Skip to main content
PLOS One logoLink to PLOS One
. 2012 May 18;7(5):e37152. doi: 10.1371/journal.pone.0037152

Identification of New Delhi Metallo-β-lactamase 1 in Acinetobacter lwoffii of Food Animal Origin

Yang Wang 1,#, Congming Wu 1,#, Qijing Zhang 2, Jing Qi 3, Hebing Liu 1, Yu Wang 1, Tao He 1, Licai Ma 1, Jing Lai 1, Zhangqi Shen 2, Yuqing Liu 3, Jianzhong Shen 1,*
Editor: Axel Cloeckaert4
PMCID: PMC3356367  PMID: 22629360

Abstract

Background

To investigate the presence of metallo-β-lactamase (MBL) genes and the genetic environment of the New Delhi metallo-β-lactamase gene bla NDM-1 in bacteria of food animal origin.

Methodology/Principal Findings

Gram-negative bacteria with low susceptibility to imipenem (MIC>8 µg/mL) were isolated from swab samples collected from 15 animal farms and one slaughterhouse in eastern China. These bacteria were selected for phenotypic and molecular detection of known MBL genes and antimicrobial susceptibility testing. For the bla NDM-1 positive isolate, conjugation and transformation experiments were carried out to assess plasmid transfer. Southern blotting was conducted to localize the bla NDM-1 genes, and DNA sequencing was performed to determine the sequences of bla NDM-1 and the flanking genes. In total, nine Gram-negative bacteria of four different species presented a MBL phenotype. bla NDM-1 was identified on a mobile plasmid named pAL-01 in an Acinetobacter lwoffii isolate of chicken origin. Transfer of pAL-01 from this isolate to E. coli J53 and JM109 resulted in resistance to multiple β-lactams. Sequence analysis revealed that the bla NDM-1 gene is attached to an intact insertion element ISAba125, whose right inverted repeat (IR-R) overlaps with the promoter sequence of bla NDM-1. Thus, insertion of ISAba125 likely enhances the expression of bla NDM-1.

Conclusion

The identification of a bla NDM-1- carrying strain of A. lwoffii in chickens suggests the potential for zoonotic transmission of bla NDM-1 and has important implications for food safety.

Introduction

Metallo-β-lactamases (MBLs) in clinical Gram-negative organisms are an important threat to public health. MBLs, which require divalent cations (usually zinc ions) as metal cofactors for enzymatic activity, can hydrolyze all β-lactams including carbapenems (except aztreonam) [1]. In 2009, a novel MBL enzyme, named New Delhi metallo-β-lactamase (NDM-1, encoded by bla NDM-1), was identified in plasmids from Klebsiella pneumoniae and Escherichia coli isolates recovered from a Swedish patient previously hospitalized in India [2]. Recently, bla NDM-1-harboring strains of Enterobacteriaceae have been identified worldwide, with most reports indicating that the isolates originated from the Indian subcontinent with hospital or community acquisition [3] or from the Balkan countries [4]. However, NDM-1 positive strains have also been reported in patients with no known contact with these areas [5]. Coexistence of bla NDM-1 with the class D carbapenemase gene bla OXA-23 in clinical isolates of Acinetobacter baumannii was first detected in India [6]. Subsequently, five bla NDM-1-harboring A. baumannii clinical strains were reported in five different provinces in China [7], [8]. A multidrug resistant Acinetobacter lwoffii strain carrying a bla NDM-1 plasmid was also isolated from the urine of a female patient in China [9]. Although China borders India and Pakistan, there was no evidence that the infected patients had any contact with the Indian subcontinent.

Recently, bla NDM-1 was found in a number of bacterial species isolated from water and seepage samples in central New Delhi, suggesting it is widely disseminated in the local environment [10]. In addition, bla NDM-1-carrying bacteria have also been reported as gut colonizers in patients with no clinical symptoms, suggesting the possible transmission of bla NDM-1 via the fecal-oral route, and that fecal flora may serve as a reservoir for bla NDM-1 dissemination [3], [10], [11]. These findings suggest that the spread of the NDM-1 resistance determinant is much wider than previously realized. However, no information is available on the distribution of NDM-1 in food producing animals. Here we investigated the prevalence of Gram-negative bacteria with low susceptibility to imipenem in food producing animals, and determined whether MBL genes, including bla NDM-1, were present in these animal isolates.

Results

Prevalence of Gram-negative bacteria with low susceptibility to imipenem in food producing animals

In total, nine isolates with very low susceptibility to imipenem (MIC>8 µg/mL for imipenem), obtained from eight of the 396 samples, were confirmed as Gram-negative bacteria. The isolates were identified by ATB 32 GN, ATB 32E and 16 S rDNA sequencing analysis as Stenotrophomonas maltophilia (n = 3), Chryseobacterium indologenes (n = 3), Myroides odoratimimus (n = 1), Myroides odoratus (n = 1), and A. lwoffii (n = 1). Eight of these isolates came from pig samples, while the A. lwoffii isolate was derived from a chicken sample. No imipenem-resistant Enterobacteriaceae strains were identified in this study. Two isolates, M. odoratimimus LYP-BCYg6a and M. odoratus LYP-BCYg6b, were collected from one rectal swab sample from a pig farm.

Characterization of the nine Gram-negative bacteria with low susceptibility to imipenem

All nine Gram-negative isolates presented high MIC values for three tested carbapenems, including imipenem (ranging from 32–128 µg/mL), meropenem (16–64 µg/mL), and ertapenem (16–512 µg/mL). Imipenem-EDTA double-disc synergy tests and E-test MBL strip tests confirmed that all nine isolates were MBL-positive. However, PCR analysis using primers specific for known mobile and chromosomal MBL genes revealed that only the A. lwoffii strain SGC-HZ9, of chicken origin, was bla NDM-1 positive. This bla NDM-1-harboring strain was resistant not only to all tested β-lactams (except aztreonam, 8 µg/mL) but also to ciprofloxacin (8 µg/mL), tetracycline (32 µg/mL), kanamycin (64 µg/mL), and chloramphenicol (32 µg/mL), while remaining susceptible to gentamicin (0.5 µg/mL) and polymyxin B (0.016 µg/mL) (Table 1). In addition, two ubiquitous free-living bacteria (one Myroides odoratimimus LYP-BCYg6a and one Myroides odoratus isolate LYP-BCYg6b) harbored a chromosomal MBL gene, bla MUS-1. Six isolates with a MBL phenotype did not contain any of the tested MBL genes.

Table 1. Antimicrobial susceptibility patterns of A. lwoffii SGC-HZ9, transformants and transconjugants.

Antimicrobial agentsa MIC (µg/mL)
A. lwoffii SGC-HZ9 E. coli J53 E. coli J53 (pAL-01) E. coli JM109 E. coli JM109 (pAL-01)
IMP 32 1 4 0.25 1
MER 64 0.03 1 0.016 1
ERT 512 0.03 2 0.016 2
AMP 32 0·5 32 1 128
CRA >512 16 256 16 256
COT >512 0.06 16 0.125 32
CAZ >512 0.125 256 0.25 >256
CEP 128 0.06 1 0.016 2
AZT 8 0.06 0.125 0.125 0.125
POL 0.016 0.25 0.5 0.125 0.25
CIP 8 0.008 0.004 0.06 0.03
TET 32 4 4 4 4
KAN 64 1 1 0.5 0.5
GEN 0.5 0.5 0.5 0.5 0.25
CHL 32 2 2 2 2
a

IMP, Imipenem; MER, Meropenem; ERT, Ertapenem; AMP, Ampicillin; CRA, Cefradine; COT, Cefotaxime; CAZ, Ceftazidime; CEP, Cefepime; AZT, Aztreonam; POL, Polymyxin B; CIP, Ciprofloxacin; TET, Tetracycline; KAN, Kanamycin; GEN, Gentamicin; CHL, Chloramphenicol.

Phenotypic and plasmid characterization of A. lwoffii SGC-HZ9

Plasmids of A. lwoffii SGC-HZ9 were extracted and separated by pulsed field gel electrophoresis (PFGE). Subsequent Southern blotting analysis of the PFGE gel revealed hybridization of a bla NDM-1-specific probe to a ∼270 kb plasmid, which was designated pAL-01 (Figure 1). Plasmid pAL-01 was successfully transferred from SGC-HZ9 to E. coli J53 using filter mating and to E. coli JM109 using electroporation. The size of the plasmid recovered from transformant JM109-SGC-HZ9 was consistent with that observed using PFGE, while two plasmid bands were identified in transconjugant J53-SGC-HZ9 (approximately 260 kb and 270 kb) (Figure 1A). Southern blotting using the bla NDM-1 probe further confirmed the presence of pAL-01 in transformant JM109-SGC-HZ9, while in transconjugant J53-SGC-HZ9, the probe hybridized to a 260 kb plasmid, suggesting unknown rearrangements had been occurred in the transconjugants with respect to pAL-01 (Figure 1B). Susceptibility tests revealed that both the transconjugant and transformant presented resistance or decreased susceptibility to all tested β-lactams (except aztreonam) as compared with the recipients E. coli J53 and JM109, but remained sensitive to other classes of antibiotics (kanamycin, ciprofloxacin, tetracycline, and chloramphenicol) (Table 1). After 14 passages in media with or without 16 µg/mL of ceftazidime, A. lwoffii SGC-HZ9 and the transformant JM109-SGC-HZ9 stably maintained the bla NDM-1-containing plasmid. However, transconjugant J53-SGC-HZ9 lost bla NDM-1 within three passages when grown in antibiotic-free media, but maintained bla NDM-1 in the presence of ceftazidime.

Figure 1. Identification of a mobile bla NDM-1 gene.

Figure 1

(A) PFGE analysis of the plasmid preparations. (B) Southern hybridization of the PFGE gel and S1 nuclease PFGE gel with a bla NDM-1 probe. For both panels, lanes 1–3 contain plasmids prepared from A. lwoffii SGC-HZ9, transformant JM109-SGC-HZ9, and transconjugant J53-SGC-HZ9, respectively. M: Lambda Ladder PFG Marker (NEB, UK).

Genetic sequence flanking bla NDM-1 in pAL-01

Following DNA cloning and modified random primer sequence walking analysis, a 6.5 kb region surrounding the bla NDM-1 gene (GenBank Accession No. JN616388) was obtained. The gene region included two antimicrobial resistance genes (bla NDM-1 and aphA6), three mobile elements (IS911, insB, and ISAba125), and phosphoribosylanthranilate isomerase gene trpF. A comparison of the regions surrounding bla NDM-1 in the plasmids of E. coli p271A, A. lwoffii pAL-01, K. pneumoniae pKpANDM-1, and E. coli pNDM-HK is presented in Figure 2. The 2022 bp bla NDM-1-containing region in pAL-01 shared 99% sequence identity with the corresponding region in pKpANDM-1 from K. pneumoniae 05-506 (GenBank no. FN396876), with an additional 24 bp inserted into the region between bla NDM-1 and traF in pAL-01. This additional 24 bp was also found in pA271A and pNDM-HK [12], [13].

Figure 2. Schematic map representing bla NDM-1 and its flanking genetic sequences.

Figure 2

Comparison of plasmid regions around the bla NDM-1 gene in A. lwoffii SGC-HZ9 (JN616388), E. coli 271(HQ162469) [12], K. pneumoniae 05-506 (FN396876) [2], and E. coli HK-01 (HQ451074) [13]. The vertical dotted lines indicate the locations at which the sequences diverge. X and E depict XbaI and EcoRI sites, respectively. The −35 promoter region of bla NDM-1 and the overlapping EcoRI site are indicated on top of the panel. The right inverted repeat of ISAba125 is shaded and partly overlaps with the −35 box of bla NDM-1.

An intact insertion sequence (IS) element, ISAba125, flanked by imperfect terminal repeats (IR-L AAACTTGAAGTGCGACA, IR-R TGTCGCACCTCATGTTT) was identified immediately upstream of the bla NDM-1 gene. This IS element belongs to the widely distributed IS30 family and was previously identified in A. baumannii (GenBank no. AY751533), where it is associated with insertional inactivation of an outer-membrane porin [14]. Notably, the bla NDM-1 upstream regions in pKpANDM-1, pA271A, and pNDM-HK only contained partial ISAba125 sequences, along with the terminal repeat IR-R. In these examples, the IS element was truncated by other insertion sequences, including ISEc33 in pA271A and IS26 in pKpANDM-1 and pNDM-HK (Figure 2). Interestingly, the previously confirmed −35 (TTGAAT) bla NDM-1 promoter sequence [12] overlaps with the inverted repeat IR-R of ISAba125, and the nucleotides TGA in the −35 box form the terminal codon of ISAba125 (Figure 2).

Upstream of ISAba125 is an open reading frame encoding an aminoglycoside phosphotransferase, which is 98.5% similar to the kanamycin resistance gene aphA6 in A. baumannii (GenBank no. P09885). Further upstream are two adjacent mobile genes that are identical to putative transposase OrfB (namely insB) in A. baumannii 1656-2 (GenBank no. CP001921), and the IS3/IS911 family transposase previously identified in A. baumannii (GenBank no. CP001921). Downstream of bla NDM-1, the phosphoribosylanthranilate isomerase gene trpF (639 bp) shows 100% similarity to the first 581 nucleotides of trpF in pNDM-HK and pKpANDM-1 (Figure 2). The TrpF protein shares 65% amino acid similarity with the phosphoribosylanthranilate isomerase of Erythrobacter sp. SD-21(ZP_01863115).

Discussion

Nine Gram-negative non-fermentative bacteria (three C. indologenes, three S. maltophilia, two Myroides spp, and one A. lwoffii) with low susceptibility to imipenem were identified in this study. Acinetobacter are common, free-living saprophytes found in soil, water, sewage, and animal source foods. It has been reported that Acinetobacter species constitute up to 22·7% of the total microflora of chicken carcasses [15]. A. lwoffii is one of the most predominant species of Acinetobacter involved in economically-important spoilage of foods such as bacon, chicken, eggs, and fish, even when stored under refrigerated conditions or following irradiation treatment [15]. In the past, Acinetobacter spp. were regarded as saprophytes of little clinical significance. However, with the introduction of powerful new antibiotics in clinical practice and agriculture, and the use of invasive procedures in hospital intensive care units, antibiotic resistance-related community- and hospital-acquired Acinetobacter infections have emerged with increasing frequency [16], [17].

All nine Gram-negative species isolated in this study were positive for a MBL phenotype. However, only four were found to contain known MBL-conferring genes. Importantly, the newly discovered MBL gene bla NDM-1 was identified in A. lwoffii SGC-HZ9, which not only presented high MIC values to nearly all β-lactams, but was also resistant to four other classes of antibiotics (kanamycin, ciprofloxacin, tetracycline, and chloramphenicol). This isolate was derived from the anal swab of a chicken. Although information on antimicrobial therapy for this particular chicken was not available, the antibiotic usage records for the chicken farm indicated that a number of antimicrobial agents, including penicillin, cefotaxime, cefradine, tilmicosin, doxycycline, and neomycin had been used for curing or preventing bacterial infections. To the best of our knowledge, this is the first report of the bla NDM-1 gene in A. lwoffii of food animal origin, which could have a serious public health implication because the species of A. lwoffii is a ubiquitous bacterium in foodstuffs, and can be transferred to human by the food chain. In addition, two Myroides spp. isolates derived from the same anal swab in a pig farm harbored bla MUS-1, an intrinsic chromosomal MBL gene from M. odoratimimus that encodes a MUS-1 subgroup 3a metalloenzyme [18]. Despite these findings, six MBL-positive isolates (three C. indologenes and three S. maltophilia) did not contain known intrinsic MBL genes bla IND1–4 or bla L1 [19], [20] as determined by PCR amplification. This might be due to the molecular heterogeneity of MBL genes in these species and requires further investigation.

Although the use of carbepenem antibiotics in food producing animals is prohibited in China and other countries, other β-lactam antibiotics such as penicillin and cephalosporins (cefradine, ceftiofur, and cefotaxime) have been extensively used in animal agriculture for the prevention and control of disease. Use of these non-carbepenem β-lactams in animal production may serve as a driving force for selecting MBL genes in bacteria. However, owing to the co-existence of MBL genes and other antimicrobial resistance genes, such as the aphA6 in pAL-01 identified in this study, the possibility of cross-selection of MBL genes through use of other antimicrobials cannot be ignored. It should be noted that some carbapenemase-positive Gram-negative bacteria, including Enterobacteriaceae, with MIC values lower than 8 µg/mL might have been missed under the conditions used in this study.

Plasmid pAL-01 was successfully transferred from SGC-HZ9 to E. coli J53 using filter mating and to E. coli JM109 using electroporation, suggesting that this plasmid is mobile. The transformant and transconjugant were resistant to or showed decreased susceptibility to almost all tested β-lactams, but remained sensitive to other tested classes of antibiotics. These findings confirm the function of pAL-01 in conferring resistance to β-lactams, and suggest that the resistance to non-β-lactam antibiotics in SGC-HZ9 may be due to a chromosomal gene or plasmid other than pAL-01. Interestingly, the bla NDM-1-harboring plasmid was highly stable in A. lwoffii SGC-HZ9 and transformant JM109-SGC-HZ9, but was lost in transconjugant J53-SGC-HZ9 in the absence of antibiotic selection pressure. This finding is similar to that reported for a bla NDM-1-carrying plasmid in A. baumannii isolates of human origin [8]. Attempts were made to identify the incompatibility group of pAL-01 by replicon typing using the previously described PCR-based methods [21], [22], however, the replicon typing experiment yielded negative results and did not identified pAL-01 as a member of the known incompatibility groups for both A. baumannii and Enterobacteriaceae.

The location of the promoter sequence for bla NDM-1 was identified in a previous study by mapping the transcription start site [12]. The +1 transcription site of the gene was located 7 bp downstream of the putative −10 sequence. Furthermore, the −35 sequence overlaps with the 3′ end of the transposase and the right terminal repeat of ISAba125. These results indicated that the expression of bla NDM-1 is driven by a promoter partly provided by ISAba125. A similar structure was also found in studies of the aminoglycoside-modifying enzyme gene aphA6, for which the right inverted repeat of ISAba125 adjacent to aphA6 provides the −35 sequence (TTGAAT), driving gene transcription [23], [24]. Because all of the known bla NDM-1 genes are associated with a partial or an intact ISAba125 (Fig. 2), and given that an intact ISAba125 has not been found in bacterial species other than Acinetobacter, it is possible that the bla NDM-1 gene may have originated in Acinetobacter, one of the most ubiquitous bacterial species in the environment. Like bla NDM-1, the aphA6 gene was found to be located immediately upstream of ISAba125 (Fig. 2). However, transferring the aphA6 gene (carried on pAL-01) to E. coli did not alter its susceptibility to kanamycin. It is therefore likely that aphA6 in pAL-01 was not expressed (or expressed at an insignificant level) in the E. coli host. Alternatively, the high MIC value of kanamycin in SGC-HZ9 (64 µg/mL) might be conferred by other resistance determinants.

The results of this study confirm that bla NDM-1 and other MBL genes (bla MUS-1) are present in bacteria of food animal origin. These findings have an important implication for the dissemination of this resistance gene, as Acinetobacter spp. are highly prevalent in food-producing animals (chickens and pigs) and in the environment (soil, surface water, and sewage). It would be difficult to contain the spread of bla NDM-1 if it can be transferred to humans via the food chain. However, it is unclear whether the bla NDM-1-carrying A. lwoffii strain of food animal origin identified in this study represents a sporadic case or the early stage of a wide dissemination trend. Therefore, enhanced and continued efforts are needed to monitor the prevalence of bla NDM-1 in Acinetobacter spp. and other bacterial species of food animal origin.

Materials and Methods

Collection and identification of bacteria with low susceptibility to imipenem

A total of 396 samples were collected from eight chicken farms (n = 146, cloacal swabs), six duck farms (n = 50, cloacal swabs), one pig farm (n = 70, rectal swabs), and one pig slaughterhouse (rectal swabs n = 60 and nasal swabs n = 50 from the carcasses before evisceration, and lymph nodes swabs n = 20 from the carcasses after evisceration) in Shandong province, located in eastern China, from October to December 2010. Each sample was collected from a different animal and inoculated onto a brain heart infusion (BHI) agar plate containing 8 µg/mL imipenem and incubated at 30°C for 16–18 hours. All colonies on the culture plates were selected and identified using Gram staining and sequence analysis of the 16 s rDNA gene, using previously described primers [25]. Gram-negative bacteria were further confirmed by both the ATB 32GN and 32E identification systems (bioMérieux, Craponne, France). All collected strains were stored at −70°C in BHI supplemented with 15% glycerol until testing.

Antibiotic Susceptibility Testing

Susceptibility of the bacterial isolates to 15 antibiotics was assessed using the broth micro-dilution method as set by the Clinical and Laboratory Standards Institute (CLSI) document M100-S18 (2008) [26].

Phenotypic and molecular detection of MBL in Gram-negative bacteria

The imipenem-EDTA double-disc synergy test as well as E-test MBL strips (bioMérieux, Craponne, France) were used to screen for MBL production [27]. Strains were screened for known mobile MBL genes (bla NDM-1, bla SIM-1, bla SPM-1, bla VIM, bla IMP, bla GIM-1, bla AIM-1, and bla DIM-1) by PCR assay using previously described primers [2], [27], [28]. In addition, the chromosomal MBL genes (bla IND1/2 and bla L1) were also screened by PCR assay [29], [30]. Primers for mobile MBL gene bla KHM and chromosomal MBL genes bla MUS-1, bla TUS-1, and bla IND3/4 designed in this study are listed in Table 2. All PCR amplicons were sequenced. The entire coding sequence of bla NDM-1 was synthesized by Beijing Genomics Institution (BGI, Beijing, China) according to the published sequence in plasmid pKpANDM-1 (accession number FN396876) and was used in the PCR assay as a positive control for bla NDM-1 [2].

Table 2. MBL gene primers designed in this study.

Primers Sequence GenBank accession No.
Mobile MBL gene
KHM-F ACGGATTAGTCGTGCTTGAT AB364006
KHM-R AATGCGTAGCCTGCTCTTC
Chromosomal MBL gene
MUS-1-F ATCGTTCTGGTGGATTAGGTT AF441286·1
MUS-1-R CCTGTCATATCCCATTCATCA
TUS-1-F CGTTCGGGTGGACTTGATTAC AF441287·1
TUS-1-R GCGCTTTACGGCTTTGATTGT
IND-3-F TCAGTGCCCAGGTAAAAGAT AF219133·2
IND-3-R CCTCCACCTTTCCATTCATC
IND-4-F TGGCAGAAAACCCAGTATCAA AF219135·2
IND-4-R CGTTGCCTTTCCACTCGTC

Conjugation and transformation experiments

For conjugation, A. lwoffii SGC-HZ9 and E. coli J53 (azide resistant) were used as the donor and recipient, respectively, with selection on MacConkey medium containing sodium azide (100 µg/mL) and ceftazidime (16 µg/mL). Plasmid DNA was extracted from SGC-HZ9 with a QIAGEN Large-Construct Kit (Qiagen, Hilden, Germany). For transformation, the plasmid preparation was used to transform electro-competent E. coli JM109, and selection was performed on Luria Bertani (LB) agar plates containing ceftazidime (16 µg/mL). Transformants and transconjugants were further confirmed by specific PCR and Southern blotting.

Southern blotting analysis

Transformants and transconjugants were further confirmed by specific PCR and Southern blotting. The sizes of the plasmids extracted from the original A. lwoffii strain and from the transformants were estimated by PFGE. Southern blotting was performed using a DIG High Prime DNA labeling and Detection Starter Kit (Roche, Basel, Switzerland) according to the manufacturer's instructions. The digoxigenin-labeled bla NDM-1-specific probe was prepared using primers (forward 5′-GGTTTGGCGATCTGGTTTTC-3′; and reverse 5′-CGGAATGGCTCATCACGATC-3′) that amplified a 621 bp region of the bla NDM-1 gene. Plasmids were extracted from A. lwoffii SGC-HZ9, transconjugant J53-SGC-HZ9, and transformant JM109-SGC-HZ9 using the QIAGEN Large-Construct Kit. Plasmid DNA was then separated by PFGE with the following conditions: 6.0 V/cm with an initial/final switch time of 5 s/50 s at an angle of 120° at 14°C for 10 hours. DNA was then transferred to a nylon membrane (Hybond N, Amersham, UK), which was hybridized with the prepared bla NDM-1-specific probe. Detection was performed using an NBT/BCIP color detection kit (Roche, Switzerland).

Plasmid stability test

Plasmid stability was assessed by serial passage of SGC-HZ9, transconjugant J53-SGC-HZ9, and transformant JM109-SGC-HZ9 on antibiotic-free and ceftazidime-containing (16 µg/mL) LB media. Carriage of bla NDM-1 in these strains was assessed by inoculating the cultures of different passages on LB plates containing 16 µg/mL ceftazidime. Additionally, presence of bla NDM-1-carrying plasmids in cultures of different passages was confirmed by PCR assay. A plasmid was designated unstable if it was lost after three consecutive passages in antibiotic-free media.

DNA cloning, sequencing, and analysis

Cloning was performed using vector pHSG298 with a kanamycin resistance marker (Takara, Dalian, China). Restriction endonucleases EcoRI, XbaI, and BamHI (NEB, UK) were used to digest the plasmid DNA extracted from A. lwoffii SGC-HZ9 and transformant JM109-SGC-HZ9. Fragments were then separately ligated into pHSG298, which had been previously digested with the same enzymes. Transformation was carried out using electroporation into E. coli JM109. Transformants were selected on LB agar plates containing ceftazidime (16 µg/mL) and kanamycin (50 µg/mL). Recombinant plasmids containing bla NDM-1-positive inserts were confirmed by sequencing. The flanking regions of bla NDM-1 carrying restriction fragments in the plasmid of SGC-HZ9 were further sequenced using a modified random primer sequence walking strategy, as described previously [31]. The obtained sequences were annotated using the VectorNTI program (Invitrogen, Carlsbad; CA, USA), and sequence comparison was performed using BLASTP and BLASTN.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This work was supported by grants from the National Natural Science Foundation of China (No. U0631006) and the program for Chang Jiang Scholars and the Innovative Research Team at the University of China (No. IRT0866). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-beta-lactamases: the quiet before the storm? Clin Microbiol Rev. 2005;18:306–325. doi: 10.1128/CMR.18.2.306-325.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, et al. Characterization of a new metallo-beta-lactamase gene, bla NDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53:5046–5054. doi: 10.1128/AAC.00774-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10:597–602. doi: 10.1016/S1473-3099(10)70143-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Livermore DM, Walsh TR, Toleman M, Woodford N. Balkan NDM-1: escape or transplant? Lancet Infect Dis. 2011;11:164. doi: 10.1016/S1473-3099(11)70048-2. [DOI] [PubMed] [Google Scholar]
  • 5.Poirel L, Benouda A, Hays C, Nordmann P. Emergence of NDM-1-producing Klebsiella pneumoniae in Morocco. J Antimicrob Chemother. 2011;66:2781–2783. doi: 10.1093/jac/dkr384. [DOI] [PubMed] [Google Scholar]
  • 6.Karthikeyan K, Thirunarayan MA, Krishnan P. Coexistence of bla OXA-23 with bla NDM-1 and armA in clinical isolates of Acinetobacter baumannii from India. J Antimicrob Chemother. 2010;65:2253–2254. doi: 10.1093/jac/dkq273. [DOI] [PubMed] [Google Scholar]
  • 7.Chen Z, Qlu S, Wang Y, Liu S, Wang Z, et al. Coexistence of blaNDM-1 with the prevalent bla OXA23 and bla IMP in pan-drug resistant Acinetobacter baumannii isolates in China. Clin Infect Dis. 2011;52:692–693. doi: 10.1093/cid/ciq231. [DOI] [PubMed] [Google Scholar]
  • 8.Chen Y, Zhou Z, Jiang Y, Yu Y. Emergence of NDM-1-producing Acinetobacter baumannii in China. J Antimicrob Chemother. 2011;52:692–693. doi: 10.1093/jac/dkr082. [DOI] [PubMed] [Google Scholar]
  • 9.Hu Y, Zhang W, Liang H, Liu L, Peng G, et al. Whole-genome sequence of a multidrug resistant clinical isolate of Acinetobacter lwoffii. J Bacteriol. 2011;193:5549–5550. doi: 10.1128/JB.05617-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Walsh TR, Weeks J, Livermore DM, Toleman MA. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis. 2011;11:355–362. doi: 10.1016/S1473-3099(11)70059-7. [DOI] [PubMed] [Google Scholar]
  • 11.D'Andrea MM, Venturelli C, Giani T, Arena F, Conte V, et al. Persistent carriage and infection by multiresistant Escherichia coli ST405 producing the NDM-1 carbapenemase: a report on the first Italian cases. J Clin Microbiol. 2011;49:2755–2758. doi: 10.1128/JCM.00016-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Poirel L, Lagrutta E, Taylor P, Pham J, Nordmann P. Emergence of metallo-beta-lactamase NDM-1-producing multidrug-resistant Escherichia coli in Australia. Antimicrob Agents Chemother. 2010;54:4914–6. doi: 10.1128/AAC.00878-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ho PL, Lo WU, Yeung MK, Lin CH, Chow KH, et al. Complete Sequencing of pNDM-HK encoding NDM-1 carbapenemase from a multidrug-resistant Escherichia coli strain isolated in Hong Kong. PLoS One. 2011;6:e17989. doi: 10.1371/journal.pone.0017989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mussi MA, Limansky AS, Viale AM. Acquisition of resistance to carbapenems in multidrug-resistant clinical strains of Acinetobacter baumannii: natural insertional inactivation of a gene encoding a member of a novel family of beta-barrel outer membrane proteins. Antimicrob Agents Chemother. 2005;49:1432–1440. doi: 10.1128/AAC.49.4.1432-1440.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Towner KJ. Bergogne-Bérézin EJ-GM, Towner KJ, editors. Biology of Acinetobacter spp. Acinetobacter: Microbiology, Epidemiology, Infections, Management. 1996. pp. 13–36. CRC Press. Boca Raton, FL.
  • 16.Bergogne-Berezin E, Towner KJ. Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin Microbiol Rev. 1996;9:148–165. doi: 10.1128/cmr.9.2.148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Guardabassi L, Dalsgaard A, Olsen JE. Phenotypic characterization and antibiotic resistance of Acinetobacter spp. isolated from aquatic sources. J Appl Microbiol. 1999;87:659–67. doi: 10.1046/j.1365-2672.1999.00905.x. [DOI] [PubMed] [Google Scholar]
  • 18.Mammeri H, Bellais S, Nordmann P. Chromosome-encoded beta-lactamases TUS-1 and MUS-1 from Myroides odoratus and Myroides odoratimimus (formerly Flavobacterium odoratum), new members of the lineage of molecular subclass B1 metalloenzymes. Antimicrob Agents Chemother. 2002;46:3561–3567. doi: 10.1128/AAC.46.11.3561-3567.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bellais S, Poirel L, Leotard S, Naas T, Nordmann P. Genetic diversity of carbapenem-hydrolyzing metallo-beta-lactamases from Chryseobacterium (Flavobacterium) indologenes. Antimicrob Agents Chemother. 2000;44:3028–3034. doi: 10.1128/aac.44.11.3028-3034.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sanschagrin F, Dufresne J, Levesque RC. Molecular heterogeneity of the L-1 metallo-beta-lactamase family from Stenotrophomonas maltophilia. Antimicrob Agents Chemother. 1998;42:1245–1248. doi: 10.1128/aac.42.5.1245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bertini A, Poirel L, Mugnier P, Villa L, Nordmann P, et al. Characterization and PCR-based replicon typing of resistance plasmids in Acinetobacter baumannii. Antimicrob Agents Chemother. 2010;54:4168–4177. doi: 10.1128/AAC.00542-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Carattoli A, Bertini A, Villa L, Falbo V, Hopkins K, et al. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005;63:219–228. doi: 10.1016/j.mimet.2005.03.018. [DOI] [PubMed] [Google Scholar]
  • 23.Naas T, Aubert D, Lambert T, Nordmann P. Complex genetic structures with repeated elements, a sul-type class 1 integron, and the bla VEB extended-spectrum beta-lactamase gene. Antimicrob Agents Chemother. 2006;50:1745–1752. doi: 10.1128/AAC.50.5.1745-1752.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Adams MD, Chan ER, Molyneaux ND, Bonomo RA. Genome wide analysis of divergence of antibiotic resistance determinants in closely related isolates of Acinetobacter baumannii. Antimicrob Agents Chemother. 2010;54:3569–3577. doi: 10.1128/AAC.00057-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kim TW, Kim YH, Kim SE, Lee JH, Park CS, et al. Identification and distribution of Bacillus species in doenjang by whole-cell protein patterns and 16 S rRNA gene sequence analysis. J Microbiol Biotechnol. 2010;20:1210–1214. doi: 10.4014/jmb.1002.02008. [DOI] [PubMed] [Google Scholar]
  • 26.Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; eighteen information supplement M100-S18. 2008. CLSI, Wayne, PA.
  • 27.Nordmann P, Poirel L, Carrer A, Toleman MA, Walsh TR. How To Detect NDM-1 Producers. J Clin Microbiol. 2011;49:718–721. doi: 10.1128/JCM.01773-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Poirel L, Rodriguez-Martinez JM, Al Naiemi N, Debets-Ossenkopp YJ, Nordmann P. Characterization of DIM-1, an integron-encoded metallo-beta-lactamase from a Pseudomonas stutzeri clinical isolate in the Netherlands. Antimicrob Agents Chemother. 2010;54:2420–2424. doi: 10.1128/AAC.01456-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bush K. Alarming β-lactamase-mediated resistance in multidrug-resistant Enterobacteriaceae. Curr Opin Microbiol. 2010;13:558–564. doi: 10.1016/j.mib.2010.09.006. [DOI] [PubMed] [Google Scholar]
  • 30.Thomson KS. Extended-spectrum-beta-lactamase, AmpC, and Carbapenemase issues. J Clin Microbiol. 2010;48:1019–1025. doi: 10.1128/JCM.00219-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhang K, McClure JA, Elsayed S, Conly JM. Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2009;53:531–540. doi: 10.1128/AAC.01118-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES