding sites have been experimentally determined for opaR (this study) or luxR [29]. Only one MQSR box-like sequence downstream of the transcription start site was annotated for vtpR, vanT, or hapR, indicating a single site within each of these promoter-proximal regions were recognized by the relevant regulatory protein; without no exception, a single corresponding HapR-binding site has been detected for hapR [51]. Notably, the MQSR box-like sequences downstream of the transcription start site were conservatively located within all the target promoter regions aligned, and the MQSR-promoter DNA association would block the entry of the RNA polymerase to repress the transcription of the target genes.

Regulation of Qrr sRNAs genes by MQSRs

All of the three closely related organisms V. harveyi, V. parahaemolyticus, and V. vulnificus contain qrr1–5, and whereas, the more distantly related V. cholerae harbors only qrr1–4. Any one of Qrr1–4 in V. cholerae is perfectly sufficient to repress hapR, and thus, the four Qrr sRNAs are functionally redundant [2], [11]. Qrr1–4 but not Qrr5 are functional in V. harveyi, and Qrr5 may be an evolutionary vestige [4]. Unlike in V. cholerae, Qrr1–4 in V. harveyi function additively to control QS behaviors; these sRNAs function to translate increasing autoinducer concentrations (following the transition from LCD to HCD) into a precise gradient of LuxR protein, and that LuxR in turns induces a gradient of expression its target genes [4]. Functions of Qrr sRNAs in V. parahaemolyticus and V. vulnificus need to be elucidated.

As mentioned above, the LuxR- or OpaR-mediated stimulation of qrr transcription constitutes a negative feedback loop most likely maintaining the QS behaviors during the transition HCD to LCD [7], [8]. The V. harveyi LuxR directly binds to the upstream DNA regions of qrr2–4 and stimulates the transcription of qrr2–4, but it has no regulatory effect on qrr1 and qrr5 [7]. In this work, we confirmed that V. parahaemolyticus OpaR also bound to the promoter regions of qrr2–4 to activate their transcription. To the best of our knowledge, this is the first report of experimentally determining MQSR-binding sites and transcription starts of qrr genes. It should be noted the experimental transcription starts of qrr genes (this study) are 1 bp downstream of the predicted ones [2].

MQSR box-like sequences were found within the promoter-proximal regions of qrr2–4 in V. harveyi and V. parahaemolyticus, and of qrr3 in V. vulnificus (but not qrr2 and qrr4 of V. vulnificus). In addition, the box elements could not be predicted from qrr1 and qrr5 of all these three closely related Vibrios. These indicated that the MQSR-qrr2–4 feedback loop was conversed between V. harveyi and V. parahaemolyticus. We aligned the promoter-proximal regions of qrr2–4 (Fig. 8a) from V. harveyi, V. parahaemolyticus, and V. vulnificus, depicting translation and transcription starts, −24 and −12 core promoter elements for σ45 recognition, and MQSR box-like sequences (Fig. 8c). Since MQSR box-like sequences are upstream of the promoter −24 elements, the MQSR-stimulated qrr promoters may have a class I regulation that depends on the RNA polymerase α subunit C-terminal domain for function [53].

Unlike in V. harveyi, the V. cholerae HapR stimulates the transcription of all the qrr1–4 in an indirect manner, since none of the binding of HapR to the qrr upstream regions can be detected [8]. As expected, MQSR box-like sequences could not be predicted from the upstream regions of all of qrr1–4 in V. cholerae.

Regulation of aphA by MQSRs

The AphA regulator is required for auto-repression [33], intestinal colonization and virulence [34], [54], biofilm formation [55], [56] in V. cholerae. In addition, as previously summarized [57], AphA and LuxR/HapR reciprocally control QS behaviors in V. harveyi and V. cholerae. At LCD, redundant Qrr sRNAs promote the AphA translation and meanwhile inhibit the LuxR translation. AphA further directly represses the luxR transcription, and also feeds back to repress the qrr transcription. At HCD, the cessation of Qrr sRNA production leads to no production of AphA, and the LuxR translation occurs. LuxR in turns directly represses the aphA transcription, and also feeds back to inhibit it own expression. Thus, AphA acts as a master regulator of QS behaviors at LCD, and in contrast, LuxR/HapR is the major one operating at HCD; the reciprocal gradients of AphA and LuxR/HapR are thought to be established for controlling the gene expression patterns during the transition between LCD and HCD [57].

The transcription of aphA is directly repressed by LuxR in V. harveyi [30] and by HapR V. cholerae [33], [48], and moreover HapR-binding site and transcription start have been determined for aphA in V. cholerae [48]. This study also detected the direct transcriptional repression of aphA by OpaR with the determination of transcription start and OpaR-binding site for aphA in V. parahaemolyticus. The alignment of the upstream regions of aphA from V. harveyi, V. parahaemolyticus, V. vulnificus and V. cholerae indicated that these four bacteria employed a conserved molecular mechanism for the repression of aphA by MQSRs, since transcription starts, −35 and −10 core promoter elements, SD sequences, and MQSR box-like sequences are conservatively located upstream of the aphA translation starts.

Supporting Information

Figure S1

Primer extension assay for validation of non-polar mutation. The opaR null mutant ΔopaR was generated from the wild-type (WT) strain RIMD 2210633, and then the complemented mutant strain C-opaR was constructed. As determined by several distinct methods (see text), the transcription of ahpA was under the negative control of OpaR. Herein, an oligonucleotide primer, which was complementary to the RNA transcript of ahpA, was employed to detect the primer extension product that represented the relative mRNA level of ahpA in WT, ΔopaR, and C-opaR. The primer extension products were analyzed with 8 M urea–6% acrylamide sequencing gel. Lanes C, T, A, and G represented the Sanger sequencing reactions. The transcription start site (nucleotide C), which was located at 200 bp upstream of ahpA, was underlined in the DNA sequence. The ahpA mRNA level was significantly enhanced in ΔopaR relative to WT, while no obvious change in the ahpA transcription was observed between WT and C-opaR, which confirmed that the detecting enhanced transcription of ahpA in ΔopaR was due to the opaR mutation rather than a polar mutation.

(TIF)

Acknowledgments

We thank Professor Mitsuaki Nishibuchi from Kyoto University for kindly providing the strain RIMD 2210633. The English writing of the manuscript was polished by EnPapers.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: Financial support was provided by the National Natural Science Foundation of China (31170127, and 30871370), and by the National Basic Research Program of China (2009CB522604). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Henke JM, Bassler BL. Three parallel quorum-sensing systems regulate gene expression in Vibrio harveyi. J Bacteriol. 2004;186:6902–6914. doi: 10.1128/JB.186.20.6902-6914.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Lenz DH, Mok KC, Lilley BN, Kulkarni RV, Wingreen NS, et al. The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae. Cell. 2004;118:69–82. doi: 10.1016/j.cell.2004.06.009. [DOI] [PubMed] [Google Scholar]
  • 3.Waters CM, Bassler BL. The Vibrio harveyi quorum-sensing system uses shared regulatory components to discriminate between multiple autoinducers. Genes Dev. 2006;20:2754–2767. doi: 10.1101/gad.1466506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Tu KC, Bassler BL. Multiple small RNAs act additively to integrate sensory information and control quorum sensing in Vibrio harveyi. Genes Dev. 2007;21:221–233. doi: 10.1101/gad.1502407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hammer BK, Bassler BL. Regulatory small RNAs circumvent the conventional quorum sensing pathway in pandemic Vibrio cholerae. Proc Natl Acad Sci U S A. 2007;104:11145–11149. doi: 10.1073/pnas.0703860104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hussa EA, Darnell CL, Visick KL. J Bacteriol. 2008;190:4576–4583. doi: 10.1128/JB.00130-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Tu KC, Waters CM, Svenningsen SL, Bassler BL. A small-RNA-mediated negative feedback loop controls quorum-sensing dynamics in Vibrio harveyi. Mol Microbiol. 2008;70:896–907. doi: 10.1111/j.1365-2958.2008.06452.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Svenningsen SL, Waters CM, Bassler BL. A negative feedback loop involving small RNAs accelerates Vibrio cholerae's transition out of quorum-sensing mode. Genes Dev. 2008;22:226–238. doi: 10.1101/gad.1629908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hammer BK, Bassler BL. Distinct sensory pathways in Vibrio cholerae El Tor and classical biotypes modulate cyclic dimeric GMP levels to control biofilm formation. J Bacteriol. 2009;191:169–177. doi: 10.1128/JB.01307-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Long T, Tu KC, Wang Y, Mehta P, Ong NP, et al. Quantifying the integration of quorum-sensing signals with single-cell resolution. PLoS Biol. 2009;7:e68. doi: 10.1371/journal.pbio.1000068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Svenningsen SL, Tu KC, Bassler BL. Gene dosage compensation calibrates four regulatory RNAs to control Vibrio cholerae quorum sensing. Embo J. 2009;28:429–439. doi: 10.1038/emboj.2008.300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Tu KC, Long T, Svenningsen SL, Wingreen NS, Bassler BL. Negative feedback loops involving small regulatory RNAs precisely control the Vibrio harveyi quorum-sensing response. Mol Cell. 2010;37:567–579. doi: 10.1016/j.molcel.2010.01.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Teng SW, Schaffer JN, Tu KC, Mehta P, Lu W, et al. Active regulation of receptor ratios controls integration of quorum-sensing signals in Vibrio harveyi. Mol Syst Biol. 2011;7:491. doi: 10.1038/msb.2011.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yeung PS, Boor KJ. Epidemiology, pathogenesis, and prevention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathog Dis. 2004;1:74–88. doi: 10.1089/153531404323143594. [DOI] [PubMed] [Google Scholar]
  • 15.Sawabe T, Kita-Tsukamoto K, Thompson FL. Inferring the evolutionary history of vibrios by means of multilocus sequence analysis. J Bacteriol. 2007;189:7932–7936. doi: 10.1128/JB.00693-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Makino K, Oshima K, Kurokawa K, Yokoyama K, Uda T, et al. Genome sequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct from that of V cholerae. Lancet. 2003;361:743–749. doi: 10.1016/S0140-6736(03)12659-1. [DOI] [PubMed] [Google Scholar]
  • 17.McCarter LL. OpaR, a homolog of Vibrio harveyi LuxR, controls opacity of Vibrio parahaemolyticus. J Bacteriol. 1998;180:3166–3173. doi: 10.1128/jb.180.12.3166-3173.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Philippe N, Alcaraz JP, Coursange E, Geiselmann J, Schneider D. Improvement of pCVD442, a suicide plasmid for gene allele exchange in bacteria. Plasmid. 2004;51:246–255. doi: 10.1016/j.plasmid.2004.02.003. [DOI] [PubMed] [Google Scholar]
  • 19.Hiyoshi H, Kodama T, Iida T, Honda T. Contribution of Vibrio parahaemolyticus virulence factors to cytotoxicity, enterotoxicity, and lethality in mice. Infect Immun. 2010;78:1772–1780. doi: 10.1128/IAI.01051-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Casselli T, Lynch T, Southward CM, Jones BW, DeVinney R. Vibrio parahaemolyticus inhibition of Rho family GTPase activation requires a functional chromosome I type III secretion system. Infect Immun. 2008;76:2202–2211. doi: 10.1128/IAI.01704-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Balbas P, Soberon X, Merino E, Zurita M, Lomeli H, et al. Plasmid vector pBR322 and its special-purpose derivatives–a review. Gene. 1986;50:3–40. doi: 10.1016/0378-1119(86)90307-0. [DOI] [PubMed] [Google Scholar]
  • 22.Zhan L, Han Y, Yang L, Geng J, Li Y, et al. The cyclic AMP receptor protein, CRP, is required for both virulence and expression of the minimal CRP regulon in Yersinia pestis biovar microtus. Infect Immun. 2008;76:5028–5037. doi: 10.1128/IAI.00370-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li YL, Gao H, Qin L, Li B, Han YP, et al. Identification and characterization of PhoP regulon members in Yersinia pestis biovar Microtus. BMC Genomics. 2008;9:143. doi: 10.1186/1471-2164-9-143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhang Y, Gao H, Wang L, Xiao X, Tan Y, et al. Molecular characterization of transcriptional regulation of rovA by PhoP and RovA in Yersinia pestis. PLoS One. 2011;6:e25484. doi: 10.1371/journal.pone.0025484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Andrews GP, Heath DG, Anderson GW, Jr, Welkos SL, Friedlander AM. Fraction 1 capsular antigen (F1) purification from Yersinia pestis CO92 and from an Escherichia coli recombinant strain and efficacy against lethal plague challenge. Infect Immun. 1996;64:2180–2187. doi: 10.1128/iai.64.6.2180-2187.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.van Helden J. Regulatory sequence analysis tools. Nucleic Acids Res. 2003;31:3593–3596. doi: 10.1093/nar/gkg567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Crooks GE, Hon G, Chandonia JM, Brenner SE. WebLogo: a sequence logo generator. Genome Res. 2004;14:1188–1190. doi: 10.1101/gr.849004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fidopiastis PM, Miyamoto CM, Jobling MG, Meighen EA, Ruby EG. LitR, a new transcriptional activator in Vibrio fischeri, regulates luminescence and symbiotic light organ colonization. Mol Microbiol. 2002;45:131–143. doi: 10.1046/j.1365-2958.2002.02996.x. [DOI] [PubMed] [Google Scholar]
  • 29.Chatterjee J, Miyamoto CM, Meighen EA. Autoregulation of luxR: the Vibrio harveyi lux-operon activator functions as a repressor. Mol Microbiol. 1996;20:415–425. doi: 10.1111/j.1365-2958.1996.tb02628.x. [DOI] [PubMed] [Google Scholar]
  • 30.Pompeani AJ, Irgon JJ, Berger MF, Bulyk ML, Wingreen NS, et al. The Vibrio harveyi master quorum-sensing regulator, LuxR, a TetR-type protein is both an activator and a repressor: DNA recognition and binding specificity at target promoters. Mol Microbiol. 2008;70:76–88. doi: 10.1111/j.1365-2958.2008.06389.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Waters CM, Wu JT, Ramsey ME, Harris RC, Bassler BL. Control of the type 3 secretion system in Vibrio harveyi by quorum sensing through repression of ExsA. Appl Environ Microbiol. 2010;76:4996–5004. doi: 10.1128/AEM.00886-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Swartzman E, Silverman M, Meighen EA. The luxR gene product of Vibrio harveyi is a transcriptional activator of the lux promoter. J Bacteriol. 1992;174:7490–7493. doi: 10.1128/jb.174.22.7490-7493.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lin W, Kovacikova G, Skorupski K. The quorum sensing regulator HapR downregulates the expression of the virulence gene transcription factor AphA in Vibrio cholerae by antagonizing Lrp- and VpsR-mediated activation. Mol Microbiol. 2007;64:953–967. doi: 10.1111/j.1365-2958.2007.05693.x. [DOI] [PubMed] [Google Scholar]
  • 34.Kovacikova G, Skorupski K. Overlapping binding sites for the virulence gene regulators AphA, AphB and cAMP-CRP at the Vibrio cholerae tcpPH promoter. Mol Microbiol. 2001;41:393–407. doi: 10.1046/j.1365-2958.2001.02518.x. [DOI] [PubMed] [Google Scholar]
  • 35.Tsou AM, Zhu J. Quorum sensing negatively regulates hemolysin transcriptionally and posttranslationally in Vibrio cholerae. Infect Immun. 2010;78:461–467. doi: 10.1128/IAI.00590-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Waters CM, Lu W, Rabinowitz JD, Bassler BL. Quorum sensing controls biofilm formation in Vibrio cholerae through modulation of cyclic di-GMP levels and repression of vpsT. J Bacteriol. 2008;190:2527–2536. doi: 10.1128/JB.01756-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lim B, Beyhan S, Meir J, Yildiz FH. Cyclic-diGMP signal transduction systems in Vibrio cholerae: modulation of rugosity and biofilm formation. Mol Microbiol. 2006;60:331–348. doi: 10.1111/j.1365-2958.2006.05106.x. [DOI] [PubMed] [Google Scholar]
  • 38.Shao CP, Lo HR, Lin JH, Hor LI. Regulation of Cytotoxicity by Quorum-Sensing Signaling in Vibrio vulnificus Is Mediated by SmcR, a Repressor of hlyU. J Bacteriol. 2011;193:2557–2565. doi: 10.1128/JB.01259-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wright AC, Morris JG., Jr The extracellular cytolysin of Vibrio vulnificus: inactivation and relationship to virulence in mice. Infect Immun. 1991;59:192–197. doi: 10.1128/iai.59.1.192-197.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Liu M, Alice AF, Naka H, Crosa JH. The HlyU protein is a positive regulator of rtxA1, a gene responsible for cytotoxicity and virulence in the human pathogen Vibrio vulnificus. Infect Immun. 2007;75:3282–3289. doi: 10.1128/IAI.00045-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Liu M, Naka H, Crosa JH. HlyU acts as an H-NS antirepressor in the regulation of the RTX toxin gene essential for the virulence of the human pathogen Vibrio vulnificus CMCP6. Mol Microbiol. 2009;72:491–505. doi: 10.1111/j.1365-2958.2009.06664.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Jeong HS, Lee MH, Lee KH, Park SJ, Choi SH. SmcR and cyclic AMP receptor protein coactivate Vibrio vulnificus vvpE encoding elastase through the RpoS-dependent promoter in a synergistic manner. J Biol Chem. 2003;278:45072–45081. doi: 10.1074/jbc.M308184200. [DOI] [PubMed] [Google Scholar]
  • 43.Gode-Potratz CJ, McCarter LL. Quorum sensing and silencing in Vibrio parahaemolyticus. J Bacteriol. 2011 doi: 10.1128/JB.00432-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Henke JM, Bassler BL. Quorum sensing regulates type III secretion in Vibrio harveyi and Vibrio parahaemolyticus. J Bacteriol. 2004;186:3794–3805. doi: 10.1128/JB.186.12.3794-3805.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Faruque SM, Biswas K, Udden SM, Ahmad QS, Sack DA, et al. Transmissibility of cholera: in vivo-formed biofilms and their relationship to infectivity and persistence in the environment. Proc Natl Acad Sci U S A. 2006;103:6350–6355. doi: 10.1073/pnas.0601277103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tamayo R, Patimalla B, Camilli A. Growth in a biofilm induces a hyperinfectious phenotype in Vibrio cholerae. Infect Immun. 2010;78:3560–3569. doi: 10.1128/IAI.00048-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhu J, Miller MB, Vance RE, Dziejman M, Bassler BL, et al. Quorum-sensing regulators control virulence gene expression in Vibrio cholerae. Proc Natl Acad Sci U S A. 2002;99:3129–3134. doi: 10.1073/pnas.052694299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kovacikova G, Skorupski K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol Microbiol. 2002;46:1135–1147. doi: 10.1046/j.1365-2958.2002.03229.x. [DOI] [PubMed] [Google Scholar]
  • 49.Hammer BK, Bassler BL. Quorum sensing controls biofilm formation in Vibrio cholerae. Mol Microbiol. 2003;50:101–104. doi: 10.1046/j.1365-2958.2003.03688.x. [DOI] [PubMed] [Google Scholar]
  • 50.Lee DH, Jeong HS, Jeong HG, Kim KM, Kim H, et al. A consensus sequence for binding of SmcR, a Vibrio vulnificus LuxR homologue, and genome-wide identification of the SmcR regulon. J Biol Chem. 2008;283:23610–23618. doi: 10.1074/jbc.M801480200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Lin W, Kovacikova G, Skorupski K. Requirements for Vibrio cholerae HapR binding and transcriptional repression at the hapR promoter are distinct from those at the aphA promoter. J Bacteriol. 2005;187:3013–3019. doi: 10.1128/JB.187.9.3013-3019.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Croxatto A, Pride J, Hardman A, Williams P, Camara M, et al. A distinctive dual-channel quorum-sensing system operates in Vibrio anguillarum. Mol Microbiol. 2004;52:1677–1689. doi: 10.1111/j.1365-2958.2004.04083.x. [DOI] [PubMed] [Google Scholar]
  • 53.Ishihama A. Functional modulation of Escherichia coli RNA polymerase. Annu Rev Microbiol. 2000;54:499–518. doi: 10.1146/annurev.micro.54.1.499. [DOI] [PubMed] [Google Scholar]
  • 54.Kovacikova G, Lin W, Skorupski K. Vibrio cholerae AphA uses a novel mechanism for virulence gene activation that involves interaction with the LysR-type regulator AphB at the tcpPH promoter. Mol Microbiol. 2004;53:129–142. doi: 10.1111/j.1365-2958.2004.04121.x. [DOI] [PubMed] [Google Scholar]
  • 55.Yang M, Frey EM, Liu Z, Bishar R, Zhu J. The virulence transcriptional activator AphA enhances biofilm formation by Vibrio cholerae by activating expression of the biofilm regulator VpsT. Infect Immun. 2010;78:697–703. doi: 10.1128/IAI.00429-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Kovacikova G, Lin W, Skorupski K. Dual regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive LysR-type regulator AlsR in Vibrio cholerae. Mol Microbiol. 2005;57:420–433. doi: 10.1111/j.1365-2958.2005.04700.x. [DOI] [PubMed] [Google Scholar]
  • 57.Rutherford ST, van Kessel JC, Shao Y, Bassler BL. AphA and LuxR/HapR reciprocally control quorum sensing in vibrios. Genes Dev. 2011;25:397–408. doi: 10.1101/gad.2015011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Miyamoto CM, Smith EE, Swartzman E, Cao JG, Graham AF, et al. Proximal and distal sites bind LuxR independently and activate expression of the Vibrio harveyi lux operon. Mol Microbiol. 1994;14:255–262. doi: 10.1111/j.1365-2958.1994.tb01286.x. [DOI] [PubMed] [Google Scholar]
  • 59.Miyamoto CM, Meighen EA. Involvement of LuxR, a quorum sensing regulator in Vibrio harveyi, in the promotion of metabolic genes: argA, purM, lysE and rluA. Biochim Biophys Acta. 2006;1759:296–307. doi: 10.1016/j.bbaexp.2006.05.005. [DOI] [PubMed] [Google Scholar]
  • 60.Chang C, Jing-Jing Z, Chun-Hua R, Chao-Qun H. Deletion of valR, a homolog of Vibrio harveyis luxR generates an intermediate colony phenotype between opaque/rugose and translucent/smooth in Vibrio alginolyticus. Biofouling. 2010;26:595–601. doi: 10.1080/08927014.2010.499511. [DOI] [PubMed] [Google Scholar]
  • 61.Lin B, Wang Z, Malanoski AP, O'Grady EA, Wimpee CF, et al. Comparative genomic analyses identify the Vibrio harveyi genome sequenced strains BAA-1116 and HY01 as Vibrio campbellii. Environ Microbiol Rep. 2010;2:81–89. doi: 10.1111/j.1758-2229.2009.00100.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Chen CY, Wu KM, Chang YC, Chang CH, Tsai HC, et al. Comparative genome analysis of Vibrio vulnificus, a marine pathogen. Genome Res. 2003;13:2577–2587. doi: 10.1101/gr.1295503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Hasegawa H, Hase CC. TetR-type transcriptional regulator VtpR functions as a global regulator in Vibrio tubiashii. Appl Environ Microbiol. 2009;75:7602–7609. doi: 10.1128/AEM.01016-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Naka H, Dias GM, Thompson CC, Dubay C, Thompson FL, et al. Complete Genome Sequence of the Marine Fish Pathogen Vibrio anguillarum Harboring the pJM1 Virulence Plasmid and Genomic Comparison with Other Virulent Strains of V. anguillarum and V. ordalii. Infect Immun. 2011;79:2889–2900. doi: 10.1128/IAI.05138-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Heidelberg JF, Eisen JA, Nelson WC, Clayton RA, Gwinn ML, et al. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature. 2000;406:477–483. doi: 10.1038/35020000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Mandel MJ, Wollenberg MS, Stabb EV, Visick KL, Ruby EG. A single regulatory gene is sufficient to alter bacterial host range. Nature. 2009;458:215–218. doi: 10.1038/nature07660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Thompson JD, Gibson TJ, Higgins DG. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics Chapter. 2002;2:Unit 2 3. doi: 10.1002/0471250953.bi0203s00. [DOI] [PubMed] [Google Scholar]
  • 68.Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Primer extension assay for validation of non-polar mutation. The opaR null mutant ΔopaR was generated from the wild-type (WT) strain RIMD 2210633, and then the complemented mutant strain C-opaR was constructed. As determined by several distinct methods (see text), the transcription of ahpA was under the negative control of OpaR. Herein, an oligonucleotide primer, which was complementary to the RNA transcript of ahpA, was employed to detect the primer extension product that represented the relative mRNA level of ahpA in WT, ΔopaR, and C-opaR. The primer extension products were analyzed with 8 M urea–6% acrylamide sequencing gel. Lanes C, T, A, and G represented the Sanger sequencing reactions. The transcription start site (nucleotide C), which was located at 200 bp upstream of ahpA, was underlined in the DNA sequence. The ahpA mRNA level was significantly enhanced in ΔopaR relative to WT, while no obvious change in the ahpA transcription was observed between WT and C-opaR, which confirmed that the detecting enhanced transcription of ahpA in ΔopaR was due to the opaR mutation rather than a polar mutation.

(TIF)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES